Primers and probes for detecting toxin-producing Pseudo-nitzschia polytricha and their applications, kits and detection methods

Abstract

The present invention belongs to the field of marine environmental protection, and is a primer and probe for detecting toxin-producing Pseudo-nitzschia multi-striped algae, as well as an application, a kit and a detection method. The primers for detecting toxin-producing Pseudo-nitzschia multi-striped algae are upstream primer: Dab A_A5F 5'-GATCCSTTCAACTCRGTCTTYATTCTCA-3'; downstream primer: Dab A_A5R 5'-CATAYCCRATCAAVGAWTCTTCTCKGGTC-3'. The specific primers and probes provided by the present invention can detect and monitor toxin-producing Pseudo-nitzschia multi-striped algae in my country's offshore waters, and have the advantages of high specificity, high sensitivity, simple operation, rapid detection and wide detection range.

Description

Technical Field

[0001] The invention belongs to the field of marine environmental protection and relates to primers and probes for detecting toxin-producing Pseudo-nitzschia polytricha, as well as applications, a kit and a detection method. Background Art

[0002] Pseudo-nitzschia Pseudo-nitzschia ) is a globally distributed marine planktonic diatom that plays a vital role as a primary producer in the marine biogeochemical cycle; it also exists as a toxic harmful algal bloom species, often causing blooms in coastal areas and open ocean areas because it can produce amnesia shellfish poisoning ( amnesic shellfish toxin ) - Domoic Acid (DA) has attracted much attention. Domoic acid is transmitted through the food web at different biological trophic levels, causing poisoning and death of a large number of marine animals such as sea lions and seabirds. The toxin can lead to the closure of shellfish fisheries and even endanger human health. The poisoning incidents also pose a huge challenge to the monitoring and early warning of Pseudo-nitzschia red tides. There have been many outbreaks of Pseudo-nitzschia red tides and toxin hazards caused by excessive domoic acid content around the world. Pseudo-nitzschia red tide incidents have also been reported in Chinese waters. To date, 61 species have been confirmed to exist in the genus Pseudo-nitzschia, of which 29 have been shown to produce domoic acid, including Pseudo-nitzschia multiseriformes ( P. multiseries ) ， Pseudo-nitzschia polytricha P. multistriata ), Pseudo-nitzschia tenuifolia ( P. delicatissima ) etc. Recently in 2018, the toxin production mechanism was revealed at the molecular level, and the gene cluster for domoic acid synthesis was discovered.

[0003] The morphological differences between species within the genus Pseudo-nitzschia are often small. Similarly, the morphological differences between toxin-producing Pseudo-nitzschia species and non-toxin-producing Pseudo-nitzschia species are difficult to distinguish through traditional detection methods based on morphological characteristics. Pseudo-nitzschia red tides are usually caused by the joint action of multiple species, and it is impossible to accurately obtain identification. At present, there are many molecular detection methods for monitoring Pseudo-nitzschia, most of which are relatively complicated operations and require the help of complex instruments. Field detection is difficult to implement, so it is impossible to detect toxin-producing Pseudo-nitzschia red tides in a timely manner, which poses a challenge to the prevention and control of red tide disasters. In addition, there are few molecular-level detections for toxin-producing and harmful Pseudo-nitzschia species. In summary, there is great potential and advantage in identifying toxin-producing Pseudo-nitzschia based on the toxin-producing genes of Pseudo-nitzschia. It is necessary to establish a method with high sensitivity, wide detection range, simple operation, and specific rapid quantitative detection of toxin-producing Pseudo-nitzschia in the field to monitor and prevent toxin-producing Pseudo-nitzschia red tides in my country's coastal waters and reduce the risk of exposure to domoic acid toxins. Summary of the invention

[0004] The present invention aims to provide a method for detecting toxin-producing Pseudo-nitzschia multistriata (Pseudo-nitzschia multistriata) in the field with rapid detection, high sensitivity, simple operation and convenient operation. P. multistriata ) specific primers and probes and applications, kits and detection methods.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] A primer for detecting toxin-producing Pseudo-nitzschia polytricha, the primer is

[0007] Upstream primer: Dab A_A5F 5′-GATCCSTTCAACTCRGTCTTYATTCTCA-3′;

[0008] Downstream primer: Dab A_A5R 5′-CATAYCCRATCAAVGAWTCTTCTCKGGTC-3′.

