Multiple qPCR primer probe set, detection system and kit for detecting duck enteritis virus, goose parvovirus and muscovy duck parvovirus and application

Abstract

The invention provides a multiple qPCR (quantitative polymerase chain reaction) primer probe group for detecting duck enteritis virus, goose parvovirus and muscovy duck parvovirus, a detection system, a kit and application, and belongs to the technical field of virus detection. The multiplex qPCR detection primer probe group comprises an upstream primer DEV-F, a downstream primer DEV-R and a fluorescent probe DEV-Probe, wherein the upstream primer DEV-F, the downstream primer DEV-R and the fluorescent probe DEV-Probe are used for detecting the duck enteritis virus; the upstream primer GPV-F, the downstream primer GPV-R and the fluorescent probe GPV-Probe are used for detecting goose parvovirus, and the upstream primer MDPV-F, the downstream primer MDPV-R and the fluorescent probe MDPV-Probe are used for detecting muscovy duck parvovirus. The primer probe group provided by the invention has good specificity and sensitivity, can simultaneously detect three waterfowl infectious disease pathogens, has no cross reaction among the three pathogens, and is high in stability, and the coefficient of variation is below 10%.

Description

Technical Field

[0001] The invention belongs to the technical field of virus detection, and in particular relates to a multiplex qPCR primer probe set, a detection system, a kit and applications for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus. Background Art

[0002] Duck viral enteritis is an acute infectious disease caused by duck enteritis virus (DEV), also known as duck plague. It affects many waterfowl species such as ducks, geese, and swans, and is widely spread among continents through migratory waterfowl. It is characterized by invasion of blood vessels, erosion of the digestive tract mucosa, tissue bleeding, lesions of lymphoid organs and degenerative lesions of their parenchymal organs. Ducks that have recovered may still carry and excrete the virus, causing the disease to spread widely among ducks, seriously affecting the development of the duck farming industry. Goose plague is an acute septicemic infectious disease caused by goose parvovirus (GPV). The pathological characteristics of the disease are large-scale necrosis, shedding and fibrous exudates on the surface of the small intestinal mucosa, coagulation of emboli or pseudomembranes wrapped on the surface of the intestinal contents, blocking the intestinal cavity to form "intestinal embolism". It mainly affects goslings and Muscovy ducklings. The disease can occur all year round, spreads quickly, and has high morbidity and mortality rates. It is one of the important infectious diseases that endanger the goose farming industry and causes significant losses to the goose farming industry. As goose parvovirus recombines or mutates, the infection spectrum continues to expand. Muscovy duck parvovirus (MDPV), which belongs to the same Parvoviridae family as goose plague, also affects the waterfowl industry. Its clinical symptoms include dyspnea, pancreatic necrosis, diarrhea caused by exudative enteritis, etc. The mortality rate of infected Muscovy ducks can reach 10% to 80%. Because the two are not only very similar in virus size, morphology, structural proteins, physicochemical properties and nucleic acid types, but also in epidemiology, clinical symptoms and pathological changes, goose plague is easily confused with Muscovy duck parvovirus disease in clinical practice.

[0003] The establishment of virus detection methods is crucial for the prevention and control of waterfowl infectious diseases. Common virus detection methods include molecular biology detection, pathogen isolation and identification, and serological detection. Molecular biology detection techniques such as PCR (polymerase chain reaction) can quickly and accurately detect viral nucleic acids, which is of great significance for the early detection of viral infections. Serological detection is a commonly used epidemiological survey method to determine whether poultry has been infected with a certain virus by detecting the antibody level in the serum. However, the above two methods have the disadvantages of complex operation, time-consuming and labor-intensive, and poor sensitivity. Especially when waterfowl are mixed with multiple pathogens, it is difficult to perform early rapid detection and differential diagnosis using conventional methods. However, the simultaneous detection of DEV, MDPV and GPV based on TaqMan probes has not been reported. Therefore, in order to be able to immediately detect the occurrence of epidemics and take effective prevention and control measures, it is very necessary to develop a convenient, rapid and effective method for the simultaneous detection of DEV, MDPV and GPV. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a multiplex qPCR primer probe set for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, wherein the primer probe set can simultaneously detect three waterfowl infectious pathogens, has no cross-reaction between the three pathogens, and has high stability.

[0005] The present invention also aims to provide a multiplex qPCR detection system for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus.

