VACCINES AND COMPOSITIONS BASED ON S PROTEINS OF DIFFERENT OMETRIC VARIANTS OF SARS-CoV-2

Abstract

The present disclosure provides vaccines and compositions of spike proteins (S proteins) based on different Omemitron variants of SARS-CoV-2, and in particular relates to recombinant SARS-CoV-2S proteins, and mRNA and DNA encoding the same. The present disclosure also relates to recombinant plasmids comprising a DNA sequence encoding a recombinant S protein. The disclosure further relates to compositions, mRNA-vector particles, e.g., lipid nanoparticles (LNP), and compositions, e.g., vaccine compositions, comprising the aforementioned recombinant S protein and / or mRNA.

Description

Technical Field

[0001] The present disclosure belongs to the field of biomedicine and vaccine technology, and in particular to multivalent vaccines and compositions targeting SARS-CoV-2, specifically targeting different Omicron variants. Background Art

[0002] The genome of SARS-CoV-2 continues to mutate as it spreads in different host populations, producing multiple subtypes. Among them, the SARS-CoV-2 Omicron variant is a highly contagious variant first discovered in South Africa.

[0003] Omicron, a new variant of the novel coronavirus, was officially named by the World Health Organization in November 2021. The number of genetic mutations in Omicron is more than 1 times that of Delta, and its comprehensive infectiousness is more than 2 times that of Delta. In addition, Omicron has multiple variants, and new variants will reduce the effectiveness of the novel coronavirus vaccine, which in turn highlights the importance of strengthening immunity, because vaccines can trigger neutralizing antibodies to deal with new variants of the virus.

[0004] Combination vaccines are made from two or more vaccine concentrates in a specific ratio. They can prevent multiple diseases or diseases caused by different subtypes of the same pathogen. The former is called a multi-component vaccine and the latter is called a multivalent vaccine. Combination vaccines are not the same as the simple superposition of any single vaccine. They will not only not aggravate the side effects after injection, but also effectively reduce the risk of adverse reactions that may occur due to multiple vaccinations.

[0005] In view of the current situation where different SARS-CoV-2 variants are rampant, the combined immunization strategy provides a new idea for preventing infection with different variants, reducing the number of vaccine injections, and reducing adverse immune reactions. Therefore, there is an urgent need for vaccines that can effectively target different SARS-CoV-2 variants at the same time. Summary of the invention

[0006] The present invention provides an mRNA vaccine for SARS-CoV-2, especially for different variants of SARS-CoV-2Omicron, which can express a pre-fusion stable form of recombinant S protein in vivo after being delivered to mice, triggering the body's cellular and humoral immune responses, thereby inducing the production of specific antibodies in vivo. The serum immunized with the vaccine of the present invention has specific high-titer antibodies against multiple Omicron variants, and has strong cross-neutralization activity against multiple Omicron variants, and has a certain inhibitory effect on both wild-type and Delta variants.

[0007] The present invention also provides an mRNA vaccine composition for SARS-CoV-2 and its variants (such as Omicron and Delta variants). The serum immunized with the mRNA vaccine composition of the present invention can inhibit a variety of SARS-CoV-2 variants, among which it has a strong neutralizing ability against wild-type, Omicron and Delta SARS-CoV-2, thereby preventing diseases caused by infection with different variants.

[0008] SARS-CoV-2 belongs to the genus β-coronavirus of the Coronaviridae family, along with SARS-CoV and MERS-CoV. The SARS-CoV-2 genome sequence is 29,903 bp in length, with a 79.5% identity to the SARS-CoV gene sequence and a 40% identity to the MERS-CoV sequence. The main structures of the SARS-CoV-2 virus particle include single-stranded positive-strand nucleic acid (ssRNA), spike protein (S), membrane protein (M), envelope protein (E), and nucleocapsid protein (N). Similar to other β-coronaviruses, the adsorption and invasion process of the SARS-CoV-2 virus to cells mainly depends on the S protein; in this process, the S protein is assembled in the form of a homotrimer with a short cytoplasmic tail and a hydrophobic transmembrane domain that anchors the protein to the membrane.

[0009] The S protein can be divided into the receptor binding subunit S1 and the membrane fusion subunit S2. The S1 subunit can be further divided into the signal peptide region (SP), the N-terminal region (NTD) and the receptor binding domain (RBD). The S2 subunit is anchored to the membrane through the transmembrane region. It contains the basic elements required for the membrane fusion process, including: the intrinsic membrane fusion peptide (FP), two heptad repeats (HR), the transmembrane domain (TM), and the C-terminal cytoplasmic domain (CP).

[0010] The S protein consists of a signal peptide region (SP), an extracellular domain (ECD), a transmembrane domain (TM) and a cytoplasmic domain (CP) from the N-terminus to the C-terminus. Among them, the extracellular domain can be further divided into an N-terminal region (NTD), a receptor binding domain (RBD), an intrinsic membrane fusion peptide (FP) and two 7-peptide repeat sequences (HR1 and HR2), belonging to the first type of viral membrane fusion protein. The signal peptide region of the S protein corresponds to the region of amino acid positions 1-13 of the S protein; the extracellular domain corresponds to the region of amino acid positions 14-1213 of the S protein; the transmembrane domain corresponds to the region of amino acid positions 1214-1237 of the S protein; and the cytoplasmic domain corresponds to the region of amino acid positions 1238-1273 of the S protein. The amino acid sequence of the S protein is shown in SEQ ID NO.1. In this article, unless otherwise specified, the amino acid positions of the recombinant S protein are numbered according to the amino acid sequence of the wild-type S protein as shown in SEQ ID NO.1.

[0011] By analyzing the pre-fusion structure of the S protein, it was found that the RBD domain of the S1 subunit undergoes a hinge-like conformational movement to hide or expose the key site of receptor binding. The "downward" state is a state that the receptor cannot bind, and the "upward" state is a state that the receptor can bind, which is in a relatively unstable state. This conformation allows the S protein to easily bind to the host receptor angiotensin-converting enzyme 2 (ACE2). After the RBD binds to the receptor, the S2 subunit changes to a post-fusion conformation by inserting the FP into the host cell membrane. HR1 and HR2 form an antiparallel six-helix bundle (6HB) that together form a fusion core, ultimately leading to the fusion of the viral membrane with the cell membrane. Using cryo-electron microscopy experiments, a large number of trimeric S glycoprotein domains were identified in the pre-fusion conformation. There are a large number of neutralizing antibody-sensitive epitopes on the pre-fusion S protein, and the post-fusion conformation minimizes the exposure of neutralization-sensitive epitopes that only exist on the pre-fusion conformation. Therefore, expressing a pre-fusion stable form of the SARS-CoV-2 S trimer protein is the key to developing a safe and effective SARS-CoV-2 vaccine. The optimized vaccine antigen will retain epitopes present in the prefusion conformation of the S protein and induce antibodies capable of inhibiting viral fusion.

[0012] As used herein, the terms "SARS-CoV-2 Omicron variant", "SARS-CoV-2 Omicron variant", "Omicron variant", "Omicron variant", "B.1.1.529", "Omicron coronavirus", and "Omicron coronavirus" are used interchangeably and refer to the SARS-CoV-2 subtype that first appeared in South Africa in November 2021. It has mutations at many locations in the genome relative to wild-type SARS-CoV-2, including mutations in S protein, ORF1a, ORF1b, ORF9b, M protein, E protein, and N protein. These mutations not only make the Omicron variant more transmissible, but also increase the resistance of this virus subtype to the protective effects of antibodies, making it more resistant to current SARS-CoV-2 vaccines and able to evade vaccine-induced immune responses. Currently, there are five subtypes of the Omicron variant (BA.1, BA.2, BA.3, BA.4, and BA.5), and they have evolved into multiple sub-branches, such as BQ1.1, BA.2.75.2, XBB, XBB.1.5, BF.7, and CH.1.1.

[0013] As used herein, the terms "SARS-CoV-2 Delta variant", "SARS-CoV-2 Delta variant", "Delta variant", "SARS-CoV-2 Delta variant", "B.1.617.2", "Delta coronavirus", and "Delta coronavirus" are used interchangeably and refer to the SARS-CoV-2 subtype that first appeared in India in October 2020, which has mutations at many locations in the genome relative to SARS-CoV-2. These mutations trigger the immune escape of the new coronavirus, resulting in the virus being more adaptable to the human body, spreading faster, having a higher viral load, requiring longer treatment time, and being more likely to develop into severe illness than other early new coronavirus subtypes.

[0014] In a first aspect, the present invention provides a recombinant SARS-CoV-2 spike protein (S protein), wherein the recombinant S protein comprises any one of the following mutations in the extracellular domain relative to the wild-type S protein:

[0015] (1) T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K;

[0016] (2) T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K;

[0017] (3) T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, and D1199N;

[0018] (4)T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E , G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K 417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K;

[0019] (5)T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E , G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K 417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K;

[0020] The amino acid positions are numbered according to the amino acid sequence of the wild-type S protein as shown in SEQ ID NO.1.

[0021] As used herein, the term "-" refers to an amino acid deletion or deletion mutation at the corresponding position. For example, a recombinant S protein comprising an "L24-" mutation means that the recombinant S protein has a leucine (L) deletion or deletion at position 24 of the amino acid sequence number corresponding to the wild-type S protein.

[0022] In some embodiments, the S1 / S2 cleavage site RRAR in the extracellular domain of the recombinant S protein (corresponding to amino acid positions 682-685 of the S protein) can be mutated to lose the ability to be cleaved by proteases such as Furin-like proteases and lysosomal proteases. In some embodiments, the S1 / S2 cleavage site RRAR in the recombinant S protein can be mutated to GGSG.

[0023] In some embodiments, the S2 cleavage site KR in the extracellular domain of the recombinant S protein (corresponding to amino acid positions 814-815 of the S protein) is mutated to lose the ability to be cleaved by proteases such as furin-like proteases and lysosomal proteases. In some embodiments, the S2 cleavage site KR in the recombinant S protein or its antigenic fragment can be mutated to AN.