[0009] A probe for detecting toxin-producing Pseudo-nitzschia polytricha, the probe being RPA-PMA-1P;

[0010] RPA-PMA-1P is

[0011] 5'-GGCATTCTTGAAGCTCAAGGATGAAATTCT(THF)GAATCGGCTCGGAC-3'.

[0012] The 5' end of the downstream primer in the primers is labeled with biotin;

[0013] The 5' end of the probe was labeled with carboxyfluorescein 6'-FAM, the 31st base thymine T was replaced with tetrahydrofuran THF residue, and the 3' end was labeled with C3 Spacer.

[0014] An application of the primers, wherein the primers are used in the rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia multistriata.

[0015] An application of the primers and probes, wherein the primers and probes are used in the rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia multistriata.

[0016] A kit for rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia polytricha, comprising the specific primers and the probe.

[0017] A method for rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia multistriata, which uses the total genomic DNA of Pseudo-nitzschia multistriata in a sample to be detected as a template, uses the specific primers and the probe to perform a recombinase polymerase amplification (RPA) reaction, and then performs a lateral flow test strip (LFD) detection on the reaction product, thereby qualitatively and / or quantitatively detecting the toxin-producing Pseudo-nitzschia multistriata.

[0018] The recombinase amplification (RPA) reaction kit (KS105, Suzhou Xinda Biotechnology Co., Ltd., China) was used for the recombinase amplification (RPA) reaction. The total reaction volume was 50 μL, including one portion of recombinase polymerase amplification (RPA) reaction reagent dry powder, 20 μL of dissolving agent, 21.2 μL of nuclease-free water, 2.1 μL of 10 μM upstream primer, 2.1 μL of 10 μM downstream primer, 0.6 μL of 10 μM probe, 2 μL of DNA template, and 2 μL of activator.

[0019] The recombinase polymerase amplification (RPA) reaction conditions are 37°C for 30 minutes. When the reaction is carried out for 4 minutes, the reaction tube is taken out and slightly shaken, and then quickly centrifuged and returned to 37°C for amplification.

[0020] The lateral flow test strip (LFD) test of the recombinase polymerase amplification (RPA) reaction product was taken and added to a 1.5 mL sterile centrifuge tube, diluted 40 times with a nuclease-free aqueous solution, and the matching lateral flow test strip (TS101, Suzhou Xinda Biotechnology Co., Ltd., China) was inserted into the centrifuge tube, and the test result was interpreted after 10 minutes.

[0021] The recombinase polymerase amplification RPA reaction appears a band at 211bp, which can qualitatively detect the toxin-producing Pseudo-nitzschia multi-stripes; then, a qualitative test is performed according to the detection line on the lateral flow test strip LFD. The simultaneous appearance of the quality control line and the detection line on the lateral flow test strip is a positive result, the appearance of only the quality control line is a negative result, and the absence of both the quality control line and the detection line makes the result invalid; then, the density of Pseudo-nitzschia multi-stripes in the sample is quantitatively detected according to the color depth of the detection line of the lateral flow test strip LFD.

[0022] When a test line appears on the lateral flow test strip LFD, its image is converted into a grayscale image using PhotoShop CC 2024 software, and the grayscale value is measured. The grayscale value T of the test line and the grayscale value C of the control line are respectively subtracted from the background grayscale value B of the test strip. The relationship between the ratio S= (TB) / (CB) of the two and the DNA template of the Pseudo-nitzschia multiflora cells of the recombinase polymerase amplification RPA reaction is used to quantitatively detect the Pseudo-nitzschia multiflora in the sample.