[0006] The present invention also aims to provide a multiplex qPCR kit for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides a multiplex qPCR primer probe set for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, wherein the primer probe set comprises an upstream primer DEV-F, a downstream primer DEV-R and a fluorescent probe DEV-Probe for detecting duck enteritis virus; an upstream primer GPV-F, a downstream primer GPV-R and a fluorescent probe GPV-Probe for detecting goose parvovirus; and an upstream primer MDPV-F, a downstream primer MDPV-R and a fluorescent probe MDPV-Probe for detecting Muscovy duck parvovirus;

[0009] The nucleotide sequence of the upstream primer DEV-F for detecting duck enteritis virus is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer DEV-R is shown in SEQ ID NO.2, and the nucleotide sequence of the fluorescent probe DEV-Probe is shown in SEQ ID NO.3;

[0010] The nucleotide sequence of the upstream primer GPV-F for detecting goose parvovirus is shown in SEQ ID NO.5, the nucleotide sequence of the downstream primer GPV-R is shown in SEQ ID NO.6, and the nucleotide sequence of the fluorescent probe GPV-Probe is shown in SEQ ID NO.7;

[0011] The nucleotide sequence of the upstream primer MDPV-F for detecting Muscovy duck parvovirus is shown in SEQ ID NO.10, the nucleotide sequence of the downstream primer MDPV-R is shown in SEQ ID NO.11, and the nucleotide sequence of the fluorescent probe MDPV-Probe is shown in SEQ ID NO.12.

[0012] Preferably, the 5' end of the fluorescent probe in the primer probe set is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0013] More preferably, the fluorescent reporter group includes one of HEX, CY5 or FAM; and the fluorescent quencher group includes BHQ1 or BHQ2.

[0014] The present invention also provides a multiplex qPCR kit for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, wherein the kit comprises the multiplex qPCR primer probe set.

[0015] The present invention also provides a multiplex qPCR detection system for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, wherein the multiplex qPCR detection system comprises the multiplex qPCR primer probe set.

[0016] Preferably, the multiplex qPCR detection system comprises the following components in a total volume of 25 μL: 12.5 μL Probeq PCR Mix, 2 μL mixed template, 0.6 μL 8-12 μM upstream primer DEV-F, 0.6 μL 8-12 μM downstream primer DEV-R, 0.8 μL 8-12 μM fluorescent probe DEV-Probe; 0.8 μL 8-12 μM upstream primer GPV-F, 0.8 μL 8-12 μM downstream primer GPV-R, 1 μL 8-12 μM fluorescent probe GPV-Probe; 0.6 μL 8-12M upstream primer MDPV-F, 0.6 μL 8-12 μM downstream primer MDPV-R, 0.8 μL 8-12 μM fluorescent probe MDPV-Probe; 3.9 μL ddH2O.

[0017] More preferably, in the mixed template, the three pathogenic templates of duck enteritis virus, goose parvovirus and Muscovy duck parvovirus are mixed in an equal volume ratio.

[0018] The present invention also provides a multiplex qPCR detection method for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus for non-diagnostic purposes, comprising the following steps:

[0019] Extract the RNA of the sample to be tested and reverse transcribe it into cDNA;

[0020] Using the above cDNA as a template, perform multiplex qPCR amplification with the multiplex qPCR primer-probe set, or the kit, or the detection system described;

[0021] After the reaction is completed, judge whether DEV, GPV and MDPV in the sample to be tested are positive according to the amplification curve.

[0022] Preferably, the judgment criteria are as follows: if an amplification curve appears in the detection of the sample to be tested and Ct ≤ 35, it is judged as positive; if 35 < Ct ≤ 38 in the fluorescence channel, it is judged as suspicious and needs to be retested; if there is no amplification curve in the fluorescence channel or Ct value > 38, it is judged as negative.

[0023] Preferably, the reaction procedure of the multiplex qPCR amplification is as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 48°C for 30 s, extension at 72°C for 20 s, 40 cycles.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention provides a primer-probe set for detecting three pathogenic agents of waterfowl infectious diseases, namely duck enteritis virus DEV, goose parvovirus GPV and Muscovy duck parvovirus MDPV. The primer-probe set is used to detect the three pathogenic agents of waterfowl infectious diseases, and has good specificity and sensitivity. Compared with the currently widely used PCR detection, pathogen isolation and identification, and serological detection, it has quite high detection sensitivity. The primer-probe set of the present invention can simultaneously detect three pathogenic agents of waterfowl infectious diseases, and there is no cross-reaction among the three pathogenic agents, and it has high stability, and its coefficient of variation is all below 10%. The present invention also establishes a multiplex qRT-PCR system and method for simultaneously detecting DEV, GPV and MDPV. Using the multiplex qRT-PCR detection system and method provided by the present invention, the three viruses DEV, GPV and MDPV can be quickly detected, which can provide effective prevention for these three viruses and is expected to reduce the economic losses in waterfowl breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a diagram of the optimized annealing temperature result of the multiplex qPCR detection of the present invention;

[0027] Figure 2The qPCR fluorescence quantitative sensitivity amplification curve and standard curve for the detection of a single waterfowl infectious pathogen. In the figure, A is the sensitivity amplification curve and standard curve of DEV, B is the sensitivity amplification curve and standard curve of GPV, and C is the sensitivity amplification curve and standard curve of MDPV.