[0024] During the intracellular packaging of the SARS-CoV-2 virus, the S protein may be cleaved by proteases such as furin-like proteases or lysosomal proteases, and the S protein with the S1 subunit and S2 subunit in a non-fused state may be secreted. By mutating the cleavage sites in the recombinant S protein, such as the S1 / S2 cleavage site and / or the S2 cleavage site, the recombinant S protein can be prevented from being cleaved by proteases, thereby further improving its stability.

[0025] In some embodiments, the recombinant S protein further comprises K986P and V987P mutations. Introducing two proline mutations K986P and V987P into the extracellular domain of the recombinant S protein can improve the stability of the prefusion conformation.

[0026] In some embodiments, the recombinant S protein may not include a functional fusion peptide domain (FP domain: corresponding to amino acid positions 788-806 of the S protein). For example, the recombinant S protein may include a mutated fusion peptide domain, such as through substitution, deletion, insertion and / or addition of one or more amino acid residues, resulting in the fusion peptide domain losing its natural function, such as the function of mediating fusion of the virus with the host cell membrane. Alternatively, in some embodiments, the recombinant S protein may not include a fusion peptide domain.

[0027] By removing the functional fusion peptide domain in the recombinant S protein, the stability of the pre-fusion conformation can be improved, thereby retaining and exposing a large number of neutralizing antibody-sensitive epitopes present on the pre-fusion conformation of the S protein.

[0028] In some embodiments, the recombinant S protein may not include a transmembrane domain (corresponding to the region of amino acid positions 1214-1237 of the S protein) and / or a cytoplasmic domain (corresponding to the region of amino acid positions 1238-1273 of the S protein). In some embodiments, the recombinant S protein may not include a cytoplasmic domain. In some embodiments, the recombinant S protein may not include a transmembrane domain and a cytoplasmic domain. In some embodiments, the recombinant S protein further includes a trimer domain, which, when expressed, promotes the formation of a trimer by the recombinant S protein.

[0029] As used herein, "trimer domain" refers to a protein or polypeptide domain that can spontaneously or inducedly form a trimer when expressed. A variety of such trimer domains are known in the art. By including a trimer domain in a recombinant S protein (e.g., by constructing a fusion protein), the recombinant S protein can be promoted to form a trimer conformation, and / or the trimer conformation of the recombinant S protein can be stabilized.

[0030] In some embodiments, the trimer domain in the recombinant S protein may include a T4 phage fibritin trimer motif. In some embodiments, the T4 phage fibritin trimer motif may have an amino acid sequence as shown in SEQ ID NO. 29 (GYIPEAPRDGQAYVRKDGEWVLLSTFL).

[0031] In some embodiments, the trimer domain can be directly fused to the recombinant S protein. In other embodiments, the trimer domain can be fused to the recombinant S protein through a linker. In some embodiments, the trimer domain can be fused to the N-terminus of the recombinant S protein. In other embodiments, the trimer domain can be fused to the C-terminus of the recombinant S protein. For example, the trimer domain can be fused to the C-terminus of the recombinant S protein through a linker. In some embodiments, the linker sequence can include the sequence shown in SEQ ID NO.30 (SAIG).

[0032] In some embodiments, the recombinant S protein further comprises a signal sequence; preferably, the signal sequence comprises an immunoglobulin heavy chain variable region (IGHV) signal sequence. For example, the signal sequence may have an amino acid sequence as shown in SEQ ID NO.31 (MDWIWRILFLVGAATGAHS).

[0033] In some embodiments, the recombinant S protein consists of any of the following from N-terminus to C-terminus:

[0034] i) extracellular domain;

[0035] ii) an extracellular domain, a transmembrane domain and optionally a cytoplasmic domain;

[0036] iii) extracellular domain and trimerization domain;

[0037] iv) an extracellular domain, a transmembrane domain, optionally a cytoplasmic domain, and a trimerization domain;

[0038] v) signal sequence, extracellular domain;

[0039] vi) a signal sequence, an extracellular domain, a transmembrane domain and optionally a cytoplasmic domain;

[0040] vii) a signal sequence, an extracellular domain, and a trimerization domain; and

[0041] viii) a signal sequence, an extracellular domain, a transmembrane domain, an optional cytoplasmic domain, and a trimerization domain.

[0042] In some embodiments, the recombinant S protein consists of the following from N-terminus to C-terminus: an optional signal sequence, an extracellular domain, an optional transmembrane domain, an optional cytoplasmic domain, and an optional trimerization domain.

[0043] In some embodiments, the recombinant S protein consists of the following from N-terminus to C-terminus: an extracellular domain, an optional transmembrane domain, and an optional cytoplasmic domain.

[0044] In a preferred embodiment, the recombinant S protein consists of the following from N-terminus to C-terminus: a signal sequence, an extracellular domain, a transmembrane domain, and a cytoplasmic domain.

[0045] In some embodiments, the extracellular domain has one or more of the following mutations relative to the wild-type sequence:

[0046] (1) T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K;

[0047] (2) T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K;

[0048] (3) T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, and D1199N;

[0049] (4)T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E , G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K 417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K;

[0050] (5)T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E , G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K 417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K;

[0051] (6) The S1 / S2 cleavage site RRAR is mutated to lose the ability to be cleaved by furin-like proteases and lysosomal proteases. Preferably, the S1 / S2 cleavage site is mutated to GGSG;

[0052] (7) the S2 cleavage site KR is mutated to lose the ability to be cleaved by furin-like proteases and lysosomal proteases, preferably, the S2 cleavage site is mutated to AN;

[0053] (8) K986P and / or V987P mutations;

[0054] (9) The fusion peptide domain is mutated to lose the function of mediating fusion between the virus and the host cell membrane; preferably, the fusion peptide domain deletion mutation.

[0055] In some embodiments, the signal sequence comprises an immunoglobulin heavy chain variable region (IGHV) signal sequence. For example, the signal sequence has an amino acid sequence as shown in SEQ ID NO.31.

[0056] In some embodiments, the trimer domain is a T4 phage fibritin trimer motif. In some embodiments, the T4 phage fibritin trimer motif has an amino acid sequence as shown in SEQ ID NO.29.

[0057] In a preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K.

[0058] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D40 5N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, S1 / S2 cleavage site RRAR mutated to GGSG and S2 cleavage site KR mutated to AN.

[0059] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R40 8S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, K986P, V987P, S1 / S2 cleavage site RRAR mutation to GGSG and S2 cleavage site KR mutation to AN. For example, the recombinant S protein has the amino acid sequence shown in SEQ ID NO.6.

[0060] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S 375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K.

[0061] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, S1 / S2 cleavage site RRAR mutated to GGSG and S2 cleavage site KR mutated to AN.

[0062] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, K986P, V987P, S1 / S2 cleavage site RRAR mutation to GGSG and S2 cleavage site KR mutation to AN. For example, the recombinant S protein has the amino acid sequence shown in SEQ ID NO.7.

[0063] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S37 1F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, and D1199N.

[0064] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S371F, S373P, S375F, T37 6A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, D1199N, S1 / S2 cleavage site RRAR mutated to GGSG and S2 cleavage site KR mutated to AN.

[0065] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S371F, S373P, S375F, T376A, D40 5N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, D1199N, K986P, V987P, S1 / S2 cleavage site RRAR mutation to GGSG and S2 cleavage site KR mutation to AN. For example, the recombinant S protein has the amino acid sequence shown in SEQ ID NO.8.

[0066] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S37 1F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K.

[0067] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T37 6A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, S1 / S2 cleavage site RRAR mutated to GGSG and S2 cleavage site KR mutated to AN.

[0068] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D40 5N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, K986P, V987P, S1 / S2 cleavage site RRAR is mutated to GGSG and S2 cleavage site KR is mutated to AN. For example, the recombinant S protein has the amino acid sequence shown in SEQ ID NO.9.

[0069] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S37 1F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K.

[0070] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T37 6A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, S1 / S2 cleavage site RRAR mutated to GGSG and S2 cleavage site KR mutated to AN.

[0071] In another preferred embodiment, the recombinant S protein consists of a signal sequence, an extracellular domain, a transmembrane domain and a cytoplasmic domain from N-terminus to C-terminus, and the extracellular domain has the following mutations relative to the wild-type sequence: T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D40 5N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, K986P, V987P, S1 / S2 cleavage site RRAR is mutated to GGSG and S2 cleavage site KR is mutated to AN. For example, the recombinant S protein has the amino acid sequence shown in SEQ ID NO.10.

[0072] In some embodiments, the recombinant S protein has an amino acid sequence selected from any one of SEQ ID NOs. 6-10.

[0073] In a second aspect, the present invention provides mRNA encoding the recombinant S protein of the first aspect of the present invention.

[0074] In some embodiments, the mRNA comprises, from 5' to 3' direction, a cap structure, a 5'-UTR, an open reading frame (ORF) encoding the recombinant S protein of the present invention, a 3'-UTR, and a polyA tail.

[0075] In some embodiments, the cap structure may have m 7 G5'ppp5'(2'-OMe)NpG, where m 7 G is N7-methylguanosine; p is phosphate; ppp is triphosphate; 2'-OMe is 2'-methoxy modification; N is any nucleoside, such as adenine nucleoside (A), guanosine nucleoside (G), cytidine nucleoside (C) and uridine nucleoside (U), or other naturally occurring nucleosides or modified nucleosides.

[0076] In some embodiments, the 5'-UTR may comprise a 5'-UTR of a gene selected from the group consisting of a β-globin (HBB) gene, a heat shock protein 70 (Hsp70) gene, a axial filament motor protein heavy chain 2 (DNAH2) gene, a 17β-hydroxysteroid dehydrogenase 4 (HSD17B4) gene, or a homolog, fragment or variant thereof. For example, the variant sequence may have at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with the wild-type 5'-UTR sequence of the corresponding gene.

[0077] In some embodiments, the 5'-UTR comprises a 5'-UTR derived from a 17β-hydroxysteroid dehydrogenase 4 (HSD17B4) gene or a homologue, fragment or variant thereof. In some embodiments, the 5'-UTR comprises a 5'-UTR derived from a 17β-hydroxysteroid dehydrogenase 4 (HSD17B4) gene or a homologue, fragment or variant thereof. In some embodiments, the 5'-UTR comprises a sequence as shown in SEQ ID NO.27 (GTCCCGCAGTCGGCGTCCAGCGGCTCTGCTTGTTCGTGTGTGTGTCGT TGCAGGCCTTATTC).