[0023] The present invention has the following advantages:

[0024] The detection method of the present invention uses the Dab A gene in the toxin synthesis gene cluster of Pseudo-nitzschia as the target region, and has the ability to distinguish the toxin-producing Pseudo-nitzschia species. P. multistriata ), Pseudo-nitzschia multiseriformis ( P. multiseries ), Pseudo-nitzschia acuminatum ( P. cuspidata ), Pseudo-nitzschia in series ( P. seriata ) and Pseudo-nitzschia australis ( P. austrails Specific recombinase polymerase amplification (RPA) primers were designed for the conserved region of the toxin synthesis gene Dab A of the five species, and specific probes for the target region of Pseudo-nitzschia multiflora were designed, and lateral flow test strips (LFD) were used for detection; specifically,

[0025] 1. High specificity. The recombinase polymerase amplification-lateral flow test strip (RPA-LFD) detection method of the present invention can specifically detect Pseudo-nitzschia multiflora;

[0026] 2. High sensitivity. The detection limit of the recombinase polymerase amplification-lateral flow test strip (RPA-LFD) detection method of the present invention is less than 1 cell per milliliter, which can detect low-density Pseudo-nitzschia multiflora in the sea area, and is helpful for early monitoring and early warning of Pseudo-nitzschia multiflora red tide;

[0027] 3. Wide detection range. The quantitative detection range of the recombinase polymerase amplification-lateral flow test strip (RPA-LFD) detection method of the present invention is 4.78×10 -1 cells / mL-4.78×10 4 cells / mL, with a wide detection range of 5 orders of magnitude;

[0028] 4. Easy to operate. The recombinase polymerase amplification-lateral flow test strip (RPA-LFD) detection method of the present invention only needs to be reacted at a constant temperature of 37°C, and does not need to rely on professional instruments such as PCR instruments;

[0029] 5. Fast detection speed. In the recombinase polymerase amplification-lateral flow test strip (RPA-LFD) detection method of the present invention, the recombinase polymerase amplification reaction only takes 30 minutes, and the lateral flow test strip (RPA-LFD) detection only takes 10 minutes. The entire detection process can be completed in a short time. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The electrophoretic diagram of the recombinase polymerase amplification (RPA) reaction products of toxin-producing Pseudo-nitzschia spp. under different reaction temperature conditions provided in the embodiments of the present invention.

[0031] Figure 2 This is an electrophoresis diagram of the recombinase polymerase amplification (RPA) reaction products of toxin-producing Pseudo-nitzschia under different reaction time conditions provided in an embodiment of the present invention.

[0032] Figure 3The specificity verification electrophoresis diagram and lateral flow test strip (LFD) display result diagram of the recombinase polymerase amplification (RPA) reaction provided in the embodiment of the present invention are as follows: Figure 3 In the figure a is the electrophoresis diagram. Figure 3 Middle b is the result display diagram of lateral flow test strip (LFD); 1-3 are 3 positive target algae, 4-23 are 20 negative algae strains, 1-3 are positive algae - multi-striped Pseudo-nitzschia, multi-column Pseudo-nitzschia, pointed Pseudo-nitzschia; 4-23 are negative algae - American Pseudo-nitzschia, Brazilian Pseudo-nitzschia, weak Pseudo-nitzschia, Galaxy Pseudo-nitzschia, Microporous Pseudo-nitzschia, Hainan Pseudo-nitzschia, Spiky Pseudo-nitzschia, Spiky Pseudo-nitzschia, Akashiwo Heterosigma, Strong Anterior Groove Algae, Globular Isochrysis, Mascheroni, Weishi Sea Algae, Alexandrium Tammar, Karenia mikimoto, Prorocentrum donghaiense, Golden Globe Algae, Mucker's Ceratocystis, Marine Shield Algae, Spherical Brown Algae, NC is the blank control.

[0033] Figure 4 The present invention provides a schematic diagram of the quantitative analysis principle of the grayscale ratio method of the lateral flow test strip (LFD) test line and quality control line for Pseudo-nitzschia polyphylla (LFD 1-7 test strips correspond to DNA template amounts of 4×10 1 , 4×10 0 , 4×10 -1 , 4×10 -2 , 4×10 -3 , 4×10 -4 and 4×10 -5 ng, NC was blank control).

