A KASP molecular marker for identifying soybean low-temperature phenotype and its application

Abstract

The present invention discloses a KASP molecular marker for identifying the low-temperature phenotype of soybean and its application, belonging to the technical field of molecular biology. The present invention identifies the low-temperature phenotype of 184 resequenced soybean materials and develops a molecular marker related to the low-temperature tolerance of soybean. The molecular marker can be used to quickly identify the low-temperature phenotype of soybean and assist in screening soybean lines that are resistant to or not resistant to low temperatures. The present invention can effectively promote the progress of soybean molecular breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a KASP molecular marker for identifying soybean low-temperature phenotype and an application thereof. Background Art

[0002] Soybean ( Glycine max L .) is one of the important food crops originating in my country. It is deeply loved by consumers at home and abroad because it is rich in nutrients such as protein, amino acids, lecithin, soy isoflavones, etc.

[0003] The soybean planting area in Northeast my country accounts for about 50% of the total planting area in China, and the soybean production in this region is seriously restricted by the weather. The frost-free period in Northeast China is short, and the accumulated temperature range from 1900℃ to 2700℃ in the sixth accumulated temperature zone to the first accumulated temperature zone, with large temperature changes. Soybeans are thermophilic crops, and low temperature is one of the important factors limiting soybean production. Generally, low temperature years are also years of reduced soybean production. The optimal growth temperature for soybean seedlings is 20-21℃. If the average temperature during the soybean seedling stage is lower than 15℃, it will delay soybean growth and inhibit the production of new leaves and new shoots. If it is in a low temperature environment for a long time, it will directly cause a reduction in production by inhibiting flowering and reducing the number of pods.

[0004] By identifying the low-temperature phenotype of cultivated soybean seedling materials and developing low-temperature-related molecular markers, we can quickly identify soybean cultivation materials that are resistant to low temperatures at the seedling stage, which is helpful for the screening of low-temperature resistant materials and the breeding of new varieties. KASP genotyping detection is a fluorescence-based detection marker used to identify single nucleotide polymorphism (SNP) variation sites. It is a new generation of SNP typing markers and has been applied to a variety of crops, such as the identification of disease-resistant materials in wheat. Summary of the invention

[0005] In view of the shortcomings of existing technologies, in order to discover new genes for low temperature tolerance in soybean seedling stage, this project conducted low temperature phenotype identification and resequencing on 184 modern cultivation materials in soybean seedling stage, and conducted genome-wide association analysis (GWAS) on low temperature related light and indicators: chlorophyll fluorescence index (Fv / Fm), and discovered a series of low temperature tolerance related QTLs on chromosome 12. Based on the previous research results, this project developed a series of KASP molecular markers using the discovered QTLs. This application applied to one of the pairs significantly associated with low temperature phenotypes ( p <0.05), which can be used to quickly scan germplasm resources and assist in identifying low-temperature-resistant materials.

[0006] The technical solution of the present invention mainly includes the following contents:

[0007] In one aspect, the present invention provides a KASP molecular marker for identifying a low-temperature phenotype of soybean, wherein the molecular marker is located at the 97th base of the sequence shown in SEQ ID NO.4, and an A / T base mutation exists at the 97th base.

[0008] Furthermore, the present invention also provides a KASP primer for detecting the molecular marker, wherein the KASP primer includes a common upstream primer 391F and a downstream primer 391-FAM-R and a downstream primer 391-HEX-R;

[0009] The nucleotide sequence of the common upstream primer 391F is: GGTTAGTGAGTACCATCTCAG;

[0010] The nucleotide sequence of the downstream primer 391-FAM-R is: GAAGGTGACCAAGTTCATGCTTTGTATTACCAACCATTTTTTTTTA;

[0011] The nucleotide sequence of the downstream primer 391-HEX-R is: GAAGGTCGGAGTCAACGGATTTTGTATTACCAACCATTTTTTTTTT;

[0012] Furthermore, the present invention provides a detection kit for the molecular marker, which comprises the KASP primers.

[0013] In a second aspect, the present invention also relates to an application of the molecular marker, the KASP primer or the detection kit:

[0014] (1) Identification of soybean low temperature phenotype;

[0015] (2) Screening soybean lines that are resistant to or not resistant to low temperatures.

[0016] In a third aspect, the present invention provides a method for identifying a soybean low-temperature phenotype, comprising the following steps: using the genomic DNA of the soybean sample to be tested as a template, performing PCR amplification on the DNA template using the KASP primers or the detection kit, and using the amplification result to determine the tolerance of the soybean to low temperature.

[0017] Furthermore, if the amplification result shows that the base mutation of the molecular marker is T, the soybean sample to be tested is judged to be a low-temperature resistant material; if the amplification result shows that the base mutation of the molecular marker is A, the soybean sample to be tested is judged to be a low-temperature intolerant material.

[0018] Furthermore, the PCR amplification program is: 94°C pre-denaturation for 15 min, 94°C denaturation for 20 s, 61-55°C gradient annealing / extension for 60 s, 10 cycles, decreasing 0.6°C in each cycle; 94°C denaturation for 20 s, 55°C annealing / extension for 60 s, 29 cycles.