[0078] In some embodiments, the 3'-UTR may comprise a 3'-UTR of a gene selected from the group consisting of an albumin (ALB) gene, an alpha-globin gene, a beta-globin (HBB) gene, a tyrosine hydroxylase gene, a heat shock protein 70 (Hsp70) gene, a lipoxygenase gene, and a collagen alpha gene. For example, the variant sequence may have at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with the wild-type 3'-UTR sequence of the corresponding gene. In some embodiments, the 3'-UTR comprises a 3'-UTR derived from an albumin (ALB) gene, or a homolog, fragment, or variant thereof. Preferably, the 3'-UTR comprises a sequence as shown in SEQ ID NO.28 (AGCCAACACCCTGTCTAAAAAACATAAATTTCTTTAATCATTTTGCCTC TTTTCTCTGTGCTTCAATTAATAAAAAATGGAAAGAACCT).

[0079] In some embodiments, the length of the poly A tail can be 100-200 nucleotides, such as about 100 nucleotides, about 110 nucleotides, about 120 nucleotides, about 130 nucleotides, about 140 nucleotides, about 150 nucleotides, about 160 nucleotides, about 170 nucleotides, about 180 nucleotides, about 190 nucleotides, or about 200 nucleotides. In some embodiments, the length of the poly A tail can be 100-150 nucleotides. In some embodiments, the length of the poly A tail can be about 120 nucleotides.

[0080] In some embodiments, the mRNA of the present invention comprises a sequence as shown in any one of SEQ ID NOs. 15-19, or consists of a sequence as shown in any one of SEQ ID NOs. 15-19.

[0081] In some embodiments, one or more nucleotides in the mRNA can be modified. For example, one or more nucleotides (e.g., all nucleotides) in the mRNA can be independently replaced with naturally occurring nucleotide analogs or artificially synthesized nucleotide analogs.

[0082] In some embodiments, the naturally occurring nucleotide analogs are selected from pseudouridine, 2-thiouridine, 5-methyluridine, 5-methylcytidine and N6-methyladenosine. In some embodiments, the artificially synthesized nucleotide analogs are selected from N1-methylpseudouridine and 5-ethynyluridine.

[0083] In some embodiments, one or more uridine triphosphates in the mRNA can be each independently replaced by pseudouridine triphosphate, 2-thiouridine triphosphate, 5-methyluridine triphosphate, N1-methylpseudouridine triphosphate or 5-ethynyluridine triphosphate, and / or one or more cytidine triphosphates can be each independently replaced by 5-methylcytidine triphosphate, and / or one or more adenosine triphosphates can be each independently replaced by N6-methyladenosine triphosphate.

[0084] In some embodiments, one or more uridine triphosphates in the mRNA can be replaced by pseudouridine triphosphate, 1-methyl-pseudouridine triphosphate or 5-ethynyluridine triphosphate. In some embodiments, one or more cytidine triphosphates in the mRNA can be replaced by 5-methylcytidine triphosphate.

[0085] In a third aspect, the present invention provides a composition comprising one or more recombinant S proteins of the first aspect of the present invention, or one or more mRNAs of the second aspect of the present invention.

[0086] In some embodiments, the composition comprises one or more recombinant S proteins of the first aspect of the present invention. In some embodiments, the composition comprises a recombinant S protein having an amino acid sequence as shown in any one of SEQ ID NOs. 6-10.

[0087] In some embodiments, the composition comprises one or more mRNAs of the second aspect of the invention. In some embodiments, the composition comprises an mRNA having a sequence as shown in any one of SEQ ID NOs. 15-19.

[0088] In some embodiments, the molar ratio of different recombinant S proteins or different mRNAs in the composition is 1-3:1-3, such as 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1.5:2.5, 2:1.5, 2:2.5, 2:3, 2.5:3, preferably 1:1. In a preferred embodiment, the molar ratio of different recombinant S proteins of the first aspect of the invention in the composition is 1-3:1-3, such as 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1.5:1, 1.5:2, 1.5:2.5, 2:1, 2:1.5, 2:2.5, 2:3, 2.5:1, 2.5:1.5, 2.5:2, 2.5:3, 3:1, 3:2, 3:2.5, preferably 1:1. In a preferred embodiment, the molar ratio of different mRNAs of the second aspect of the invention in the composition is 1-3:1-3, for example 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1.5:1, 1.5:2, 1.5:2.5, 2:1, 2:1.5, 2:2.5, 2:3, 2.5:1, 2.5:1.5, 2.5:2, 2.5:3, 3:1, 3:2, 3:2.5, preferably 1:1.

[0089] In some embodiments, the composition further comprises at least one of the following recombinant S proteins or mRNA encoding the same:

[0090] (a) Wild-type S protein;

[0091] (b) a recombinant S protein comprising the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R and D950N;

[0092] (c) a recombinant S protein comprising the following mutations relative to the wild-type S protein: A67V, H69 deletion mutation, V70 deletion mutation, T95I, G142 deletion mutation, V143 deletion mutation, Y144 deletion mutation, Y145D, N211 deletion mutation, L212I, insertion mutation of three amino acids E, P, E between R214 and D215, G339D, S371L, S3 73P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, and L981F;

[0093] (d) A recombinant S protein comprising the following mutations relative to the wild-type S protein: G75V, T76I, R246 deletion, S247 deletion, Y248 deletion, L249 deletion, T250 deletion, P251 deletion, G252 deletion, D253N, L452Q, F490S, D614G and T859N.

[0094] In some embodiments, the S1 / S2 cleavage site RRAR in the above-mentioned recombinant S proteins (a)-(d) can be mutated to lose the ability to be cleaved by proteases such as furin-like proteases and lysosomal proteases; preferably, the S1 / S2 cleavage site RRAR is mutated to GGSG.

[0095] In some embodiments, the S2 cleavage site KR in the above recombinant S proteins (a)-(d) can be mutated to lose the ability to be cleaved by proteases such as furin-like proteases and lysosomal proteases; preferably, the S2 cleavage site KR is mutated to AN.

[0096] In some embodiments, the above-mentioned recombinant S proteins (a)-(d) further include K986P and V987P mutations relative to the wild-type S protein.

[0097] In a preferred embodiment, the recombinant S protein (a)-(d) has an amino acid sequence selected from any one of SEQ ID NOs. 2 to 5. In a preferred embodiment, the mRNA encoding the recombinant S protein (a)-(d) has a sequence selected from any one of SEQ ID NOs. 11-14.

[0098] In some embodiments, the molar ratio of different recombinant S proteins or different mRNAs in the composition is 1-3:1-3, such as 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1.5:2.5, 2:1.5, 2:2.5, 2:3, 2.5:3, preferably 1:1. In a preferred embodiment, the molar ratio of different recombinant S proteins of the first aspect of the invention in the composition is 1-3:1-3, such as 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1.5:1, 1.5:2, 1.5:2.5, 2:1, 2:1.5, 2:2.5, 2:3, 2.5:1, 2.5:1.5, 2.5:2, 2.5:3, 3:1, 3:2, 3:2.5, preferably 1:1. In a preferred embodiment, the molar ratio of different mRNAs of the second aspect of the invention in the composition is 1-3:1-3, for example 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1.5:1, 1.5:2, 1.5:2.5, 2:1, 2:1.5, 2:2.5, 2:3, 2.5:1, 2.5:1.5, 2.5:2, 2.5:3, 3:1, 3:2, 3:2.5, preferably 1:1.

[0099] In a preferred embodiment, the composition comprises recombinant S protein-1 and recombinant S protein-2, or mRNA-1 and mRNA-2, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R, D950N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; the recombinant S protein-2 or the recombinant S protein encoded by mRNA-2 comprises the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutation to GGSG, S2 cleavage site KR mutation to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S3 71F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E48 4A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1 to recombinant S protein-2 in the composition is 1:1, or the molar ratio of mRNA-1 to mRNA-2 in the composition is 1:1.

[0100] In another preferred embodiment, the composition comprises recombinant S protein-1 and recombinant S protein-2, or mRNA-1 and mRNA-2, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213 G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K; recombinant S protein or mRNA-encoded recombinant S protein relative to wild-type S The protein contains the following mutations: S1 / S2 cleavage site RRAR mutated to GGSG, S2 cleavage site KR mutated to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K417 N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1 to recombinant S protein-2 in the composition is 1:1, or the molar ratio of mRNA-1 to mRNA-2 in the composition is 1:1.

[0101] In another preferred embodiment, the composition comprises recombinant S protein-1 and recombinant S protein-2, or mRNA-1 and mRNA-2, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213 G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K; recombinant S protein or mRNA-encoded recombinant S protein relative to wild-type S The protein contains the following mutations: S1 / S2 cleavage site RRAR mutated to GGSG, S2 cleavage site KR mutated to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K417 N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1 to recombinant S protein-2 in the composition is 1:1, or the molar ratio of mRNA-1 to mRNA-2 in the composition is 1:1.

[0102] In another preferred embodiment, the composition comprises recombinant S protein-1 and recombinant S protein-2, or mRNA-1 and mRNA-2, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site mutates to GGSG, the S2 cleavage site mutates to AN, K986P and V987P; the recombinant S protein-2 or the recombinant S protein encoded by mRNA-2 comprises the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site RRAR mutates to GGSG, the S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1 to recombinant S protein-2 in the composition is 1:1, or the molar ratio of mRNA-1 to mRNA-2 in the composition is 1:1.

[0103] In another preferred embodiment, the composition comprises recombinant S protein-1 and recombinant S protein-2, or mRNA-1 and mRNA-2, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R, D950N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; the recombinant S protein-2 or the recombinant S protein encoded by mRNA-2 comprises the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutation to GGSG, S2 cleavage site KR mutation to AN, K986P and V987P. 87P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478 K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1 to recombinant S protein-2 in the composition is 1:1, or the molar ratio of mRNA-1 to mRNA-2 in the composition is 1:1.

[0104] In another preferred embodiment, the composition comprises recombinant S protein-1 and recombinant S protein-2, or mRNA-1 and mRNA-2, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K; recombinant S protein-2 or mRNA-encoded S protein-2; The recombinant S protein encoded by the gene comprises the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S371F, S373P, S375F, T376A, D405N, R40 8S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K and D1199N; and the molar ratio of recombinant S protein-1 to recombinant S protein-2 in the composition is 1:1, or the molar ratio of mRNA-1 to mRNA-2 in the composition is 1:1.