[0028] Figure 3 The multiplex qPCR fluorescence quantitative sensitivity amplification curve and standard curve for the detection of three waterfowl infectious disease pathogens. In the figure, A is the sensitivity amplification curve of the three waterfowl infectious disease pathogens, and B is the standard curve of the three waterfowl infectious disease pathogens.

[0029] Figure 4 It is a graph of the specific detection results of multiplex qPCR, in which 1-3: plasmid standard templates DEV, GPV and MDPV, 1'-3': DEV, GPV and MDPV virus templates, 4-9: DTMUV, NDRV, DHAV-1, DHAV-3, NDV and AIV virus templates;

[0030] Figure 5 The multiplex qPCR detection system of the present invention uses qPCR instruments of different brands to systematically calibrate the various judgment standards of the established method. In the figure, A is the sensitivity amplification curve and standard curve of DEV, B is the sensitivity amplification curve and standard curve of GPV, and C is the sensitivity amplification curve and standard curve of MDPV; D is the specific result diagram of each virus under the triple system provided by the present invention;

[0031] Figure 6 Serum and diseased tissue samples were detected using the multiplex qPCR detection system of the present invention. In the figure, purple represents MDPV, blue represents GPV, and green represents DEV. DETAILED DESCRIPTION

[0032] The invention provides a multiplex qPCR primer probe set for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus. The invention designs the primer probe set according to the UL6 gene of duck enteritis virus DEV, the NS gene of goose parvovirus GPV and the VP gene of Muscovy duck parvovirus MDPV; the primer probe set comprises an upstream primer DEV-F, a downstream primer DEV-R and a fluorescent probe DEV-Probe for detecting duck enteritis virus; an upstream primer GPV-F, a downstream primer GPV-R and a fluorescent probe GPV-Probe for detecting goose parvovirus; and an upstream primer MDPV-F, a downstream primer MDPV-R and a fluorescent probe MDPV-Probe for detecting Muscovy duck parvovirus.

[0033] The nucleotide sequence of the upstream primer DEV-F for detecting duck enteritis virus is preferably GGCCAGGGAGTTTATAATTCGG (SEQ ID NO.1), the nucleotide sequence of the downstream primer DEV-R is preferably GCTATATGTCGTGCATCTAACCC (SEQ ID NO.2), and the nucleotide sequence of the fluorescent probe DEV-Probe is preferably CTGCCATACGWCAAATCCAGGCGAC (SEQ ID NO.3); wherein W is a degenerate base, and its corresponding base is A or T. In a specific embodiment of the present invention, the nucleotide sequence of the fluorescent probe DEV-Probe for detecting duck enteritis virus is more preferably CTGCCATACGACAAATCCAGGCGAC (SEQ ID NO.4);

[0034] The nucleotide sequence of the upstream primer GPV-F for detecting goose parvovirus is preferably AATTGTTCTCYCATCAGTYGCTC (SEQ ID NO.5), the nucleotide sequence of the downstream primer GPV-R is preferably ARTTTGCYTTCTCACATTCCATAC (SEQ ID NO.6), and the nucleotide sequence of the fluorescent probe GPV-Probe is preferably CCTGTGACTCCTCAGAACTCCCCT (SEQ ID NO.7); wherein Y and R are degenerate bases, the base corresponding to Y is C or T, and the base corresponding to R is A or G; in a specific embodiment of the present invention, the nucleotide sequence of the upstream primer GPV-F for detecting goose parvovirus is more preferably AATTGTTCTCATCAGTCGCTC (SEQ ID NO.8), and the nucleotide sequence of the downstream primer GPV-R is more preferably AGTTTGCTTTCTCACATTCCATAC (SEQ ID NO.9),

[0035] The nucleotide sequence of the upstream primer MDPV-F for detecting Muscovy duck parvovirus is AAGCTACAACAACCACATSTAC (SEQ ID NO.10), the nucleotide sequence of the downstream primer MDPV-R is GGCAGTGRAATCTGTTGAAAT (SEQ ID NO.11), and the nucleotide sequence of the fluorescent probe MDPV-Probe is ATCACAAGCGGAACAAACCCAGAC (SEQ ID NO.12), wherein S and R are degenerate bases, the base corresponding to S is G or C, and the base corresponding to R is A or G; in a specific embodiment of the present invention, the nucleotide sequence of the upstream primer MDPV-F for detecting Muscovy duck parvovirus is more preferably AAGCTACAACAACCACATCTAC (SEQ ID NO.13), and the nucleotide sequence of the downstream primer MDPV-R is more preferably GGCAGTGGAATCTGTTGAAAT (SEQ ID NO.14).

