Primer combination and method for screening high-alkali elimination rice and application of primer combination and method

Abstract

The invention relates to the technical field of gene engineering, in particular to a primer combination and a method for screening high-alkali elimination rice and application of the primer combination and the method. The primer combination comprises an SNP (Single Nucleotide Polymorphism) site specific primer pair and a reverse primer, nucleotide sequences of an upstream primer and a downstream primer of the SNP site specific primer pair are sequentially as shown in SEQ ID No.1-2; and the nucleotide sequence of the reverse primer is as shown in SEQ ID No.3. A-GC and G-GC molecular markers are designed at the 6752756 position (A-GC and G-GC) of chr.6 by sequencing the ALK gene sequence, and each marker is composed of a pair of SNP (Single Nucleotide Polymorphism) allelic specific primers and a reverse primer so as to distinguish the A / G basic group of the site. If the basic group of the site is A, the site is a high alkali elimination value; if G is a low alkali elimination value. The primer combination provided by the invention can be used for screening rice with high alkali elimination value, the selection efficiency of breeding materials is improved, and the omission ratio is reduced.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to a primer combination and method for screening high alkali-inhibition value rice and applications thereof. Background Art

[0002] Rice is one of the main food crops in the world. In 2023, my country's rice planting area was 2.8991 million hectares, and the total rice output was 206.603 million tons. In recent years, with the improvement of material living standards, people have higher and higher requirements for rice quality, including taste quality including amylose content, gelatinization temperature, gelatin consistency, etc.

[0003] Gao Zhenyu et al. first cloned the ALK gene through positional cloning. The gene includes 8 exons and 7 introns. Based on the differences in ALK gene sequences among different varieties and the results of subtraction analysis, it is speculated that base substitutions in the coding region of the ALK gene may have caused changes in the structure of the branched starch crystal layer, thereby leading to changes in the gelatinization temperature. Further studies have found that the combination of three SNPs (4198A / T, 4329G / T, and 4330C / T) in the 8th exon of the ALK gene is crucial to the SSⅡa function and the gelatinization characteristics of starch. Li Chuang et al. analyzed 111 rice materials collected from the Hani terraces in Yunnan and found that the G-TT type was mainly indica rice, accounting for 75%; the A-GC type was mainly japonica rice, accounting for about 73%. Among the three combination types (A-GC, G-GC and G-TT) composed of these three SNPs, the A-GC and G-TT combinations mainly control low (<66℃) and medium-low (66-70℃) gelatinization temperatures, while the G-GC combination mainly controls medium-high (70-74℃) and high (>74℃) gelatinization temperatures.

[0004] Currently, most ALK gene detections are done on the A-GC and G-TT sites. These sites are only distributed at a high frequency in indica rice, but at a low frequency in japonica rice. The existing markers have low detection efficiency for japonica-type rice materials, and are difficult and inefficient to use in japonica rice or indica-japonica hybrid breeding. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a primer combination and method for screening high alkali-insoluble rice and its application. The primer combination provided by the present invention can screen high alkali-insoluble rice, improve the selection efficiency of breeding materials, and reduce the missed detection rate.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The invention provides a primer combination for screening high alkali elimination value rice, comprising a SNP site specific primer pair and a reverse primer;

[0008] The nucleotide sequences of the upstream primer and the downstream primer of the SNP site-specific primer pair are shown in SEQ ID No. 1 to 2 respectively;

[0009] The nucleotide sequence of the reverse primer is shown in SEQ ID No.3;

[0010] The SNP site is located at 6752756 of rice chr.6, and there is a base A / G mutation. When the base is A, the rice is a high alkali insoluble rice, and when the base is G, the rice is a low alkali insoluble rice. The gelatinization temperature of the high alkali insoluble rice is greater than 74°C, the gelatinization temperature of the low alkali insoluble rice is less than 66°C, the medium-low gelatinization temperature is 66-70°C, the medium-high gelatinization temperature is 70-74°C, and the high gelatinization temperature is greater than 74°C.

[0011] The present invention also provides a method for screening high alkali-elimination value rice, comprising the following steps:

[0012] 1) extracting rice genomic DNA, and amplifying the genomic DNA as a template using the primer combination described in the above technical solution to obtain an amplified product;

[0013] 2) reading the fluorescent signal of the amplification product obtained in step 1), and then analyzing and converting it to obtain the genotyping result. When the genotype is AA, the rice is a high alkali-absorbing rice;

[0014] When the genotype is GG, the rice is low alkali elimination value rice.