[0105] In another preferred embodiment, the composition comprises recombinant S protein-1 and recombinant S protein-2, or mRNA-1 and mRNA-2, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G33 9D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K; recombinant S protein or mRNA encoding recombinant S-2. The protein contains the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1 to recombinant S protein-2 in the composition is 1:1, or the molar ratio of mRNA-1 to mRNA-2 in the composition is 1:1.

[0106] In another preferred embodiment, the composition comprises recombinant S protein-1 and recombinant S protein-2, or mRNA-1 and mRNA-2, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, and D1199N; recombinant S protein-2 or m The recombinant S protein encoded by RNA-2 contains the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1 to recombinant S protein-2 in the composition is 1:1, or the molar ratio of mRNA-1 to mRNA-2 in the composition is 1:1.

[0107] In another preferred embodiment, the composition comprises recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3, or mRNA-1, mRNA-2 and mRNA-3, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site RRAR mutates to GGSG, the S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A2 7S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K 444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N76 4K, D796Y, Q954H and N969K; wherein the recombinant S protein-2 or the recombinant S protein encoded by mRNA-2 contains the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G25 7S, G339H, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, and D1199N;The recombinant S protein-3 or the recombinant S protein encoded by mRNA-3 contains the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S , K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3 in the composition is 1:1:1, or the molar ratio of mRNA-1, mRNA-2 and mRNA-3 in the composition is 1:1:1. ;

[0108] In another preferred embodiment, the composition comprises recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3, or mRNA-1, mRNA-2 and mRNA-3, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R, D950N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; wherein the recombinant S protein-2 or mRNA-2 comprises the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R, D950N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; 2 The encoded recombinant S protein contains the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G , H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; the recombinant S protein-3 or the recombinant S protein encoded by mRNA-3 contains the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site RRAR mutates to GGSG, the S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S3 75F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3 in the composition is 1:1:1, or the molar ratio of mRNA-1, mRNA-2 and mRNA-3 in the composition is 1:1:1.

[0109] In another preferred embodiment, the composition comprises recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3, or mRNA-1, mRNA-2 and mRNA-3, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R, D950N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; wherein the recombinant S protein-2 or mRNA-2 encodes The recombinant S protein contains the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y5 05H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; the recombinant S protein-3 or the recombinant S protein encoded by mRNA-3 contains the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site RRAR mutates to GGSG, the S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S37 3P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3 in the composition is 1:1:1, or the molar ratio of mRNA-1, mRNA-2 and mRNA-3 in the composition is 1:1:1.

[0110] In another preferred embodiment, the composition comprises recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3, or mRNA-1, mRNA-2 and mRNA-3, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R, D950N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; wherein the recombinant S protein-2 or mRNA-2 encodes The recombinant S protein contains the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y5 05H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; the recombinant S protein-3 or the recombinant S protein encoded by mRNA-3 contains the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site RRAR mutates to GGSG, the S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S37 3P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3 in the composition is 1:1:1, or the molar ratio of mRNA-1, mRNA-2 and mRNA-3 in the composition is 1:1:1.

[0111] In another preferred embodiment, the composition comprises recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3, or mRNA-1, mRNA-2 and mRNA-3, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R, D950N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; wherein the recombinant S protein-2 or mRNA-2 comprises the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R, D950N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; 2 The encoded recombinant S protein contains the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G , H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; the recombinant S protein-3 or the recombinant S protein encoded by mRNA-3 contains the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site RRAR mutates to GGSG, the S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S3 75F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3 in the composition is 1:1:1, or the molar ratio of mRNA-1, mRNA-2 and mRNA-3 in the composition is 1:1:1.

[0112] In another preferred embodiment, the composition comprises recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3, or mRNA-1, mRNA-2 and mRNA-3, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site mutates to GGSG, and the S2 cleavage site mutates to AN, K986P and V987P; wherein the recombinant S protein-2 or the recombinant S protein encoded by mRNA-2 comprises the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site RRAR mutates to GGSG, and the S2 cleavage site KR Mutations are AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K , D796Y, Q954H and N969K; the recombinant S protein-3 or the recombinant S protein encoded by mRNA-3 contains the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site RRAR mutates to GGSG, the S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D4 05N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1, recombinant S protein-2 and recombinant S protein-3 in the composition is 1:1:1, or the molar ratio of mRNA-1, mRNA-2 and mRNA-3 in the composition is 1:1:1.

[0113] In another preferred embodiment, the composition comprises recombinant S protein-1 and recombinant S protein-2, or mRNA-1 and mRNA-2, wherein the recombinant S protein-1 or the recombinant S protein encoded by mRNA-1 comprises the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G33 9D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K; recombinant S protein or mRNA encoding recombinant S-2. The protein contains the following mutations relative to the wild-type S protein: S1 / S2 cleavage site RRAR mutates to GGSG, S2 cleavage site KR mutates to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H and N969K; and the molar ratio of recombinant S protein-1 to recombinant S protein-2 in the composition is 1:1, or the molar ratio of mRNA-1 to mRNA-2 in the composition is 1:1.

[0114] In some embodiments, the compositions of the present invention further comprise one or more pharmaceutically acceptable carriers, excipients, or diluents.

[0115] As used herein, the term "pharmaceutically acceptable" refers to a carrier, excipient or diluent that is suitable, within the scope of sound medical judgment, for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0116] Exemplary carriers for compositions of the present invention include saline, buffered saline, glucose and water. Exemplary excipients for compositions of the present invention include fillers, adhesives, disintegrants, coating agents, adsorbents, antiadhesives, glidants, preservatives, antioxidants, flavoring agents, coloring agents, sweeteners, solvents, cosolvents, buffers, chelating agents, viscosity imparting agents, surfactants, diluents, wetting agents, carriers, diluents, preservatives, emulsifiers, stabilizers and tension regulators. It is known to those skilled in the art that suitable excipients are selected to prepare compositions of the present invention. Typically, the selection of suitable excipients depends especially on the desired dosage form of the active agent used, the disease to be treated and the compositions.

[0117] Depending on the active agent (e.g., mRNA) employed, the compositions of the present disclosure may be prepared in various forms, such as solid, liquid, gaseous or lyophilized forms, particularly in the form of ointments, creams, transdermal patches, gels, powders, tablets, solutions, aerosols, granules, pills, suspensions, emulsions, capsules, syrups, liquids, elixirs, extracts, tinctures or fluid extracts, or in a form particularly suitable for the desired method of administration. The processes known in the invention for producing drugs are shown in the 22nd edition of Remington's Pharmaceutical Sciences (Ed. Maack Publishing Co, Easton, Pa., 2012), and may include, for example, conventional mixing, dissolving, granulating, sugar coating, grinding, emulsifying, encapsulating, embedding or lyophilizing processes.

[0118] In some embodiments, the composition may be a vaccine composition, optionally further comprising one or more adjuvants.

[0119] As used herein, the term "vaccine composition" refers to a biological preparation that induces or improves immunity to a specific disease. Stimulating the immune system of an individual with a vaccine composition induces the formation and / or proliferation of immune cells that specifically recognize the compounds contained in the vaccine. At least a portion of the immune cells remain viable for a period of time, which can be extended to 10, 20 or 30 years after vaccination. If the individual's immune system encounters a pathogen from which a compound capable of eliciting an immune response is derived within the aforementioned time period, the immune cells generated by vaccination are reactivated and the immune response to the pathogen is enhanced compared to the immune response of an individual who has not yet been stimulated with a vaccine and has encountered the immunogenic compound of the pathogen for the first time.

[0120] As used herein, "vaccination", "immunization", "immunization" or "vaccination" refers to the administration of a vaccine to a subject with the purpose of preventing the subject from developing one or more symptoms of a disease. In principle, vaccination includes a primary vaccination and optionally one or more booster vaccinations. Primary vaccination or primary immunization is defined as a plan of initial administration of a composition or unit dose disclosed herein to establish a protective immune response. Booster vaccination or booster immunization refers to an administration or plan of administration after the primary vaccination, for example, at least one week, at least 2 weeks, at least one month, at least 6 months, at least 1 year or even 5 or 10 years after the last administration of the primary vaccination plan. Booster administration attempts to enhance or rebuild the immune response of the primary vaccination.

[0121] The immune response to the composition or vaccine composition of the present invention is the formation of a humoral and / or cellular immune response in a subject to the antigenic protein present in the composition. For the purposes of the present invention, a "humoral immune response" refers to an immune response mediated by antibody molecules, including secretory (IgA) or IgG molecules, while a "cellular immune response" refers to an immune response mediated by T-lymphocytes and / or other leukocytes. An important aspect of cellular immunity involves the antigen-specific response of cytolytic T cells ("CTL"). CTLs are specific for peptide antigens presented in combination with proteins encoded by the major histocompatibility complex (MHC) and expressed on the cell surface. CTLs help induce and promote the destruction of intracellular microorganisms, or the lysis of cells infected by such microorganisms. Another aspect of cellular immunity involves the antigen-specific response of helper T cells. Helper T cells act to help stimulate function and focus the activity of nonspecific effector cells against cells that display peptide antigens bound to MHC molecules on their surfaces. The cellular immune response also involves the production of cytokines, chemokines and other such molecules produced by activated T cells and / or other leukocytes, including those derived from CD4+ and CD8+ T cells.

[0122] Therefore, the immune response can be a response that stimulates CTL, and / or helper T cell generation or activation. The generation of chemokines and / or cytokines can also be stimulated. The composition or vaccine composition of the present invention can also trigger an antibody-mediated immune response. Therefore, the immune response can include one or more of the following effects: antibody (e.g., IgA or IgG) generation of B cells; and / or activation of inhibitors, cytotoxic or helper T cells and / or T cells specific for proteins present in the vaccine. These responses can be used to neutralize infectivity, and / or mediate antibody-complement, or antibody-dependent cellular cytotoxicity (ADCC) to provide protection to immunized individuals. Such responses can be measured using standard immunoassays and neutralization assays known in the art.