[0036] The present invention designs fluorescent probes and primers based on gene chip technology. The size of the fluorescent probe and the length of the target DNA will affect the hybridization signal. Generally, the oligonucleotide probe can take into account the sensitivity and specificity of the chip when it is 16 to 25 bp. At the same time, the smaller the target fragment, the higher the efficiency of amplification. However, when the length is too low, its stability is poor and the hybridization signal is reduced. The length of each probe of the present invention is 24 to 25 bp, the target fragment of the DEV target gene is 161 bp, the target fragment of the GPV target gene is 153 bp, and the target fragment of the MDPV target gene is 119 bp, which ensures the stability and clarity of the response signal.

[0037] In the present invention, the fluorescent probe is an oligonucleotide, the 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. During the extension phase of PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the fluorescent probe, separating the reporter fluorescent group and the quencher fluorescent group. The fluorescent monitoring system can receive the fluorescent signal and present curves of different fluorescent colors to distinguish the three waterfowl infectious disease pathogens. In the present invention, the fluorescent reporter group preferably includes one of HEX, CY5 or FAM; the fluorescent quencher group preferably includes BHQ1 or BHQ2.

[0038] The primer probe set provided by the invention detects three waterfowl infectious disease pathogens with good specificity and sensitivity, can detect the three waterfowl infectious disease pathogens at the same time, has no cross reaction between the three pathogens, and has high stability, with coefficients of variation all below 10%.

[0039] The present invention also provides a multiplex qPCR kit for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, wherein the kit comprises the multiplex qPCR primer probe set.

[0040] The present invention also provides a multiplex qPCR detection system for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, wherein the multiplex qPCR detection system comprises the multiplex qPCR primer probe set.

[0041] In the present invention, the detection system of the multiplex qPCR is preferably calculated in a total volume of 25 μL, and includes the following components: 12.5 μL Probe qPCR Mix, 2 μL mixed template, 8-12 μM upstream primer DEV-F 0.6 μL, 8-12 μM downstream primer DEV-R 0.6 μL, 8-12 μM fluorescent probe DEV-Probe 0.8 μL; 8-12 μM upstream primer GPV-F 0.8 μL, 8-12 μM downstream primer GPV-R 0.8 μL, 8-12 μM fluorescent probe GPV-Probe 1 μL; 8-12 μM upstream primer MDPV-F 0.6 μL, 8-12 μM downstream primer MDPV-R 0.6 μL, 8-12 μM fluorescent probe MDPV-Probe 0.8 μL; 3.9 μL ddH2O. In the present invention, the molar concentration of each primer and fluorescent probe is more preferably 10 μM. The present invention determines the concentration and addition amount of each primer and fluorescent probe in the detection system by orthogonal test to ensure that the detection result has good stability.

[0042] In the present invention, the three pathogenic templates of duck enteritis virus, goose parvovirus and Muscovy duck parvovirus in the mixed template are preferably mixed in an equal volume ratio. In the present invention, the three pathogenic templates of duck enteritis virus, goose parvovirus and Muscovy duck parvovirus are more preferably mixed in a volume ratio of 1:1:1. As an practicable method, 1 to 3 μL of the three pathogenic templates of duck enteritis virus, goose parvovirus and Muscovy duck parvovirus are respectively aspirated and fully mixed, and the mixed templates are aspirated as the mixed template.

[0043] The present invention also provides a multiplex qPCR detection method for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus for non-diagnostic purposes, preferably comprising the following steps:

[0044] Extract RNA from the sample to be tested and reverse transcribe it into cDNA;

[0045] Using the cDNA as a template, performing multiplex qPCR amplification using the multiplex qPCR primer probe set, the kit, or the detection system;

[0046] After the reaction is completed, whether DEV, GPV and MDPV in the sample to be tested are positive is determined based on the amplification curve.

[0047] The present invention does not make special limitations on the methods for extracting sample RNA and reverse transcription. Conventional means well-known in the art can be used to extract the RNA of the sample to be tested and perform reverse transcription; or a conventional commercially available kit can be used to extract the RNA of the sample to be tested and perform reverse transcription. The detection method established by the present invention can simultaneously and rapidly detect three viruses, namely DEV, GPV, and MDPV, and can also perform single detection of each virus.

[0048] The detection instrument used in the present invention can collect fluorescence-labeled probe signals of different wavelengths, and the corresponding primer probes can be located according to different well positions and fluorescence signals. In the present invention, the judgment criteria are preferably as follows: if an amplification curve appears in the detection of the sample to be tested and Ct ≤ 35, it is determined to be positive; if 35 < Ct ≤ 38, it is determined to be suspicious and needs to be retested; if there is no amplification curve or Ct value > 38, it is determined to be negative. In the present invention, as an implementable manner, if it is still suspicious after retesting and excluding environmental pollution, it is determined to be weakly positive for the viral nucleic acid in the corresponding channel.