[0015] Preferably, the amplification system in step 1) is: 2×PARMS mastermix 5 μL, upstream primer 0.15 μL at a concentration of 10 μM, downstream primer 0.15 μL at a concentration of 10 μM, reverse primer 0.15 μL at a concentration of 10 μM, genomic DNA 10-100 ng, ddH 2 Add HO to make up to 10 μL.

[0016] Preferably, the amplification program is: 94°C for 20 min; 94°C for 20 s, 65-57°C with a decrease of 0.8°C for 1 min per cycle, 10 cycles; 94°C for 20 s, 57°C for 1 min, 32 cycles.

[0017] The present invention also provides application of the primer combination described in the above technical solution in japonica rice breeding.

[0018] The present invention also provides application of the primer combination described in the above technical solution in indica-japonica hybrid rice breeding.

[0019] Beneficial effects:

[0020] The present invention designs the molecular marker ALK-2 of A-GC and G-GC by sequencing the ALK gene sequence at 6752756 (i.e. A-GC and G-GC) of chr.6. The marker consists of a pair of SNP allele-specific primers and a reverse primer to distinguish the A / G bases at the site. If the base at the site is A, it is a high base elimination value; if it is G, it is a low base elimination value. The original marker ALK (published ALK molecular marker, used to detect SNP 6752887 (TT / GC) of chr.6) (ALK-Ftt (SEQ ID No.7): GAAGGTGACCAAGTTCATGCTTACAAGGAGAGCTGGAGGGGtt; ALK-Tgc (SEQIDNo.8): GAAGGTCGGAGTCAACGGATTTACAAGGAGAGCTGGAGGGGgc; ALK-R (SEQ ID No.9): CTGAGGTCCTGCGACATGC) and marker ALK-2 were used to simultaneously detect the G-GC, G-TT sites and A-GC, G-GC sites of 136 segregating generation indica-japonica hybrid breeding materials. Among them, 19 materials were detected as GC at the G-GC and G-TT sites, but AA at the A-GC and G-GC sites. The rest of the test results were consistent. This indicates that the molecular marker ALK-2 provided by the present invention can be used as an effective supplement to ALK in japonica rice or indica-japonica hybrid rice breeding materials, thereby improving the selection efficiency of breeding materials and reducing the missed detection rate.

[0021]

[0022] ALK gene amplification primers:

[0023] ALK-F (SEQ ID No. 5): CAGGGACACGATAAACTCTTCTT;

[0024] ALK-R (SEQ ID No. 6): GCATCAATGGACATAACAAACAC. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0026] Figure 1 The typing results of the ALK genotype of rice materials detected by the molecular marker ALK-2 described in the embodiment of the present invention, where A is blue near the X-axis, G is green near the Y-axis, and A / G is red in the middle. This color is not the inherent color of fluorescence. The typing diagram is processed by the signal later. It has no color itself, only clusters. The color is added in the software that generates the diagram for good-looking display. DETAILED DESCRIPTION

[0027] The invention provides a primer combination for screening high alkali insoluble rice, comprising a SNP site specific primer pair and a reverse primer; the nucleotide sequences of the upstream primer and the downstream primer of the SNP site specific primer pair are shown in SEQ ID No.1-2 respectively; the nucleotide sequence of the reverse primer is shown in SEQ ID No.3; the SNP site is located at 6752756 of rice chr.6, and there is a base A / G mutation, when the base is A, the rice is high alkali insoluble rice, and when the base is G, the rice is low alkali insoluble rice; the gelatinization temperature of the high alkali insoluble rice is greater than 74°C, the gelatinization temperature of the low alkali insoluble rice is less than 66°C, the medium-low gelatinization temperature is 66-70°C, the medium-high gelatinization temperature is 70-74°C, and the high gelatinization temperature is greater than 74°C.

[0028] SEQ ID No.1:

[0029] GAAGGTGACCAAGTTCATGCTCGGGCTGAGGGACACCA;

[0030] SEQ ID No.2:

[0031] GAAGGTCGGAGTCAACGGATTCGGGCTGAGGGACACCG;

[0032] SEQ ID No.3:

[0033] GAGCGCCTCGATGAGCTTG.

[0034] The present invention also provides a method for screening high alkali-elimination value rice, comprising the following steps:

[0035] 1) extracting rice genomic DNA, and amplifying the genomic DNA as a template using the primer combination described in the above technical solution to obtain an amplified product;

[0036] 2) reading the fluorescent signal of the amplification product obtained in step 1), and then analyzing and converting it to obtain the genotyping result. When the genotype is AA, the rice is a high alkali-absorbing rice;

[0037] When the genotype is GG, the rice is low alkali elimination value rice.

[0038] The present invention has no particular limitation on the method for extracting rice genomic DNA, and those skilled in the art may use conventional extraction methods.