[0123] As used herein, the term "adjuvant" refers to an agent that increases, stimulates, activates, strengthens or regulates the immune response to the active ingredient of the composition at the cellular level or the body fluid level, for example, an immune adjuvant stimulates the immune system to respond to the actual antigen but does not have an immune effect itself. Examples of such adjuvants include, but are not limited to, inorganic adjuvants (e.g., inorganic metal salts such as aluminum phosphate or aluminum hydroxide), organic adjuvants (e.g., saponins or squalene), oil-based adjuvants (e.g., Freund's complete adjuvant and Freund's incomplete adjuvant), cytokines (e.g., IL-1β, IL-2, IL-7, IL-12, IL-18, GM-CFS and INF-γ), particulate adjuvants (e.g., immunostimulatory complexes (ISCOMS), liposomes or biodegradable microspheres), viral particles, bacterial adjuvants (e.g., monophosphoryl lipid A or cell wall peptides), synthetic adjuvants (e.g., nonionic block copolymers, cell wall peptide analogs or synthetic lipid A) or synthetic polynucleotide adjuvants (e.g., polyarginine or polylysine). Preferably, the adjuvant is selected from aluminum adjuvants (e.g., aluminum hydroxide, aluminum phosphate, aluminum sulfate, alum), MF59, AS03, virosomes (e.g., hepatitis virus virosomes and influenza virus virosomes), AS04, thermoreversible oil-in-water emulsions, ISA51, Freund's adjuvant, IL-12, CpG motifs, mannose, or any combination thereof.

[0124] In some embodiments, the composition or vaccine composition further comprises one or more additional therapeutic agents. For example, the therapeutic agent can be selected from another antigenic protein or polypeptide, an antibody, a hormone or hormone analog, and a small molecule drug.

[0125] In a fourth aspect, the present invention provides a DNA encoding the mRNA of the second aspect of the present invention. In some embodiments, the DNA of the present invention can be used to prepare the mRNA of the present invention by transcription in vitro.

[0126] In some embodiments, the DNA of the present invention comprises a sequence as shown in any one of SEQ ID NOs. 20-24, or consists of a sequence as shown in any one of SEQ ID NOs. 20-24.

[0127] In a fifth aspect, the present invention provides a recombinant plasmid comprising the DNA of the fourth aspect of the present invention.

[0128] In some embodiments, the recombinant plasmid is a pT7TS plasmid.

[0129] In some embodiments, the recombinant plasmid further comprises an initiation sequence (Ori), a T7 promoter, a 5'-UTR, and a 3'-UTR.

[0130] In some embodiments, the starter sequence is a ColE1 type starter sequence. Preferably, the starter sequence comprises the sequence shown in SEQ ID NO.25, or consists of the sequence shown in SEQ ID NO.25.

[0131] In some embodiments, the T7 promoter comprises the sequence shown in SEQ ID NO. 26 (TAATACGACTCACTATAATG), or consists of the sequence shown in SEQ ID NO. 26.

[0132] In some embodiments, the 5'-UTR may comprise a 5'-UTR of a gene selected from the group consisting of a β-globin (HBB) gene, a heat shock protein 70 (Hsp70) gene, a axial filament motor protein heavy chain 2 (DNAH2) gene, a 17β-hydroxysteroid dehydrogenase 4 (HSD17B4) gene, or a homolog, fragment or variant thereof. For example, the variant sequence may have at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with the wild-type 5'-UTR sequence of the corresponding gene.

[0133] In some embodiments, the 5'-UTR comprises a 5'-UTR derived from a 17β-hydroxysteroid dehydrogenase 4 (HSD17B4) gene or a homologue, fragment or variant thereof. In some embodiments, the 5'-UTR comprises a 5'-UTR derived from a 17β-hydroxysteroid dehydrogenase 4 (HSD17B4) gene or a homologue, fragment or variant thereof. In some embodiments, the 5'-UTR comprises a sequence as shown in SEQ ID NO.27.

[0134] In some embodiments, the 3'-UTR may comprise a 3'-UTR of a gene selected from the group consisting of an albumin (ALB) gene, an alpha-globin gene, a beta-globin (HBB) gene, a tyrosine hydroxylase gene, a heat shock protein 70 (Hsp70) gene, a lipoxygenase gene, and a collagen alpha gene, or a homolog, fragment, or variant thereof. For example, the variant sequence may have at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with the wild-type 3'-UTR sequence of the corresponding gene.

[0135] In some embodiments, the 3'-UTR comprises a 3'-UTR derived from the albumin (ALB) gene or a homologue, fragment or variant thereof. Preferably, the 3'-UTR comprises the sequence shown in SEQ ID NO.28.

[0136] In some embodiments, the recombinant plasmid further comprises polyA, a resistance gene promoter, and a resistance gene.

[0137] In some embodiments, the length of the poly A tail can be 100-200 nucleotides, such as about 100 nucleotides, about 110 nucleotides, about 120 nucleotides, about 130 nucleotides, about 140 nucleotides, about 150 nucleotides, about 160 nucleotides, about 170 nucleotides, about 180 nucleotides, about 190 nucleotides, or about 200 nucleotides. In some embodiments, the length of the poly A tail can be 100-150 nucleotides. In some embodiments, the length of the poly A tail can be about 120 nucleotides.

[0138] In some embodiments, the resistance gene promoter is an ampicillin resistance gene promoter.

[0139] In some embodiments, the resistance gene is a kanamycin sulfate resistance gene.

[0140] In a sixth aspect, the present invention provides an mRNA-carrier particle comprising the mRNA of the second aspect of the present invention, and a carrier material encapsulating the mRNA.

[0141] In some embodiments, the carrier material may be selected from protamine, lipid nanoparticles (LNP), polymer materials and inorganic nanoparticles. In a preferred embodiment, the carrier material is LNP.

[0142] In some embodiments, LNP can comprise one or more of ionized lipid, PEGylated lipid, cholesterol and derivatives and phospholipid.For example, LNP can comprise any one of ionized lipid, PEGylated lipid, cholesterol and derivatives and phospholipid, wherein any two, any three or all four combinations.

[0143] In the seventh aspect, the present invention provides a method for preventing and / or treating a disease or condition associated with SARS-CoV-2 infection in a subject, comprising administering to the subject an effective amount of the recombinant S protein of the first aspect, the mRNA of the second aspect, the composition of the third aspect, the recombinant plasmid of the fifth aspect, or the mRNA-vector particle of the sixth aspect of the present invention.

[0144] As used herein, the terms "prevent" or "treat" refer to the reduction of the risk of acquiring or developing a disease or condition, i.e., preventing at least one of the clinical symptoms of a disease from developing in a subject susceptible to the disease, or not exposed to the pathogen prior to the onset of the disease. For example, treatment may include: (i) preventing the disease, disorder, and / or condition in a patient who may be susceptible to the disease, disorder, and / or condition but has not yet been diagnosed with the disease, disorder, and / or condition; (ii) inhibiting the disease, disorder, and / or condition, i.e., preventing its development; or (iii) alleviating the disease, disorder, and / or condition, i.e., causing regression of the disease, disorder, and / or condition.

[0145] As used herein, the term "effective amount" means an amount of a compound that, when administered to a subject for treatment or prevention of a disease, is sufficient to achieve such treatment or prevention. The "effective amount" may vary depending on the compound, the disease and its severity, and the age, weight, etc., of the subject to be treated. A "therapeutically effective amount" refers to an effective amount for therapeutic treatment. A "prophylactically effective amount" refers to an effective amount for prophylactic treatment.

[0146] The term "administering" as used herein refers to the physical introduction of an agent into a subject using any of the various methods and delivery systems known to those skilled in the art. Exemplary routes of administration include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, such as by injection or infusion.

[0147] As used herein, the terms "subject", "individual", and "patient" are well known in the art and are used interchangeably herein to refer to any subject, particularly a mammalian subject, in need of treatment. Examples include, but are not limited to, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species. The terms individual, subject, and patient do not themselves denote a particular age, sex, race, etc.

[0148] In an embodiment of the method of the present invention, the disease or condition is a disease or condition caused by infection with wild-type SARS-CoV-2 or a SARS-CoV-2 variant, such as an Omicron variant or a Delta variant.

[0149] In an eighth aspect, the present invention provides use of the recombinant S protein of the first aspect, the mRNA of the second aspect, the composition of the third aspect, the recombinant plasmid of the fifth aspect, or the mRNA-vector particle of the sixth aspect of the present invention in the preparation of a medicament for preventing and / or treating a disease or condition associated with SARS-CoV-2 infection in a subject.

[0150] In the ninth aspect, the present invention provides the recombinant S protein of the first aspect, the mRNA of the second aspect, the composition of the third aspect, the recombinant plasmid of the fifth aspect, or the mRNA-vector particle of the sixth aspect of the present invention, which is used to prevent and / or treat a disease or condition associated with SARS-CoV-2 infection in a subject.

[0151] In an embodiment of the use of the present invention, the disease or disorder is a disease or disorder caused by infection with wild-type SARS-CoV-2 or a SARS-CoV-2 variant, such as the Omicron variant or the Delta variant. BRIEF DESCRIPTION OF THE DRAWINGS

[0152] Figure 1 The schematic diagrams of the structures of the RBMRNA-01 plasmid, RBMRNA-02 plasmid, RBMRNA-03 plasmid, RBMRNA-04 plasmid and RBMRNA-05 plasmid of the present invention are shown.

[0153] Figure 2 The electrophoresis results of mRNAs transcribed from the RBMRNA-01, RBMRNA-02, RBMRNA-03, RBMRNA-04 and RBMRNA-05 plasmids of the present invention are shown.

[0154] Figure 3 The graph shows the results of Western blotting of the recombinant S proteins expressed by RBMRNA-01, RBMRNA-02, RBMRNA-03, RBMRNA-04 and RBMRNA-05 of the present invention.

[0155] Figure 4 The graph shows the results of cytokine secretion by mouse spleen cells stimulated with BQ.1.1S protein induced by the RBMRNA-combination 15 vaccine of the present invention detected by Elispot (compared with the PBS group, *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001.).

[0156] Figure 5 The graph shows the results of cytokine secretion by mouse spleen cells stimulated with XBB.1.5S protein induced by the RBMRNA-combination 15 vaccine of the present invention detected by Elispot (compared with the PBS group, *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001.).