[0049] In the present invention, the reaction procedure of the multiplex qPCR amplification is preferably as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 48°C for 30 s, extension at 72°C for 20 s, for 40 cycles. The present invention optimizes the annealing temperature through orthogonal experiments to determine the annealing temperature in the amplification reaction procedure of the present invention to ensure that the amplification reaction has good stability.

[0050] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0051] In the following embodiments, Duck enteritis virus DEV, Goose parvovirus GPV, Muscovy duck parvovirus MDPV, Duck Tembusu virus DTMUV, Novel duck reovirus NDRV, Duck hepatitis A virus type 1 DHAV-1, Duck hepatitis A virus type 3 DHAV-3, Newcastle disease virus (NDV Lasota strain), and Avian influenza H9 (AIV-H9) were provided by the China Institute of Veterinary Drug Control.

[0052] The virus genomic DNA extraction kit, virus genomic RNA extraction kit, and rapid plasmid miniprep kit were all purchased from Tiangen Biochemical Technology Co., Ltd. The DH5α competent cells were purchased from Novizan, MiniBEST Agarose Gel DNA Extraction Kit, One Step PrimeScript TM III RT-qPCR Mix, with UNG, pMD TM 19-T Vector Cloning Kit was purchased from TAKARA.

[0053] Example 1 Establishment of multiplex qPCR detection method

[0054] 1. Design of primers and probes

[0055] To ensure the detection performance of the primers and probes used in the multiplex qRT-PCR method, all available DEV, GPV, and MDPV sequences were obtained from GenBank and analyzed. Primers and probes for DEV, GPV, and MDPV were designed based on the UL6 gene of DEV, the NS gene of GPV, and the VP gene of MDPV, as shown in Table 1.

[0056] Table 1 Multiplex fluorescence quantitative RT-qPCR primers and probes

[0057]

[0058]

[0059] 2. Preparation of three virus recombinant positive plasmids

[0060] 2.1 Sample nucleic acid extraction

[0061] According to the instructions of the Tiangen Virus Genomic DNA Extraction Kit, nucleic acids of the three virus samples were extracted respectively.

[0062] 2.2 Amplification of each viral target fragment

[0063] Use the fragments with a length of 110 to 161 bp containing the fragments amplified by the pathogen primers in Table 2 as the target fragments to be inserted into the T vector, and perform PCR amplification reaction to obtain the target product. Use the nucleic acid extracted in 2.1 as the template, the reaction system is: 25 μL 2×TaqMasterMix, 2 μL each of the upstream and downstream primers in Table 2, 4 μL of a single virus template, 17 μL of double distilled water ddH2O, and the reaction procedure is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 48°C for 30 s, extension at 72°C for 30 s, 35 cycles; 72°C for 7 min, and storage at 4°C.

[0064] Table 2 Amplification primers

[0065]

[0066] 2.3 Construction of recombinant T vector and extraction of recombinant positive plasmid

[0067] Purify the target PCR product according to the instructions of TAKARA's MiniBESTAgarose Gel DNA Extraction Kit Ver.4.0.TM 19-T Vector Cloning Kit Instructions, construct T vector and coat it in Amp resistant medium. Select PCR positive bacterial samples for sequencing and use NCBINucleotide Blast to compare the sequencing results. Finally, use Tiangen's Rapid Plasmid Extraction Kit Instructions to extract the recombinant positive plasmids of each virus.

[0068] 3. Optimization of multiplex qPCR amplification conditions

[0069] To establish the multiplex qPCR method, the recombinant positive plasmid extracted in 2.3 was used as the plasmid standard and serially diluted. The copy numbers after dilution were as follows:

[0070] DEV: 1.16×10 9 copies / μL~1.16×10 0 copies / μL;

[0071] GPV: 9.8×10 8 copies / μL~9.8×10 0 copies / μL;

[0072] MDPV: 1.48×10 9 copies / μL~1.48×10 0 copies / μL.

[0073] All primers, probes and serially diluted plasmid standards of DEV, GPV and MDPV were mixed with 12.5 μL ProbeqPCR Mix and sterile ddH2O in a 25 μL reaction system. Finally, the concentration of each primer and probe was optimized. The optimal concentration of primers and probes and the optimal annealing temperature were determined by orthogonal experiments. The optimal amount of primers, probes and annealing temperature should be determined based on the optimal amplification curve at a certain value in the orthogonal process, and the CT value is low to determine the optimal amount of primers and probes and annealing temperature. The specific primer and probe sequences are shown in Table 3.