[0034] Figure 5 A relationship diagram between the grayscale ratio of a lateral flow test strip (LFD) and the amount of DNA template in a recombinase polymerase amplification (RPA) reaction for Pseudo-nitzschia polyphylla is provided for an embodiment of the present invention.

[0035] Figure 6 Cell density detection limit diagram of the Pseudo-nitzschia polymorpha recombinase polymerase amplification-lateral flow test strip (RPA-LFD) detection method provided in the embodiment of the present invention (LFD 1-7 test strips correspond to cell densities of 4.78×10 4 4.78×10 3 4.78×10 2 4.78×10 1 4.78×10 0 4.78×10 -1 and 4.78×10 -2 cells / ml, NC was blank control). DETAILED DESCRIPTION

[0036] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention.

[0037] Example 1

[0038] Establishment of the recombinase polymerase amplification (RPA) detection method for Pseudo-nitzschia multiflora:

[0039] 1.1 Design of primers and probes

[0040] The conserved regions of the toxin synthesis gene Dab A of five species, including Pseudomettschia multistriata, Pseudomettschia multiseriate, Pseudomettschia acuminate, Pseudomettschia in series and Pseudomettschia australis, were aligned in MEGA v7.0.26, and specific recombinase polymerase amplification-lateral flow strip (RPA-LFD) primers were designed using Primer 6.0 software. In addition, a specific probe for the target region of Pseudomettschia multistriate was designed (upstream primer: Dab A_A5F 5'-GATCCSTTCAACTCRGTCTTYATTCTCA-3' (sequence 1); downstream primer: Dab A_A5R 5'-CATAYCCRATCAAVGAWTCTTCTCKGGTC-3' (sequence 2); probe: RPA-PMA-1P GGCATTCTTGAAGCTCAAGGATGAAATTCT(THF)GAATCGGCCTCGGAC (sequence 3)). The 5' end of the downstream primer is labeled with biotin; the 5' end of the probe is labeled with carboxyfluorescein 6'-FAM, the 31st base (thymine T) is replaced with tetrahydrofuran (THF) residue, and the 3' end is labeled with C3 Spacer.

[0041] 1.2 Optimization of reaction conditions

[0042] The temperature gradient was set at 35℃, 37℃, 39℃ and 41℃, and the effect of temperature on the recombinase polymerase amplification (RPA) reaction was analyzed to determine the most suitable reaction temperature. The reaction time was optimized at the optimal temperature, and the time was set to 10min, 20min, 30min and 40min. The recombinase polymerase amplification (RPA) kit used for reaction condition optimization was TwistAmp Basic Kit (TwistDX, Maidenhead, UK), and the total reaction volume was 50μL, including one recombinase polymerase amplification (RPA) reaction reagent dry powder, 29.5μL of Primer Free Rehydration buffer, 11.2μL of nuclease-free water, 2.4μL of 10μM upstream primer, 2.4μL of 10μM downstream primer, 2μL of DNA template, and 2.5μL of activator. After purification, the amplified product was analyzed by 2% agarose gel electrophoresis to determine the optimal amplification conditions.

[0043] The results showed that when the amplification temperature was 39℃ and 41℃, the positive target algae Pseudo-nitzschia acuminatum had no target band or the brightness of the target band was limited; when the amplification temperature was 37℃, all three positive target algae could produce relatively bright target amplification bands (the target product size was 211bp, see Figure 1 ). Therefore, 37℃ is the appropriate temperature for recombinase polymerase amplification (RPA) reaction. When the amplification time is 10min, 20min and 40min, the positive target algae Pseudo-nitzschia acuminata has no target band or the brightness of the target band is limited; when the amplification time is 30min, the target amplification band can be generated (see Figure 2 ). Therefore, 30 min is a suitable time for recombinase polymerase amplification (RPA) reaction.