[0157] Figure 6 The graph shows the TCID50 test results of mice against the BA.5 strain 3 days after vaccination with the RBMRNA-combination 15 vaccine of the present invention.

[0158] Figure 7 The graph shows the TCID50 test results of mice against the BA.5 strain 6 days after vaccination with the RBMRNA-combination 15 vaccine of the present invention. DETAILED DESCRIPTION

[0159] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific examples and accompanying drawings, and the advantages and features of the present invention will become clearer as the description progresses. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are carried out according to conventional conditions in the art, for example, the conditions described in Sambrook and Russeii et al., Molecular Cloning: A Laboratory Manual (3rd Edition) (2001), CSHL Press, or according to the conditions recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following examples are all commercially available.

[0160] Example 1. Preparation of mRNA

[0161] The recombinant S protein was obtained by the following mutations based on the wild-type SARS-CoV-2 S protein: S1 / S2 cleavage site RRAR mutated to GGSG, S2 cleavage site KR mutated to AN, K986P, V987P, T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S371 F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F4 86V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K.

[0162] Based on the sequence of the recombinant S protein, a DNA coding sequence was designed. After adding, for example, 5'-UTR, 3'-UTR, and polyA sequences to the DNA coding sequence, the sequences were inserted into the pT7TS plasmid by homologous recombination to form a recombinant vector pT7TS-2.0, and the final recombinant plasmid was named RBMRNA-01 plasmid.

[0163] The elements contained in the RBMRNA-01 plasmid include a start sequence (SEQ ID NO.25), a T7 promoter sequence (SEQ ID NO.26), a 5'-UTR sequence (SEQ ID NO.27), a 3'-UTR sequence (SEQ ID NO.28), a 3'-terminal polyadenylic acid (poly A) sequence, an ampicillin resistance gene promoter, and a kanamycin sulfate resistance gene. These non-coding structures are used to regulate the stability, translation efficiency, and immunogenicity of the mRNA transcribed from the RBMRNA-01 plasmid.

[0164] The coding region and polyA region of the RBMRNA-01 plasmid were sequenced, and the inserted target gene sequencing was completely consistent with the reference sequence. The entire plasmid structure was successfully constructed as shown in Figure 1 The RBMRNA-01 plasmid was transcribed in vitro to obtain mRNA (named RBMRNA-01, the sequence is shown in SEQ ID NO.15), and the mRNA was translated to obtain protein (named RBMRNA-01 protein, the sequence is shown in SEQ ID NO.6).

[0165] Referring to the above method, RBMRNA-02 plasmid, RBMRNA-03 plasmid, RBMRNA-04 plasmid, RBMRNA-05 plasmid (such as Figure 1 ), RBMRNA-02, RBMRNA-03, RBMRNA-04, and RBMRNA-05 were obtained by in vitro transcription, and their sequences were shown in SEQ ID NO.16-19, respectively. RBMRNA-02 protein, RBMRNA-03 protein, RBMRNA-04 protein, and RBMRNA-05 protein were obtained by translation, and their sequences were shown in SEQ ID NO.7-10, respectively.

[0166] Table 1. Mutation information of recombinant S protein encoded by mRNA vaccine

[0167]

[0168]

[0169] The size and integrity of the mRNA transcribed from the recombinant plasmids RBMRNA-01 plasmid, RBMRNA-02 plasmid, RBMRNA-03 plasmid, RBMRNA-04 plasmid and RBMRNA-05 plasmid were analyzed using the Agilent 2200 Tapestation electrophoresis system. Figure 2 As shown, the transcribed mRNA band is single and not degraded.

[0170] Example 2. Verification of mRNA expression

[0171] Referring to the instructions of Lipofectamine Messager MAX (ThermoFisher Scientific), 293T cells were transfected with 2.5 μg of RBMRNA-01, RBMRNA-02, RBMRNA-03, RBMRNA-04 and RBMRNA-05 obtained in Example 1, respectively, and cells not transfected with mRNA were used as negative controls. 24 hours after transfection, the expression of pre-fused Omicron type SARS-CoV-2 S protein was detected by protein immunoblotting, wherein rabbit anti-SARS-CoV-2 S protein antibody (GeneTex, GTX632604) was used for immunoblotting, and goat anti-rabbit-HRP secondary antibody was used for labeling. Figure 3 As shown, the expression of the prefusion S protein was successfully detected at 180 kDa, which was consistent with the expected size.

[0172] Example 3. Evaluation of IgG antibody titer induced by mRNA vaccine

[0173] RBMRNA-01, RBMRNA-02, RBMRNA-03, RBMRNA-04 and RBMRNA-05 in Example 1 are used to prepare mRNA vaccines, respectively, and are referred to as RBMRNA-01 vaccine, RBMRNA-02 vaccine, RBMRNA-03 vaccine, RBMRNA-04 vaccine and RBMRNA-05 vaccine. Lipid nanoparticles comprising the following components are used to encapsulate mRNA: 8-(3-hydroxypropyl) (9,12-dienyl-octadecyl-1)-amino-octanoic acid heptadecan-9-ol ester, distearoylphosphatidylcholine (DSPC), 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol 2000 (DMG-PEG2000) and cholesterol. The preparation method includes dissolving the above components in an ethanol solution, mixing the lipid ethanol solution with an mRNA aqueous solution by a microfluidic mixer to obtain lipid nanoparticles, and dialyzing, ultrafiltration and micron membrane filtration of the mixture to obtain an LNP vaccine preparation of mRNA. For specific vaccine preparation methods, see, for example, Chinese Patent Application No. 202011369776.2, which is incorporated herein by reference in its entirety.

[0174] The experiment used healthy BALB / c mice of SPF level, 6 to 8 weeks old, female, and randomly divided them into solvent control (PBS) group and immunization group (20 μg / mouse) according to the balanced weight of mice, with 6 mice in each group. After grouping, the mice in the immunization group were vaccinated twice by intramuscular injection according to the set dose on day 0 and day 21 for primary immunization and booster immunization, and the solvent control group was given an equal volume of PBS, and the serum of the mice was taken for the experiment. 14 days after the booster immunization, the titer of specific IgG antibodies in the mouse serum was detected by indirect ELISA. As shown in Table 2, each vaccine group can induce the production of specific high-titer IgG antibodies.

[0175] Table 2. Serum IgG antibody titers of immunized mice

[0176]

[0177] Example 4. Evaluation of the neutralization potency of mRNA multivalent vaccines

[0178] 4.1 Preparation of mRNA multivalent vaccines

[0179] Referring to the method in Example 1, RBMRNA-W plasmid and RBMRNA-D plasmid were obtained, and RBMRNA-W and RBMRNA-D were obtained by in vitro transcription, respectively, and their sequences were shown in SEQ ID NOs.11-12, respectively. They were translated to obtain RBMRNA-W protein and RBMRNA-D protein, respectively, and their sequences were shown in SEQ ID NOs.2-3, respectively.

[0180] Table 3. Mutation information of recombinant S protein encoded by mRNA vaccine

[0181]

[0182] Referring to the method of Example 3, RBMRNA-01 vaccine, RBMRNA-02 vaccine, RBMRNA-03 vaccine, RBMRNA-04 vaccine, RBMRNA-05 vaccine, RBMRNA-D vaccine and RBMRNA-W vaccine were obtained respectively; in addition, when preparing the vaccine, lipid nanoparticles were used to simultaneously encapsulate 2 or 3 mRNAs among RBMRNA-01, RBMRNA-02, RBMRNA-03, RBMRNA-04, RBMRNA-05, RBMRNA-D and RBMRNA-W, and different mRNAs were mixed in an equimolar ratio, i.e., 1:1 or 1:1:1, to obtain the bivalent or trivalent mRNA vaccines in the following Table 4 respectively.

[0183] Table 4. Bivalent or trivalent mRNA vaccine information

[0184] Encapsulated mRNA The vaccine obtained RBMRNA-D, RBMRNA-01 RBMRNA-Combination 1 Vaccine RBMRNA-01, RBMRNA-04 RBMRNA-Combination 2 Vaccine RBMRNA-01, RBMRNA-05 RBMRNA-combination 3 vaccines RBMRNA-W, RBMRNA-02 RBMRNA-Combination 4 Vaccine RBMRNA-D, RBMRNA-02 RBMRNA-combination 5 vaccines RBMRNA-02, RBMRNA-03 RBMRNA-combination 6 vaccines RBMRNA-02, RBMRNA-04 RBMRNA-combination 7 vaccines RBMRNA-03, RBMRNA-04 RBMRNA-Combination 8 Vaccine RBMRNA-02, RBMRNA-03, RBMRNA-04 RBMRNA-Combination 9 Vaccine RBMRNA-D, RBMRNA-01, RBMRNA-04 RBMRNA-Combination 10 Vaccine RBMRNA-D, RBMRNA-02, RBMRNA-04 RBMRNA-combination 11 vaccines RBMRNA-D, RBMRNA-02, RBMRNA-05 RBMRNA-Combination 12 Vaccine RBMRNA-D, RBMRNA-01, RBMRNA-05 RBMRNA-combination 13 vaccines RBMRNA-W, RBMRNA-02, RBMRNA-05 RBMRNA-Combination 14 Vaccine RBMRNA-02, RBMRNA-05 RBMRNA-Combination 15 Vaccine

[0185] 4.2 Evaluation of the neutralization potency of mRNA multivalent vaccines against multiple SARS-CoV-2 subtypes

[0186] The mRNA vaccine was used in the BALB / c mouse immunization test using a similar experimental method as in Example 3, and the sera of 4 mice in each group were used for the experiment. The vaccine group only used a high dose (20 μg / mouse). The mice were immunized and sera were collected on days 0 and 21, respectively, and S protein-specific neutralizing antibodies were detected by pseudovirus neutralization test.