[0074] Table 3 Multiplex fluorescence quantitative RT-qPCR primer and probe sequences

[0075]

[0076] according to Figure 1The results in Tables 4 to 6 show that the optimal primer and probe concentrations of DEV, GPV and MDPV are: 10μM upstream primer DEV-F 0.6μL, 10μM downstream primer DEV-R 0.6μL, 10μM fluorescent probe DEV-Probe 0.8μL; 10μM upstream primer GPV-F 0.8μL, 10μM downstream primer GPV-R 0.8μL, 10μM fluorescent probe GPV-Probe 1μL; 10μM upstream primer MDPV-F 0.6μL, 10μM downstream primer MDPV-R 0.6μL, 10μM fluorescent probe MDPV-Probe 0.8μL. The reaction system was 12.5μL Probe qPCRMix, 2μL mixed template, 0.6μL each of 10μM DEV-F and DEV-R primers, 0.8μL of 10μM DEV-Probe probe; 0.6μL each of 10μM MDPV-F and MDPV-R primers, 0.8μL of 10μM MDPV-Probe probe; 0.8μL of 10μM GPV-F and GPV-R primers, 1μL of 10μM GPV-Probe probe; 3.9μL ddH2O. The annealing temperature optimization results showed that 48℃ was the best annealing temperature, and the reaction amplification conditions were 95℃, 30s, 95℃, 5s, 48℃, 30s, 72℃, 20s, and 40 cycles.

[0077] Table 4 Optimization of primer and probe concentrations for duck enteritis virus (CT value)

[0078]

[0079] Table 5 Optimization of primer and probe concentrations for goose parvovirus (CT value)

[0080]

[0081] Table 6 Optimization of primer and probe concentrations for Muscovy duck parvovirus (CT value)

[0082]

[0083]

[0084] 4. Construction of standard curve

[0085] The plasmid standards of the three viruses obtained in step 2.3 of Example 1 were diluted 10 times continuously to establish a standard curve for each virus. In analytical chemistry experiments, the standard curve method is often used for quantitative analysis. The scales of the horizontal and vertical axes of the drawing paper used to draw the standard curve and the size of the experimental points should not be too large or too small, and should be able to approximately reflect the accuracy of the measurement. Therefore, the three viral plasmid standards were diluted 10 times. 7copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 copies / μL, 7 concentrations were used as templates respectively to prepare the standard curves of three viruses. ddH2O was used as the negative control template for TapMan fluorescence quantitative RT-qPCR amplification( Figure 2 ), and the standard curves were drawn according to the final results( Figure 3 ). The standard curve of DEV was y = -3.5197x + 40.21, the standard curve of GPV was y = -3.436x + 37.718, and the standard curve of MDPV was y = -3.5135x + 39.464; the multiplex qPCR standard curves all showed good correlation coefficients and amplification efficiencies: DEV (R 2 = 0.9921, Eff% = 91); GPV (R 2 = 0.994, Eff% = 89); MDPV (R 2 = 0.994, Eff% = 93).

[0086] 5. Result determination

[0087] The instrument collected the fluorescence-labeled probe signals at different wavelengths. After being processed by software, the amplification curves of three fluorescence channels, FAM, VIC, and CY5, were presented. The corresponding primer probes could be located according to different well positions and fluorescence signals. The results were as Figure 4 shown. If an amplification curve appeared in the sample detection and ct ≤ 35, it was determined as positive; if 35 < Ct ≤ 38 in the corresponding channel, it was determined as suspicious and needed to be retested; if it was still suspicious after retesting and excluding environmental pollution, it was determined as weak positive for the viral nucleic acid in the corresponding channel; if there was no amplification curve in the corresponding channel or Ct value > 38, it was determined as negative for the nucleic acid in that channel.

[0088] Example 2 Multiplex qPCR sensitivity detection

[0089] To analyze the sensitivity of the established multiplex RT-qPCR detection, the plasmid standard products obtained in step 2.3 of Example 1 were mixed and serially diluted 10-fold in sterile ddH2O. The final concentrations after dilution were in 10 8 ~10 0The single template sensitivity of the three viruses was tested in the mixed system. The single detection sensitivity of DEV was 11.6 copies / μL, the single detection sensitivity of GPV was 95 copies / μL, and the single detection sensitivity of MDPV was 14.8 copies / μL ( Figure 2 ). The sensitivity of the three viruses in detecting mixed templates in the mixed system was 116 copies / μL, 95 copies / μL and 14.8 copies / μL for multiple detection of DEV, GPV and MDPV respectively ( Figure 3 , Table 7).

[0090] Table 7 Sensitivity of multiplex fluorescence quantitative RT-qPCR

[0091]

[0092]

[0093] Example 3 Multiplex qPCR specific detection

[0094] The specificity of the multiplex RT-qPCR established in Example 1 was evaluated using cDNAs of nine waterfowl viruses, including DEV, MDPV, GPV, DTMUV, DHAV-1, DHAV-3, NDRV, AIV-H9, and NDV, as amplification templates. Sterile ddH2O was used as a negative control template (see Figure 4 ). The results showed that DEV, GPV, and MDPV were successfully detected; no signals were detected for NDRV, DHAV-1, DHAV-3, DTMUV, AIV-H9, and NDV, and no signals were detected for the negative control.