[0044] The results showed that the optimal reaction conditions for recombinase polymerase amplification (RPA) of toxin-producing Pseudo-nitzschia were 37°C for 30 min.

[0045] Example 2

[0046] Specificity verification of recombinase polymerase amplification (RPA) of toxigenic Pseudo-nitzschia

[0047] Known algae strains were selected for specific verification. All algae strains are known and can be obtained through public platforms. The algae strains in this experiment are the existing Pseudo-nitzschia species in the laboratory, including Pseudo-nitzschia multistriata ( P. multistriata , 1) Pseudo-nitzschia multiseriformis ( P. multiseries , 2), Pseudo-nitzschia acuminatum ( P. cuspidata , 3), Pseudo-nitzschia americana ( P. americana , 4), Pseudo-nitzschia brasiliensis ( P. brasiliana, 5) Pseudo-nitzschia tenuifolia ( P. delicatissima , 6), Pseudo-nitzschia galaxica ( P. galaxiae , 7), Pseudo-nitzschia micropora ( P. micropora , 8), Hainan Pseudo-nitzschia ( P. hainanensis , 9), 2 Pseudo-nitzschia spicata ( P. pungens , 10 and 11 were isolated from stations C3 and D5 in Jiaozhou Bay, respectively), of which Pseudo-nitzschia multistriata, Pseudo-nitzschia multiseriate and Pseudo-nitzschia acuminate were positive target algae, and the others were negative controls, and 12 strains of other genera were used for negative control verification, including Heterosigma akashiwo ( Heterosigma akashiwo , 12), Strong front algae ( Amphidinium carterae , 13), Isochrysis galbana ( Isochrysis galbana , 14), Skeletonema martensii ( Skeletonema marinoi , 15), Thalassiosira wiseri ( Thalassiosira weissflogii , 16), Alexandrium tamarense ( Alexandrium tamarense , 17), Karenia mikimotoi ( Karenia mikimotoi , 18), Prorocentrum donghaiense ( Prorocentrum donghaiense , 19), inhibiting the feeding of golden algae ( Aureococcus anophagefferens , 20), Chaetoceros muelleri ( Chaetoceros muelleri , 21), marine card shield algae ( Chattonella marina , 22), spherical brown cysts ( Phaeocystis globosa ,twenty three).

[0048] DNA of each algae was extracted, and then amplified and electrophoresed on 2% agarose gel using the specific primers and probes described in the above examples and the corresponding method of TwistAmpBasic Kit (TwistDX, Maidenhead, UK) by determining the conditions of the recombinase polymerase amplification (RPA) reaction according to the above examples. The specificity of the probe was also tested using the recombinase polymerase amplification-horizontal test strip method.

[0049] The specific method is as follows: the kit used for the recombinase polymerase amplification (RPA) reaction is TwistAmp Basic Kit (TwistDX, Maidenhead, UK), the total reaction volume is 50 μL, including one recombinase polymerase amplification (RPA) reaction reagent dry powder, 29.5 μL of buffer (Primer Free Rehydration buffer), 11.2 μL of nuclease-free water, 2.4 μL of 10 μM upstream primer, 2.4 μL of 10 μM downstream primer, 2 μL of DNA template, 2.5 μL of activator, and the reaction conditions are the 37°C amplification reaction for 30 minutes determined in Example 1, and the reaction is continued after shaking and rapid centrifugation for 4 minutes. After the amplification product is purified, the product is verified by 2% agarose gel electrophoresis. The fragment size of the amplification product in this example is 211 bp. The recombinase polymerase amplification-lateral test strip method (RPA-LFD) used in this example adopts a test strip type nucleic acid recombinase amplification (RPA) reaction kit (KS105, Suzhou Xinda Biotechnology Co., Ltd., China) to perform the recombinase amplification (RPA) reaction. The total reaction volume is 50 μL, including one portion of recombinase polymerase amplification (RPA) reaction reagent dry powder, 20 μL of dissolving agent, 21.2 μL of nuclease-free water, 2.1 μL of 10 μM upstream primer, 2.1 μL of 10 μM downstream primer, 0.6 μL of 10 μM probe, 2 μL of DNA template, and 2 μL of activator. The reaction conditions are 37°C amplification reaction for 30 minutes. When the reaction is carried out for 4 minutes, the reaction tube is taken out and slightly shaken, and then quickly centrifuged and returned to 37°C for amplification. After the reaction, take 5 μL of recombinase polymerase amplification (RPA) reaction product and add it to a 1.5 mL sterile centrifuge tube, dilute it 40 times with a nuclease-free aqueous solution, insert the matching lateral flow test strip (TS101, Suzhou Xinda Biotechnology Co., Ltd., China) into the centrifuge tube, and read the test results after 10 minutes. A positive result is the simultaneous appearance of the quality control line and the test line.