[0187] After inactivating the serum in a water bath, centrifuge and collect the supernatant. Dilute the inactivated serum with serum-free DMEM medium. Add the diluted serum and pseudovirus to a 96-well plate and incubate at 37°C for 1 hour. Set up a blank control group without pseudovirus and a positive control group with only pseudovirus. After the incubation, add 293T-ACE2-p2A-mTagBFP2 cells to the 96-well plate. Culture at 37°C and 5% CO2 for 48 hours. After the culture is completed, wash off the culture medium, then add the FireflyLuciferase substrate reaction cleavage mixture, shake in the dark, and detect the luciferase chemiluminescence value using a multifunctional microplate reader. According to the macro used in the literature "Quantification of SARS-CoV-2 neutralizing antibody by apseudotyped virus-based assay" (https: / / www.nature.com / articles / s41596-020-0394-5), the experimental data of the blank control group, positive control group and test group (two replicates) were directly substituted into the table, the starting dilution multiple was set to 20, the dilution factor was set to 4, and the P / N limit was set to 1000, and the neutralization titer was directly obtained. The results are shown in Tables 5-12.

[0188] It can be seen from Tables 5 to 12 that the RBMRNA-01 vaccine, RBMRNA-02 vaccine, RBMRNA-03 vaccine, RBMRNA-04 vaccine, and RBMRNA-05 vaccine all have good inhibitory effects on different Omicron-type variants, and different combination vaccines can simultaneously have good inhibitory effects on the wild type, Delta type, and different Omicron-type variants.

[0189] Table 5. Neutralizing antibody titers of mouse serum against WT novel coronavirus pseudovirus 14 days after booster immunization

[0190] Vaccine group Sample 1 Sample 2 Sample 3 Sample 4 RBMRNA-W vaccine 4543 5185 5855 5609 RBMRNA-D vaccine 5673 5062 2256 3540 RBMRNA-01 vaccine 231 137 109 85 RBMRNA-02 vaccine 612 121 89 91 RBMRNA-03 vaccine 133 413 314 181 RBMRNA-04 vaccine 85 59 64 33 RBMRNA-05 vaccine 152 52 162 79 RBMRNA-Combination 1 Vaccine 3284 4069 3335 794 RBMRNA-Combination 2 Vaccine 1380 1543 2327 710 RBMRNA-combination 3 vaccines 735 671 1136 955 RBMRNA-Combination 4 Vaccine 3411 11551 2857 5720 RBMRNA-combination 5 vaccines 963 2066 1674 3475 RBMRNA-combination 6 vaccines 93 54 73 253 RBMRNA-combination 7 vaccines 140 309 581 308 RBMRNA-Combination 8 Vaccine 196 163 864 488 RBMRNA-Combination 9 Vaccine 149 157 141 124 RBMRNA-Combination 10 Vaccine 1402 2588 3718 2061 RBMRNA-combination 11 vaccines 750 5809 3770 1932 RBMRNA-Combination 12 Vaccine 8986 6590 5541 10459 RBMRNA-combination 13 vaccines 7935 5332 9134 6768 RBMRNA-Combination 14 Vaccine 1802 3924 4238 1307

[0191] Table 6 Neutralizing antibody titers of mouse serum against Delta-type novel coronavirus pseudovirus 14 days after booster immunization

[0192]

[0193]

[0194] Table 7 Neutralizing antibody titers of mouse serum against BA.5 novel coronavirus pseudovirus 14 days after booster immunization

[0195] Vaccine group Sample 1 Sample 2 Sample 3 Sample 4 RBMRNA-W vaccine 259 251 68 133 RBMRNA-D vaccine 740 47 639 453 RBMRNA-01 vaccine 9904 3106 11494 5986 RBMRNA-02 vaccine 14590 15285 15575 12727 RBMRNA-03 vaccine 539 2428 2598 2344 RBMRNA-04 vaccine 3213 1458 827 949 RBMRNA-05 vaccine 4108 1793 2003 1042 RBMRNA-Combination 1 Vaccine 1693 2852 2384 1009 RBMRNA-Combination 2 Vaccine 2721 3369 5680 5678 RBMRNA-combination 3 vaccines 4066 5627 5434 4193 RBMRNA-Combination 4 Vaccine 5895 10522 10394 8653 RBMRNA-combination 5 vaccines 9660 12653 6162 12124 RBMRNA-combination 6 vaccines 4325 7767 10760 12050 RBMRNA-combination 7 vaccines 8105 5740 10055 3922 RBMRNA-Combination 8 Vaccine 1984 3996 5023 4732 RBMRNA-Combination 9 Vaccine 6598 9690 6964 874 RBMRNA-Combination 10 Vaccine 6350 4468 6198 2235 RBMRNA-combination 11 vaccines 5093 5565 7051 6575 RBMRNA-Combination 12 Vaccine 9258 14597 8279 7008 RBMRNA-combination 13 vaccines 4138 10321 5232 4571 RBMRNA-Combination 14 Vaccine 9979 5964 5051 8914

[0196] Table 8 Neutralizing antibody titers of mouse serum against BQ.1.1 novel coronavirus pseudovirus 14 days after booster immunization

[0197]

[0198]

[0199] Table 9 Neutralizing antibody titers of mouse serum against XBB-type novel coronavirus pseudovirus 14 days after booster immunization

[0200]

[0201]

[0202] Table 10 Neutralizing antibody titers of mouse serum against BF.7 novel coronavirus pseudovirus 14 days after booster immunization

[0203] Vaccine group Sample 1 Sample 2 Sample 3 Sample 4 RBMRNA-W vaccine 49 117 21 23 RBMRNA-D vaccine 629 45 676 155 RBMRNA-01 vaccine 10818 11243 9064 6631 RBMRNA-02 vaccine 17367 5958 19394 11793 RBMRNA-03 vaccine 549 4685 2469 2766 RBMRNA-04 vaccine 2615 1427 838 722 RBMRNA-05 vaccine 4769 2116 1979 1226 RBMRNA-Combination 1 Vaccine 2110 3367 2511 1792 RBMRNA-Combination 2 Vaccine 2751 3092 5407 5509 RBMRNA-combination 3 vaccines 4164 5503 5014 4362 RBMRNA-Combination 4 Vaccine 2667 11677 7210 7620 RBMRNA-combination 5 vaccines 9262 9627 3031 7779 RBMRNA-combination 6 vaccines 4331 9386 14573 9316 RBMRNA-combination 7 vaccines 7195 7021 11145 7571 RBMRNA-Combination 8 Vaccine 1602 2919 8930 3427 RBMRNA-Combination 9 Vaccine 10477 7867 4105 1426 RBMRNA-Combination 10 Vaccine 7060 4658 6579 3114 RBMRNA-combination 11 vaccines 5721 5617 7538 7709 RBMRNA-Combination 12 Vaccine 9073 13393 8847 7709 RBMRNA-combination 13 vaccines 4977 10653 5779 4042 RBMRNA-Combination 14 Vaccine 9645 5036 5228 8873

[0204] Table 11 Neutralizing antibody titers of mouse serum against XBB.1.5 novel coronavirus pseudovirus 14 days after booster immunization

[0205]

[0206]

[0207] Table 12 Neutralizing antibody titers of mouse serum against CH.1.1 novel coronavirus pseudovirus 14 days after booster immunization

[0208] Vaccine group Sample 1 Sample 2 Sample 3 Sample 4 RBMRNA-W vaccine <20 37 <20 <20 RBMRNA-D vaccine <20 <20 <20 <20 RBMRNA-01 vaccine 1120 169 709 896 RBMRNA-02 vaccine 11411 2908 4802 1965 RBMRNA-03 vaccine 2320 1812 2294 6918 RBMRNA-04 vaccine 731 1085 1053 260 RBMRNA-05 vaccine 1196 1014 1301 1414 RBMRNA-Combination 1 Vaccine 294 1410 117 377 RBMRNA-Combination 2 Vaccine 632 1029 725 641 RBMRNA-combination 3 vaccines 1067 790 2919 1187 RBMRNA-Combination 4 Vaccine 600 578 4434 1152 RBMRNA-combination 5 vaccines 705 1141 2165 2175 RBMRNA-combination 6 vaccines 2060 1778 3241 2276 RBMRNA-combination 7 vaccines 7120 2582 2490 2048 RBMRNA-Combination 8 Vaccine 1088 1008 732 1097 RBMRNA-Combination 9 Vaccine 7238 3250 4005 380 RBMRNA-Combination 10 Vaccine 1300 169 1064 1077 RBMRNA-combination 11 vaccines 4386 3755 6509 4609 RBMRNA-Combination 12 Vaccine 4099 6742 3069 1598 RBMRNA-combination 13 vaccines 830 1115 2522 1515 RBMRNA-Combination 14 Vaccine 2182 3414 6251 2875

[0209] Example 5. Th1-biased cellular immune response induced by bivalent mRNA vaccine

[0210] Referring to the method of Example 3, lipid nanoparticles were used to simultaneously encapsulate RBMRNA-02 and RBMRNA-05 when preparing the vaccine; they were mixed in an equimolar ratio (1:1) to obtain the RBMRNA-combination 15 vaccine. The RBMRNA-combination 15 vaccine was used for BALB / c mouse immunization test. Female SPF-level healthy BALB / c mice aged 6-8 weeks were used for immunization. The experiment was randomly divided into a solvent control group (PBS), a low-dose vaccine group (1 μg / mouse), a medium-dose vaccine group (5 μg / mouse) and a high-dose vaccine group (20 μg / mouse) according to the weight balance of the mice, with 12 mice in each group. After grouping, the vaccine preparations were inoculated twice on day 0 and day 21 by intramuscular injection according to the set dose for primary and booster immunization, and the solvent control group was given an equal volume of PBS. Seven days after booster immunization, spleens of mice were taken to isolate spleen lymphocytes, and ELISPOT kits were used: Mouse IL-4precoated ELISPOT kit (Da Kewei, 2210402), Mouse IL-5ELIspotPLUS (HRP) (Mabtech, 3391-4HPW-2), Mouse IL-2ELIspotPLUS (HRP) (Mabtech, 3441-4HPW-2), Mouse IFN-γprecoated ELISPOTkit (Da Kewei, 2210005) to detect T lymphocytes secreting IFN-γ, IL-2, IL-4 and IL-5. The results are shown in Table 1. Figure 4 , Figure 5 shown.