[0019] Furthermore, the PCR amplification system is: 2×KASP Mix 5 μL, primer working solution 0.112 μL, DNA template 2 μL and ddH2O, with a total volume of 10 μL.

[0020] Beneficial effects of the present invention:

[0021] The present invention identified the low-temperature phenotype of 184 resequenced soybean materials and developed molecular markers related to soybean low-temperature tolerance. The molecular markers can be used to quickly identify the low-temperature phenotype of soybean and assist in screening soybean lines that are resistant to or not resistant to low temperatures. The present invention can effectively promote the progress of soybean molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 .Use GWAS to mine candidate SNPs related to low temperature tolerance. A: The low temperature related SNP loci found by the FarmCPU model and the linkage disequilibrium (LD) map 100kb upstream and downstream of the significant SNP loci. The map shows that there is linkage disequilibrium in this interval. B: BBX The gene expression level increases under low temperature induction. C: BBX The SNP sites present in the gene promoter, gene region and 3'UTR region form two haplotypes in cultivated varieties.

[0023] Figure 2 . KASP typing diagram of cultivated soybean (partial sample identification diagram). Black circles represent blank controls, red circles represent low-temperature intolerant materials (haplotype II: H2, base type A), and blue circles represent low-temperature tolerant materials (haplotype I: H1, base type T). DETAILED DESCRIPTION

[0024] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0025] 1. High-throughput sequencing and data analysis

[0026] 188 soybean materials from low and middle latitudes were selected for whole genome resequencing. After seedlings in the greenhouse, leaves were taken and sent to BGI for DNA extraction, second-generation library construction and high-throughput sequencing. Each material was tested 10×. The offline data was filtered using Trimmomatic v0.38 software to remove the linker and other sequences, and then sentieon commercial software was used for SNP calling. The reference genome was Williams 82 v.2.1. After obtaining the vcf file, the vcftools tool was used for filtering. The parameters were: vcftools --vcf 188.vcf --recode-INFO-all --max-alleles 2 --min-alleles 2 --minDP 4 --maxDP 60 --minQ 30 --max-missing 0.9 --out groupall--recode, and finally 3,749,796 high-quality SNP markers were obtained.

[0027] 2. Obtaining soybean low temperature tolerance index (chlorophyll fluorescence parameter Fv / Fm) and GWAS association analysis

[0028] The low temperature phenotype of the seedlings was identified for the 188 resequenced materials. All materials were grown at 22°C until the first pair of three compound leaves stretched flat (about 20 days), and then transferred to 4°C for low temperature treatment for 5 days. The chlorophyll fluorescence parameter Fv / Fm was measured before and after treatment. In order to eliminate the data differences between species, the Fv / Fm value after low temperature treatment was divided by the Fv / Fm value before low temperature treatment to obtain the ratio before and after treatment, that is, Fv / Fm 前 Divide by Fv / Fm 后 =Fv / Fm. The FarmCPU model was used to perform a genome-wide association study (GWAS) of Fv / Fm values ​​with 3,749,796 high-quality SNP markers using GAPIT software. The FarmCPU model obtained SNP sites greater than the threshold on chromosomes 3, 4, 6, 10, 11, 12, 15, and 16. By performing linkage disequilibrium analysis (LD) on the sequences 100 kb upstream and downstream of the SNP site, it was found that a SNP located on chromosome 12 was in linkage disequilibrium 100 kb upstream and downstream ( Figure 1 , A). After annotating all genes in this segment, we found a BBX gene family members, the gene expression level increases after low temperature induction ( Figure 1 , B).

[0029] 3. Development of KASP primers and specific operation methods

[0030] Haplotype analysis of the gene revealed that the gene had two haplotypes in 184 cultivars. A KASP molecular marker was developed based on the SNP variation sites of the two haplotypes, located in the 3'UTR region of the gene ( Figure 1 , C). KASP primers were designed based on the SNP (A / T) variant site, two negative chains were designed at the 3' end, and fluorescent linker primers FAM and HEX were added to the 5' end of the two negative chains. The two negative chains were named 391-FAM and 391-HEX, and a common upstream primer 391F was designed. The product length was 117bp. The three primers constituted the KASP391 molecular marker primer. The primer sequences are as follows:

[0031] 391F (SEQ ID NO.1): GGTTAGTGAGTACCATCTCAG

[0032] 391-FAM-R (SEQ ID NO.2): GAAGGTGACCAAGTTCATGCTTTTGTATTACCAACCATTTTTTTTTA

[0033] 391-HEX-R (SEQ ID NO.3):GAAGGTCGGAGTCAACGGATTTTGTATTACCAACCATTTTTTTTTT

[0034] (The black bold sequences are FAM and HEX linker primers, FAM: GAAGGTGACCAAGTTCATGCT and HEX: GAAGGTCGGAGTCAACGGATT, and the black bold sequence at the 3' end is the SNP (A / T) variant sequence)