[0095] Example 4 Multiplex qPCR Repeatability

[0096] In order to evaluate the repeatability of multiplex qPCR, the coefficient of variation (CV) of RT-qPCR was detected using 10-fold serial dilutions of the plasmid standard prepared in step 2.3 of Example 1, and all tests were repeated three times to evaluate the repeatability of the intra-batch experiment. In order to evaluate the repeatability of the inter-batch experiment, the test was repeated three times at different locations (see Tables 8 to 10). The coefficient of variation of the DEV intra-batch experiment was 0.21-2.28%, and the coefficient of variation of the inter-batch experiment was 0.28-3.25%. The coefficients of variation of GPV amplification within and between batches were 0.17-2.17% and 0.24-3.45%, respectively. The coefficients of variation of MDPV amplification within and between batches were 0.02-2.30% and 0.55-3.34%, respectively. The results show that the multiplex qPCR detection system of the present invention has good repeatability.

[0097] Table 8 Intra-assay and inter-assay coefficients of variation of duck enteritis virus

[0098]

[0099] Table 9 Intra-assay and inter-assay coefficients of variation of goose parvovirus

[0100]

[0101]

[0102] Table 10 Intra-assay and inter-assay coefficients of variation of Muscovy duck parvovirus

[0103]

[0104] Example 5 Calibration of qPCR Instruments of Different Brands

[0105] All reactions established by the present invention for the multiplex qPCR method were performed on a QuantStudio 7Flex qPCR instrument system (Thermo Fisher SCIENTIFIC). In order to improve the adaptability of the present invention, the construction method of the standard curve in Example 1, the sensitivity detection in Example 2, and the specific detection in Example 3 were constructed on a Bio-Rad CFX 384qPCR instrument system. The standard curve results showed that the DEV standard curve was y=-3.3354x+36.81, the GPV standard curve was y=-3.3019x+35.49, and the MDPV standard curve was y=-3.5759x+36.345; the multiplex qPCR standard curves all showed good correlation coefficients and amplification efficiencies: DEV (R 2 =0.9976, Eff%=99); GPV(R 2 =0.9989, Eff%=200); MDPV(R 2 =0.9998, Eff%=90). The sensitivity results showed that the single detection sensitivity of DEV was 11.6 copies / μL, the single detection sensitivity of GPV was 95 copies / μL, and the single detection sensitivity of MDPV was 14.8 copies / μL. The specificity results showed that DEV, GPV, and MDPV were successfully detected; no signals were detected for NDRV, DHAV-1, DHAV-3, DTMUV, AIV-H9, and NDV, and no signals were detected for the negative control (see Figure 5 ). The results show that the multiplex qPCR detection method established by the present invention presents good results through two different types of instruments, has strong adaptability, and can be applied to a variety of detection instruments.

[0106] Example 6 Multiplex qPCR sample diversity detection

[0107] In order to cope with the diversity of clinical samples, 83 cases of waterfowl lesions (Table 11) and 12 healthy serum samples collected in Nanchang, Jiangxi Province were collected and tested according to the steps of Example 1. The results showed that 34 positive samples were detected in 83 lesions, including 18 positive samples for GPV, 4 positive samples for MDPV, and 12 positive samples for DEV. At the same time, serum samples of healthy waterfowl were tested, and no positive amplification was found (see Figure 6 ).

[0108] Table 1183 Waterfowl Disease Tissue Sample Collection Information Summary

[0109] Collection location quantity Fujian 34 Guangxi 8 Anhui 6 Guangdong 7 Jiangsu 3 Jiangxi 12 Shandong 13

[0110] Example 7 Multiplex qPCR applied to clinical sample detection

[0111] In this example, a total of 142 clinical samples from pathogen-positive or suspected waterfowl were collected, and the clinical samples were prepared with an amplification system according to Example 1, and multiplex qPCR detection was performed. The results were determined by the result determination method in Example 1, and the positive rate was calculated. At the same time, common PCR detection technology was used for joint detection to analyze the consistency of the test results. The multiplex qPCR method established by the present invention detected a total of 18 DEV samples, 20 GPV samples, and 12 MDPV samples.

[0112] Table 12 Clinical sample test results

[0113] pathogen qPCR Positive rate (%) PCR Kappa test DEV 12 / 215 5.5％ 12 / 215 1.000(p＜0.001) GPV 25 / 215 11.6％ 24 / 215 0.977(p＜0.001) MDPV 10 / 215 4.6％ 10 / 215 1.000(p＜0.001)

[0114] In the table, Kappa test:

[0115]

[0116] That is: κ = (consistency of two observations - chance consistency of two observations) / (1-chance consistency of two observations); κ≤0.40 means poor consistency, 0.40<κ≤0.60 means moderate consistency, 0.60<κ≤0.80 means high consistency, and κ>0.80 means excellent consistency.

