SiRNA and siRNA conjugate targeting CDK4 and medical application of siRNA and siRNA conjugate

Abstract

The invention belongs to the field of biological medicine. The invention relates to siRNA (small interfering Ribonucleic Acid) and siRNA conjugates of targeting CDK4 (Cyclin Derivative

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to siRNA, shRNA and conjugates thereof capable of inhibiting the expression of cyclin-dependent kinase 4 (CDK4), and pharmaceutical compositions containing them, as well as preparation methods and applications thereof. Background Art

[0002] Abnormal cell proliferation caused by dysregulated cell division is one of the hallmark features of tumors. Therefore, identifying and blocking targets related to cell division is an important direction for tumor treatment. The division of eukaryotic cells follows a highly conserved process, namely the cell cycle. Each step of the cell cycle must be carried out in sequence under the control of relevant signal checkpoints. The process from one step of the cell cycle to the next is controlled by cyclin-dependent kinases (CDKs), which are activated when they interact with cyclins. Studies have found that knocking out the CDK4 gene can inhibit tumor cell growth without affecting the growth of normal cells. Therefore, based on these characteristics, CDK4 has become a target with great clinical potential and safety for tumor treatment.

[0003] Currently, a variety of CDK4 small molecule inhibitors are used clinically, such as palbociclib, ribociclib and abemaciclib. Although CDK4 inhibitors have greatly improved disease control in patients with HR-positive breast cancer, not all patients respond to these drugs. Moreover, most cancer patients will develop acquired drug resistance after using CDK4 small molecule inhibitors, and there are still certain adverse reactions, including neutropenia, thrombocytopenia, diarrhea, liver and kidney damage, venous thrombosis, etc.

[0004] Elbashir et al. found in 2001 that siRNA can specifically bind to target mRNA with complementary sequence and degrade it; at the same time, the study found that in vitro chemically synthesized siRNA also works after entering cells, degrading target mRNA and effectively reducing the immune response caused by long-chain RNA. Currently, five siRNAs have been approved for market access in Europe and the United States, which fully demonstrates the feasibility of this treatment method. Therefore, siRNA is designed for CDK4, which is overly expressed in cancer, to specifically reduce the expression of its mRNA, thereby restoring the normal regulation of the tumor cell cycle, blocking the DNA synthesis and proliferation of tumor cells, and achieving the effect of tumor treatment. Summary of the invention

[0005] The present invention provides siRNA, shRNA and conjugates thereof and salts thereof, and pharmaceutical compositions thereof, which can specifically inhibit the expression of cyclin-dependent kinase 4 (CDK4). They can specifically target tumor cells, thereby achieving tissue-specific delivery thereof and achieving tumor treatment.

[0006] In one aspect, the present invention provides an siRNA or a salt thereof, wherein the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II, wherein the nucleotide sequence I and the nucleotide sequence II are at least partially reversely complementary to each other to form a double-stranded region, and the nucleotide sequence I and the nucleotide sequence II are selected from the group consisting of the sequences shown in (1) to (60) below:

[0007] (1) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 2, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 22:

[0008] GAUGAAGGUAAUCCGGAGUGA(SEQ ID NO:2)

[0009] UCACUCCGGAUUACCUUCAUC(SEQ ID NO:22);

[0010] (2) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 3, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 23:

[0011] GAUGACUGGCCUCGAGAUGUA(SEQ ID NO:3)

[0012] UACAUCUCGAGGCCAGUCAUC(SEQ ID NO:23);

[0013] (3) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 4, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 24:

[0014] GGACACUGAGAGGGCAAUCUU(SEQ ID NO:4)

[0015] AAGAUUGCCCUCUCAGUGUCC (SEQ ID NO: 24);

[0016] (4) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 5, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 25:

[0017] GGAUCUGAUGCGCCAGUUUCU(SEQ ID NO:5)

[0018] AGAAACUGGCGCAUCAGAUCC (SEQ ID NO:25);

[0019] (5) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 6, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 26:

[0020] GUCCCUUUCCCUACCUUUAUA(SEQ ID NO:6)

[0021] UAUAAAGGUAGGGAAAGGGAC (SEQ ID NO: 26);

[0022] (6) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 7, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 27:

[0023] GGCUGAAAUUGGUGUCGGUGC(SEQ ID NO:7)

[0024] GCACCGACACCAAUUUCAGCC(SEQ ID NO:27);

[0025] (7) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 28:

[0026] GUGGAAACUCUGAAGCCGACC(SEQ ID NO:8)

[0027] GGUCGGCUUCAGAGUUUCCAC(SEQ ID NO:28);

[0028] (8) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 29:

[0029] GUCUGUGCCACAUCCCGAACU(SEQ ID NO:9)

[0030] AGUUCGGGAUGUGGCACAGAC (SEQ ID NO: 29);