[0039] In the present invention, the amplification system is preferably: 2×PARMS mastermix 5 μL, upstream primer 0.15 μL with a concentration of 10 μM, downstream primer 0.15 μL with a concentration of 10 μM, reverse primer 0.15 μL with a concentration of 10 μM, genomic DNA 10-100 ng, ddH 2 In the present invention, the amplification procedure is preferably: 94°C for 20 min; 94°C for 20 s, 65-57°C with a decrease of 0.8°C for 1 min per cycle, 10 cycles; 94°C for 20 s, 57°C for 1 min, 32 cycles.

[0040] After PCR is completed, the present invention preferably uses a TECAN infinite M1000 microplate reader to read the fluorescence signal, and then uses the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and output the genotype result according to different colors.

[0041] The present invention also provides application of the primer combination described in the above technical solution in japonica rice breeding.

[0042] The present invention also provides application of the primer combination described in the above technical solution in indica-japonica hybrid rice breeding.

[0043] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0044] Example 1

[0045] 1. DNA Extraction

[0046] 1. Take a rice leaf with a length and width of about 1 cm and put it into a deep well plate (96 wells 1.2 ml);

[0047] 2. Add 100 μL of 0.3 M sodium hydroxide and grind the sample at 50 Hz for 2 min (until the sample is completely ground).

[0048] 3. After grinding, centrifuge at 3000 rpm for 1 min and boil in water for 2 min;

[0049] 4. Add 200 μL 0.2 M Tris-HCl (pH 6.8-7.0) and mix well, then boil in water for 2 min.

[0050] 5. After the water bath is completed, centrifuge at 3000rpm for 1 minute, take the supernatant, dilute it 20 times, and freeze it at -20℃ as a template for subsequent PCR amplification.

[0051] 2. PCR Amplification

[0052] Table 1 PCR amplification reaction system is as follows (PARMS mix Wuhan Jingpeptide)

[0053]

[0054] Allele X primer SEQ ID No.1:

[0055] GAAGGTGACCAAGTTCATGCTCGGGCTGAGGGACACCA;

[0056] AlleleYprimer SEQ ID No.2:

[0057] GAAGGTCGGAGTCAACGGATTCGGGCTGAGGGACACCG;

[0058] Commonprimer SEQ ID No.3:

[0059] GAGCGCCTCGATGAGCTTG.

[0060] Table 2 PCR amplification reaction conditions are as follows (dual-head 384 PCR instrument ABI Gene Amp 9700)

[0061]

[0062] 3. Genotyping

[0063] After PCR was completed, the fluorescence signal was read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results were output according to different colors.

[0064] Table 3 Genotype results

[0065]

[0066]

[0067]

[0068]

[0069] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer combination for screening high alkalinity-inhibiting rice, characterized in that: Includes SNP site-specific primer pairs and reverse primers; The nucleotide sequences of the upstream primer and the downstream primer of the SNP site-specific primer pair are shown in SEQ ID No. 1 to 2 respectively; The nucleotide sequence of the reverse primer is shown in SEQ ID No.3; The SNP site is located at 6752756 of rice chr.6, and there is a base A / G mutation. When the base is A, the rice is a high alkali-insoluble rice, and when the base is G, the rice is a low alkali-insoluble rice; the gelatinization temperature of the high alkali-insoluble rice is greater than 74°C, and the gelatinization temperature of the low alkali-insoluble rice is less than 66°C.

2. A method for screening high alkalinity-inhibiting rice, characterized in that: The following steps are involved: 1) extracting rice genomic DNA, and amplifying the genomic DNA as a template using the primer combination of claim 1 to obtain an amplified product; 2) reading the fluorescent signal of the amplification product obtained in step 1), and then analyzing and converting it to obtain the genotyping result. When the genotype is AA, the rice is a high alkali-absorbing rice; When the genotype is GG, the rice is low alkali elimination value rice.

3. The method according to claim 2, characterized in that The amplification system in step 1) is: 5 μL of 2×PARMS mastermix, 0.15 μL of an upstream primer at a concentration of 10 μM, 0.15 μL of a downstream primer at a concentration of 10 μM, 0.15 μL of a reverse primer at a concentration of 10 μM, 10-100 ng of genomic DNA, and ddH2O to make up to 10 μL.

4. The method according to claim 2 or 3, characterized in that: The amplification program is: 94°C for 20 min; 94°C for 20 s, 65-57°C with a decrease of 0.8°C for 1 min per cycle, 10 cycles; 94°C for 20 s, 57°C for 1 min, 32 cycles.

5. Use of the primer combination according to claim 1 in japonica rice breeding.

6. Use of the primer combination according to claim 1 in indica-japonica hybrid rice breeding.

Images