[0117] According to the results in Table 12, the positive rate detected by the multiplex qPCR detection method established in the present invention is relatively consistent with the positive rate detected by the PCR detection technology, and the two have good consistency calculated by the Kappa test.

[0118] In summary, the present invention has established a multiplex qPCR system and method for simultaneously detecting DEV, GPV and MDPV. The multiplex qPCR detection system and method provided by the present invention can quickly detect the three viruses DEV, GPV and MDPV, and can provide effective prevention for these three viruses, which is expected to reduce economic losses in waterfowl farming.

[0119] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A multiplex qPCR primer probe set for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, characterized in that: The primer probe group includes an upstream primer DEV-F, a downstream primer DEV-R and a fluorescent probe DEV-Probe for detecting duck enteritis virus; an upstream primer GPV-F, a downstream primer GPV-R and a fluorescent probe GPV-Probe for detecting goose parvovirus; and an upstream primer MDPV-F, a downstream primer MDPV-R and a fluorescent probe MDPV-Probe for detecting Muscovy duck parvovirus; The nucleotide sequence of the upstream primer DEV-F for detecting duck enteritis virus is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer DEV-R is shown in SEQ ID NO.2, and the nucleotide sequence of the fluorescent probe DEV-Probe is shown in SEQ ID NO.3; The nucleotide sequence of the upstream primer GPV-F for detecting goose parvovirus is shown in SEQ ID NO.5, the nucleotide sequence of the downstream primer GPV-R is shown in SEQ ID NO.6, and the nucleotide sequence of the fluorescent probe GPV-Probe is shown in SEQ ID NO.7; The nucleotide sequence of the upstream primer MDPV-F for detecting Muscovy duck parvovirus is shown in SEQ ID NO.10, the nucleotide sequence of the downstream primer MDPV-R is shown in SEQ ID NO.11, and the nucleotide sequence of the fluorescent probe MDPV-Probe is shown in SEQ ID NO.

12.

2. The multiplex qPCR primer probe set according to claim 1, characterized in that: The 5' end of the fluorescent probe in the primer probe set is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

3. The multiplex qPCR primer probe set according to claim 2, characterized in that: The fluorescent reporter group includes one of HEX, CY5 or FAM; the fluorescent quencher group includes BHQ1 or BHQ2.

4. A multiplex qPCR kit for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, characterized in that: The kit comprises the multiplex qPCR primer probe set according to any one of claims 1 to 3.

5. A multiplex qPCR detection system for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, characterized in that: The multiplex qPCR detection system comprises the multiplex qPCR primer probe set according to any one of claims 1 to 3.

6. The multiplex qPCR detection system according to claim 5, characterized in that: The multiplex qPCR detection system includes the following components in a total volume of 25 μL: 12.5 μL Probe qPCR Mix, 2 μL mixed template, 0.6 μL 8-12 μM upstream primer DEV-F, 0.6 μL 8-12 μM downstream primer DEV-R, 0.8 μL 8-12 μM fluorescent probe DEV-Probe; 0.8 μL 8-12 μM upstream primer GPV-F, 0.8 μL 8-12 μM downstream primer GPV-R, 1 μL 8-12 μM fluorescent probe GPV-Probe; 0.6 μL 8-12 μM upstream primer MDPV-F, 0.6 μL 8-12 μM downstream primer MDPV-R, 0.8 μL 8-12 μM fluorescent probe MDPV-Probe; 3.9 μL ddH2O.

7. The multiplex qPCR detection system according to claim 6, characterized in that: In the mixed template, three pathogenic templates of duck enteritis virus, goose parvovirus and Muscovy duck parvovirus are mixed in equal volume ratio.

8. A multiplex qPCR detection method for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus for non-diagnostic purposes, characterized in that: The steps include: Extract RNA from the sample to be tested and reverse transcribe it into cDNA; Using the above cDNA as a template, perform multiplex qPCR amplification using the multiplex qPCR primer-probe set described in any one of claims 1 to 3, or the kit described in claim 4, or the detection system described in any one of claims 5 to 7; After the reaction, determine whether DEV, GPV, and MDPV in the sample to be tested are positive according to the amplification curve.

9. The multiplex qPCR detection method according to claim 8, characterized in that: The judgment criteria are as follows: If an amplification curve appears in the test of the sample to be tested and Ct ≤ 35, it is determined to be positive; if 35 < Ct ≤ 38, it is determined to be suspicious and needs to be retested; if there is no amplification curve or Ct value > 38, it is determined to be negative.

10. The multiplex qPCR detection method according to claim 8, characterized in that: The reaction procedure of the multiplex qPCR amplification is as follows: denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 48°C for 30 s, extension at 72°C for 20 s, 40 cycles.

Images