[0211] The results showed that whether the spleen lymphocytes were stimulated with BQ.1.1S protein (ACRO BIOSYSTEMS, SPN-C522S) or XBB.1.5S protein (ACRO BIOSYSTEMS, SPN-C524i), after vaccination with low, medium, and high doses of RBMRNA-combination 15 vaccine, the T lymphocytes that secreted Th1 cytokines INFγ and IL2 were significantly more than the T lymphocytes that secreted Th2 cytokines IL4 and IL5. The immune response induced by RBMRNA-combination 15 vaccine was a Th1-biased immune response.

[0212] Example 6. Bivalent mRNA vaccine challenge protection test

[0213] The RBMRNA-combination 15 vaccine obtained in Example 5 was used for the mouse attack protection test. The test selected 6-9 week-old SPF grade K18-hACE2 transgenic mice that passed the quarantine, set up a negative control group (unattacked) (Group A), an attack control group (Group B) and a vaccine group (Group C), and the immunization procedure was on day 0 (as the first immunization) and day 21 (as a booster immunization), a total of 2 immunizations. The vaccine group was given 20 μg / mouse RBMRNA-combination 15 vaccine by intramuscular injection, and the negative control group and the attack control group were given an equal volume of normal saline. Six weeks after the booster immunization, the attack control group and the vaccine group were infected with the new coronavirus SARS-CoV-2 variant BA.5 strain by intranasal drops of hACE2 transgenic mice, and the infection dose was 1000TCID50. Body weight changes were recorded daily after infection, and the death of animals in each group after infection was recorded daily until all animals in the control group died, and the mortality rate was calculated; 3 days and 6 days after infection, 3 mice and 4 mice were dissected in each group, respectively, and the right lung tissue was taken to detect the virus titer by TCID50 experiment, and the left lung tissue was dissected and fixed and stained with HE for pathological examination.

[0214] like Figure 6 and Figure 7 As shown, compared with the negative control group (Group A), higher titers of BA.5 virus were detected in the lung tissues of the challenge control group (Group B) at 3 and 6 days after the challenge, indicating that the virus replicated stably after the challenge, while no virus was detected in the lung tissues of the mice in the vaccine group (Group C). These results show that the RBMRNA-combination 15 vaccine can effectively protect mice from infection with the SARS-CoV-2 BA.5 variant.

[0215] This application refers to various issued patents, published patent applications, journal articles and other publications, all of which are incorporated herein by reference. If any incorporated reference conflicts with this specification, this specification shall prevail. In addition, any specific embodiment of the present invention that falls within the scope of the prior art may be explicitly excluded from any one or more claims. Because the embodiments are considered to be known to those skilled in the art, they may be excluded, even if the exclusion is not explicitly listed in this application. Any specific embodiment of the present invention may be excluded from any claim for any reason, whether or not it is related to the existence of the prior art.

[0216] Although the present invention has been described with reference to specific embodiments thereof, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the present invention. In addition, many modifications may be made to adapt specific situations, materials, compositions, methods, process steps to the purpose, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims.

Claims

1. A recombinant SARS-CoV-2 spike protein (S protein), wherein the recombinant S protein comprises the following mutations in the extracellular domain relative to the wild-type S protein: The S1 / S2 cleavage site RRAR was mutated to lose the ability to be cleaved by furin-like proteases and lysosomal proteases; The S2 cleavage site KR was mutated to lose the ability to be cleaved by furin-like proteases and lysosomal proteases; K986P and V987P mutations; and Any one of the following mutations (1)-(5): (1) T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K; (2) T19I, L24-, P25-, P26-, A27S, H69-, V70-, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K; (3) T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, and D1199N; (4)T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E , G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K 417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K; (5)T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E , G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K 417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K; in, The amino acid positions are numbered according to the amino acid sequence of the wild-type S protein as shown in SEQ ID NO.

1.

2. The recombinant S protein according to claim 1, wherein the S1 / S2 cleavage site is mutated to GGSG.

3. The recombinant S protein according to claim 1 or 2, wherein the S2 cleavage site is mutated to AN.

4. The recombinant S protein according to any one of claims 1 to 3, which comprises an extracellular domain, a transmembrane domain and a cytoplasmic domain from the N-terminus to the C-terminus.

5. The recombinant S protein according to claim 4, wherein the recombinant S protein further comprises a signal sequence, preferably, the signal sequence is an immunoglobulin heavy chain variable region signal sequence.

6. The recombinant S protein according to claim 1, which has an amino acid sequence selected from any one of SEQ ID NOs. 6-10.

7. mRNA encoding the recombinant S protein according to any one of claims 1 to 6. 8 . The mRNA according to claim 7 , which comprises, from 5′ to 3′ direction, a cap structure, a 5′-UTR, an open reading frame (ORF), a 3′-UTR and a polyA tail.

9. The mRNA according to claim 8, wherein the 5'-UTR comprises a 5'-UTR derived from the 17β-hydroxysteroid dehydrogenase 4 (HSD17B4) gene or a homologue, fragment or variant thereof, preferably, the 5'-UTR comprises a sequence as shown in SEQ ID NO.27; wherein the 3'-UTR comprises a 3'-UTR derived from an albumin (ALB) gene or a homologue, fragment or variant thereof, preferably, the 3'-UTR comprises a sequence as shown in SEQ ID NO.28; and / or The length of the polyA tail is 100-150 nucleotides.

10. The mRNA according to any one of claims 7-9, wherein the sequence of the mRNA is shown in any one of SEQ ID NOs. 15-19.

11. The mRNA according to any one of claims 7 to 10, wherein one or more nucleotides in the mRNA are each independently replaced by a naturally occurring nucleotide analog or an artificially synthesized nucleotide analog, wherein the naturally occurring nucleotide analog is selected from pseudouridine, 2-thiouridine, 5-methyluridine, 5-methylcytidine and N6-methyladenosine, and the artificially synthesized nucleotide analog is selected from N1-methylpseudouridine and 5-ethynyluridine; Preferably, one or more uridine triphosphates in the mRNA are each independently replaced by pseudouridine triphosphate, 1-methyl-pseudouridine triphosphate or 5-ethynyluridine triphosphate, and / or one or more cytidine triphosphates are replaced by 5-methylcytidine triphosphate.

12. A composition comprising one or more recombinant S proteins according to any one of claims 1 to 6, or one or more mRNAs according to any one of claims 7 to 11.

13. The composition according to claim 12, wherein the composition comprises one or more recombinant S proteins having an amino acid sequence as shown in any one of SEQ ID NOs. 6-10 or one or more mRNAs having a sequence as shown in any one of SEQ ID NOs. 15-19.

14. The composition according to claim 12 or 13, further comprising at least one of the following recombinant S proteins or mRNA encoding the same: (a) a recombinant S protein comprising the following mutations relative to the wild-type S protein: the S1 / S2 cleavage site mutation is GGSG, the S2 cleavage site mutation is AN, K986P and V987P; (b) a recombinant S protein comprising the following mutations relative to the wild-type S protein: T19R, G142D, E156G, F157 and R158 deletion mutations, A222V, L452R, T478K, D614G, P681R, D950N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; (c) a recombinant S protein comprising the following mutations relative to the wild-type S protein: A67V, H69 deletion mutation, V70 deletion mutation, T95I, G142 deletion mutation, V143 deletion mutation, Y144 deletion mutation, Y145D, N211 deletion mutation, L212I, insertion mutation of three amino acids E, P, E between R214 and D215, G339D, S371L, S373P, S375F, K417N, N440K , G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P, and V987P; (d) a recombinant S protein comprising the following mutations relative to the wild-type S protein: G75V, T76I, R246 deletion, S247 deletion, Y248 deletion, L249 deletion, T250 deletion, P251 deletion, G252 deletion, D253N, L452Q, F490S, D614G, T859N, S1 / S2 cleavage site mutation to GGSG, S2 cleavage site mutation to AN, K986P and V987P; Preferably, the recombinant S proteins (a)-(d) have the amino acid sequences shown in SEQ ID NOs. 2-5, respectively, and / or the mRNA encoding the recombinant S proteins (a)-(d) have the sequences shown in SEQ ID NOs. 11-14, respectively.

15. The composition according to any one of claims 12 to 14, wherein the molar ratio of different recombinant S proteins or different mRNAs in the composition is 1-3:1-3, preferably 1:

1.

16. A DNA encoding the mRNA according to any one of claims 7 to 11.

17. The DNA according to claim 16, wherein the sequence of the DNA is shown in any one of SEQ ID NOs. 20-24.

18. A recombinant plasmid comprising the DNA according to claim 16 or 17. The recombinant plasmid according to claim 18 , wherein the plasmid is a pT7TS plasmid.

20. The recombinant plasmid according to claim 19, further comprising an initiation sequence (Ori), a T7 promoter, a 5'-UTR and a 3'-UTR.

21. The recombinant plasmid according to claim 20, wherein the start sequence is a ColE1 type start sequence, preferably, the start sequence is the start sequence shown in SEQ ID NO.25; The sequence of the T7 promoter is shown in SEQ ID NO.26; wherein the 5'-UTR comprises a 5'-UTR derived from HSD17B4 or a homologue, fragment or variant thereof, preferably, the 5'-UTR comprises a sequence as shown in SEQ ID NO.27; and / or The 3'-UTR comprises a 3'-UTR derived from ALB or a homologue, fragment or variant thereof. Preferably, the 3'-UTR comprises the sequence shown in SEQ ID NO.

28.

22. The recombinant plasmid according to any one of claims 18 to 21, wherein the recombinant plasmid further comprises polyA, a resistance gene promoter and a resistance gene; Preferably, the length of the polyA is 100-150 nucleotides; the resistance gene promoter is an ampicillin resistance gene promoter; and / or the resistance gene is a kanamycin sulfate resistance gene.

23. An mRNA-carrier particle comprising the mRNA according to any one of claims 7 to 11, and a carrier material encapsulating the mRNA.

24. A method for preventing and / or treating a disease or condition associated with SARS-CoV-2 infection in a subject, comprising administering to the subject an effective amount of the recombinant S protein of any one of claims 1-6, the mRNA of any one of claims 7-11, the composition of any one of claims 12-15, the recombinant plasmid of any one of claims 18-22, or the mRNA-vector particle of claim 23.

25. The method of claim 24, wherein the disease or condition is a disease or condition caused by infection with wild-type SARS-CoV-2 or a SARS-CoV-2 variant, such as the Omicron variant or the Delta variant.

Images