[0035] SEQ ID NO.4: TATTCTCCGTAGAAGATCTTTTGTAATAGAAAA GGTTAGTGAGTACCATCTCAG GTATATAGGAAACTGCTAAATGTTTTTTATTATCATGATTTTT WAAAAAAAATGGTTGGTAATACAA CCATGTTCAATAGAAGGAGGGAATGTCCAA( W is the mutation site, W represents the base A or T, the sequence of the mutation site in the reference genome is A, belonging to haplotype II)

[0036] The specific operation procedures of KASP primers are as follows:

[0037] (1) Preparation of KASP391 primer working solution. The primer powder was synthesized by Beixiang Biotechnology Co., Ltd. All three primers were dissolved into 100 μM and prepared into working solution according to the following volumes (Table 1):

[0038] Table 1. KASP391 primer working solution configuration system

[0039]

[0040] (2) KASP reaction system: The KASP Master Mix Kit (KBS-1016-002) (genecompany.com) was prepared according to the following reaction system (Table 2):

[0041] Table 2. KASP reaction system

[0042]

[0043] (3) Use a PCR instrument with touchdown function to perform amplification (Table 3) and run according to the following program:

[0044] Table 3. PCR run program

[0045]

[0046] (4) Use the SNP typing detector (model Omega F) to read the results.

[0047] 4. KASP391 molecular marker can be used to analyze the low temperature tolerance of soybean cultivation materials

[0048] The marker was used to classify 184 soybean cultivation materials with low temperature phenotype in this study into two categories ( Figure 2 ), blue represents low-temperature resistant materials (haplotype I: H1, SNP is T), and red circles represent low-temperature intolerant materials (haplotype II: H2, SNP is A). The chlorophyll fluorescence parameter Fv / Fm is proportional to the low-temperature tolerance of the plant. The t-test analysis showed that there was a significant difference in the chlorophyll fluorescence parameter Fv / Fm between the two types of materials (p<0.01), indicating that KASP391 can divide soybean cultivation materials into two haplotypes: low-temperature resistant (blue dots, close to the X-axis) and low-temperature sensitive (red dots, close to the Y-axis), which can be used to quickly test soybean tolerance to low temperatures.

[0049] Table 4. t-test between two haplotypes and chlorophyll fluorescence parameters (Fv / Fm)

[0050]

[0051] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. A KASP primer for detecting molecular markers, characterized in that: The KASP primers include a common upstream primer 391F and downstream primers 391-FAM-R and 391-HEX-R; The nucleotide sequence of the common upstream primer 391F is: GGTTAGTGAGTACCATCTCAG; The nucleotide sequence of the downstream primer 391-FAM-R is: GAAGGTGACCAAGTTCATGCTTTGTATTACCAACCATTTTTTTTTA; The nucleotide sequence of the downstream primer 391-HEX-R is: GAAGGTCGGAGTCAACGGATTTTGTATTACCAACCATTTTTTTTTT.

2. A detection kit, characterized in that: A KASP primer comprising the detection molecular marker according to claim 1.

3. Use of the KASP primer for detecting molecular markers according to claim 1 or the detection kit according to claim 2, characterized in that: Used in any of the following applications: (1) Identification of soybean low temperature phenotype; (2) Screening soybean lines that are tolerant or intolerant to low temperatures; The molecular marker is located at the 97th base of the sequence shown in SEQ ID NO. 4, and there is an A / T base mutation at the 97th base; If the genotype of the molecular marker is TT, the soybean sample to be tested is judged to be a low-temperature resistant material; if the genotype of the molecular marker is AA, the soybean sample to be tested is judged to be a low-temperature intolerant material.

4. A method for identifying soybean low temperature phenotype, characterized in that: The method comprises the following steps: using the genomic DNA of the soybean sample to be tested as a template, performing PCR amplification on the DNA template using the KASP primers described in claim 1 or the detection kit described in claim 2, and using the amplification result to determine the tolerance of soybean to low temperature; The molecular marker is located at the 97th base of the sequence shown in SEQ ID NO. 4, and there is an A / T base mutation at the 97th base; If the genotype of the molecular marker is TT, the soybean sample to be tested is judged to be a low-temperature resistant material; if the genotype of the molecular marker is AA, the soybean sample to be tested is judged to be a low-temperature intolerant material.

5. The method according to claim 4, characterized in that The PCR amplification program was as follows: pre-denaturation at 94°C for 15 min, denaturation at 94°C for 20 s, gradient annealing / extension at 61-55°C for 60 s, 10 cycles, decreasing 0.6°C in each cycle; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, 29 cycles.

6. The method according to claim 4, characterized in that The PCR amplification system is: 2×KASP Mix 5 μL, primer working solution 0.112 μL, DNA template 2 μL and ddH2O, with a total volume of 10 μL; the primer working solution contains 12 μM downstream primer 391-FAM-R, 12 μM downstream primer 391-HEX-R and 30 μM common upstream primer 391F.

Images