[0050] The results showed that the recombinase polymerase amplification (RPA) reaction products were detected by agarose gel electrophoresis. Only the positive target algae produced a specific amplification band at the position of 211 bp in size, while the other 20 negative test algae species did not produce amplification bands (see Figure 3 According to the verification results of the reaction products of the recombinase polymerase amplification-horizontal test strip method displayed on the test strip, only Pseudo-nitzschia multiflora was detected (see Figure 3 (b)

[0051] The results showed that the established recombinase polymerase amplification (RPA) method could specifically detect the toxigenic Pseudo-nitzschia, and the established recombinase polymerase amplification-horizontal test strip method could specifically detect Pseudo-nitzschia multistriata.

[0052] Example 3

[0053] Quantitative detection effectiveness analysis based on the grayscale ratio between the test line and the quality control line of the lateral flow test strip (LFD)

[0054] In order to verify whether there is a dose-effect relationship between the amount of DNA template and the color development effect of the test strip test line, a DNA solution of Pseudo-nitzschia multiflora with a concentration of 20 ng / μL was taken and diluted 10 times in a row for 6 times. The original DNA solution and the dilution were used as templates to carry out the recombinase polymerase amplification (RPA) reaction according to the optimal conditions described in Example 1. The recombinase polymerase amplification (RPA) product was then detected by lateral flow test strips (LFD) according to the method described in Example 2. After the test strips were completely colored, the results were photographed. It was then converted into a grayscale image (Photoshop CC 2019, Adobe), and the grayscale value was determined using the software. The grayscale value of the test line (T) and the grayscale value of the quality control line (C) were subtracted from the background grayscale value of the test strip (B), and the ratio of the two was calculated S= (TB) / (CB) (see Figure 4 ), and compared this ratio with the log of Pseudo-nitzschia multiflora in the recombinase polymerase amplification (RPA) reaction. 10 A linear relationship analysis was performed between (DNA amount).

[0055] The results showed that when the amount of DNA was 4×10 -1 ng-4×10 1 The detection results were displayed in the range of ng, and the lower limit of cell density detection of the Pseudo-nitzschia polymorpha recombinase polymerase amplification-lateral flow test strip (RPA-LFD) detection method was 4×10 - 1 ng. Within the set DNA concentration range, the color of the test strip detection line has a more obvious gradient change; in log 10 The curve was established with (DNA amount) as the horizontal axis and grayscale ratio S as the vertical axis. It was found that the amount of DNA template was 4×10 -5 ng-4×10ng, there is a good linear relationship between the two (R 2 =0.7079)(See Figure 5 ).

[0056] The results showed that the detection range of DNA quantity was 4×10 -1 ng-4×10 1 The minimum detectable DNA content is 0.4 ng, and the lateral flow test strip (LFD) has good sensitivity for Pseudo-nitzschia multiflora. The grayscale ratio S of the color development result can be used to quantify the amount of DNA template.

[0057] Example 4

[0058] Determination of the detection limit of the recombinase polymerase amplification-lateral flow test strip (RPA-LFD) rapid detection method

[0059] The Pseudo-nitzschia multiflora strain was counted in a cell counting chamber, and the cell density of 50 ml was 4.78×10 4 cells / ml of the target algae solution, and the 10-fold gradient dilution was performed six times in succession, and the final cell density gradient was 4.78×10 4 ~4.78×10 -2 7 samples with 45 ml of each sample were prepared, and DNA was extracted using a DNA extraction kit (Tiangen Biotech, Beijing), followed by amplification using recombinase polymerase according to the optimal conditions described in Example 1, and then reacted using a lateral flow test strip (RPA-LFD) rapid detection method.

[0060] The results showed that when the cell density was 4.78×10 -1 cells / mL-4.78×10 4 The detection results were displayed in the range of cells / mL. The cell density detection limit of the Pseudo-nitzschia polymorpha recombinase polymerase amplification-lateral flow test strip (RPA-LFD) detection method was 4.78×10 -1 cells / mL (see Figure 6 ).

[0061] The results showed that the detection range was 4.78×10 -1 cells / mL-4.78×10 4 cells / mL, indicating that this method has a wide detection range for the cell density of Pseudo-nitzschia multistriata.

Claims

1. A primer and probe combination for detecting toxin-producing Pseudo-nitzschia polytricha, characterized in that: Primer Upstream primer: Dab A_A5F 5′-GATCCSTTCAACTCRGTCTTYATTCTCA-3′; Downstream primer: Dab A_A5R 5′-CATAYCCRATCAAVGAWTCTTCTCKGGTC-3′; The probe is RPA-PMA-1P; RPA-PMA-1P is 5'-GGCATTCTTGAAGCTCAAGGATGAAATTCT(THF)GAATCGGCCTCGGAC-3', the thymine T at the 31st base is replaced by a tetrahydrofuran (THF) residue.

2. The primer and probe composition according to claim 1, characterized in that: The 5' end of the downstream primer in the primers is labeled with biotin; The 5' end of the probe was labeled with carboxyfluorescein 6'-FAM, and the 3' end was labeled with C3 Spacer.

3. An application of the primer and probe combination according to claim 1, characterized in that: The invention discloses a primer and a probe combination for rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia multistriata.

4. A kit for rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia polytricha, characterized in that: The kit comprises the primer and probe combination according to claim 1.

5. A method for rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia polytricha, characterized in that: The total DNA of the Pseudo-nitzschia genome in the sample to be detected is used as a template, and the primer and probe combination described in claim 1 is used to perform a recombinase polymerase amplification (RPA) reaction, and the reaction product is then subjected to a lateral flow test strip (LFD) detection, thereby qualitatively and / or quantitatively detecting the toxin-producing Pseudo-nitzschia multistriata.

6. The method for rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia polytricha according to claim 5, characterized in that: The recombinase polymerase amplification RPA reaction produces a band at a size of 211 bp, which can qualitatively detect the toxin-producing Pseudo-nitzschia multi-stripes; then, a qualitative detection is performed based on the detection line on the lateral flow test strip LFD; and then, the density of Pseudo-nitzschia multi-stripes in the sample is quantitatively detected based on the color depth of the detection line on the lateral flow test strip LFD.

7. The method for rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia polytricha according to claim 5, characterized in that: The recombinase polymerase amplification RPA reaction conditions are 37°C amplification reaction for 30 minutes. When the reaction is carried out for 4 minutes, the reaction tube is taken out and slightly shaken, and then quickly centrifuged and returned to the 37°C condition for amplification reaction.

8. The method for rapid qualitative and / or quantitative detection of toxin-producing Pseudo-nitzschia polytricha according to claim 5 or 6, characterized in that: When a detection line appears on the lateral flow test strip LFD, its image is converted into a grayscale image, and the grayscale value is measured. The grayscale value T of the detection line and the grayscale value C of the quality control line are respectively subtracted from the background grayscale value B of the test strip. The relationship between the ratio S= (TB) / (CB) of the two and the DNA template of the Pseudo-nitzschia multiflora cells of the recombinase polymerase amplification RPA reaction is used to quantitatively detect the Pseudo-nitzschia multiflora in the sample.

Images