[0031] (9) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30:

[0032] GGCUUUGCCAUUGUGCGAUUU(SEQ ID NO:10)

[0033] AAAUCGCACAAUGGCAAAGCC(SEQ ID NO:30);

[0034] (10) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31:

[0035] GCCUAUAAUCCCAGCACGUUG(SEQ ID NO:11)

[0036] CAACGUGCUGGGAUUAUAGGC (SEQ ID NO:31);

[0037] (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12:

[0038] UGGCUUUGCCAUUGUGCGAUU(SEQ ID NO:12)

[0039] AAUCGCACAAUGGCAAAGCCA (SEQ ID NO: 32);

[0040] (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33:

[0041] AUGGCACUUACACCCGUGGUU(SEQ ID NO:13)

[0042] AACCACGGGUGUAAAGUGCCAU(SEQ ID NO:33);

[0043] (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 34:

[0044] UCCCAUCAGCACAGUUCGUGA(SEQ ID NO:14)

[0045] UCACGAACUGUGCUGAUGGGA (SEQ ID NO:34);

[0046] (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 35:

[0047] CUGAGAAUGGCUACCUCGA(SEQ ID NO:15)

[0048] UCGAGAGGUAGCCAUUCUCAG (SEQ ID NO:35);

[0049] (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 36:

[0050] GAGAAUGGCUACCUCUCGAUA(SEQ ID NO:16)

[0051] UAUCGAGAGGUAGCCAUUCUC(SEQ ID NO:36);

[0052] (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37:

[0053] GAGCAAGACUCUGUGUCAAAA(SEQ ID NO:17)

[0054] UUUUGACACAGAGUCUUGCUC(SEQ ID NO:37);

[0055] (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38:

[0056] CAGGAAAAACAAAACAAAGAA(SEQ ID NO:18)

[0057] UUCUUUGUUUUGUUUUUCCUG(SEQ ID NO:38);

[0058] (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39:

[0059] ACAGGAAAAACAAAACAAAGA(SEQ ID NO:19)

[0060] UCUUUGUUUUGUUUUUCCUGU(SEQ ID NO:39);

[0061] (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40:

[0062] CACUUACACCCGUGGUUGUUA(SEQ ID NO:20)

[0063] UAACAACCACGGGUAGUAAGUG(SEQ ID NO:40);

[0064] (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 41:

[0065] GUCCUUUUUUAUACAGGAAAA(SEQ ID NO:21)

[0066] UUUUCCUGUAUAAAAAAGGAC(SEQ ID NO:41);

[0067] (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 82:

[0068] GCGGCCUGUGUCUAUGGUC(SEQ ID NO:42)

[0069] GACCAUAGACACAGGCCGCdTdT (SEQ ID NO:82);

[0070] (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 83:

[0071] GGACCGAGCUCGGGUGUAU(SEQ ID NO:43)

[0072] AUACACCCGAGCUCGGUCCdTdT (SEQ ID NO:83);

[0073] (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 84:

[0074] UCGGGUGUAUGGGGCCGUA(SEQ ID NO:44)

[0075] UACGGCCCCAUACACCCGAdTdT (SEQ ID NO:84);

[0076] (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 85:

[0077] GGUGUAUGGGGCCGUAGGA(SEQ ID NO:45)

[0078] UCCUACGGCCCCAUACACCdTdT (SEQ ID NO:85);

[0079] (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 86:

[0080] GCGUGAGGGUCUCCCUUGA(SEQ ID NO:46)

[0081] UCAAGGGAGACCCUCACGCdTdT(SEQ ID NO:86)

[0082] (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 87:

[0083] UGAGGGUCUCCCUUGAUCU(SEQ ID NO:47)

[0084] AGAUCAAGGGAGACCCUCAdTdT (SEQ ID NO:87);

[0085] (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 48, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 88:

[0086] GUCUCCCUUGAUCUGAGAA(SEQ ID NO:48)

[0087] UUCUCAGAUCAAGGGAGACdTdT (SEQ ID NO:88);

[0088] (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 49, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 89:

[0089] GGCUACCUCUCGAUAUGAG(SEQ ID NO:49)

[0090] CUCAUAUCGAGAGGUAGCCdTdT (SEQ ID NO:89);

[0091] (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 50, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 90:

[0092] UGAGCCAGUGGCUGAAAUU(SEQ ID NO:50)

[0093] AAUUUCAGCCACUGGCUCAdTdT (SEQ ID NO:90);

[0094] (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 51, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 91:

[0095] GCCAGUGGCUGAAAUUGGU(SEQ ID NO:51)

[0096] ACCAAUUUCAGCCACUGGCdTdT (SEQ ID NO:91);

[0097] (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 52, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 92:

[0098] CGGUGCCUAUGGGACAGUG(SEQ ID NO:52)

[0099] CACUGUCCCAUAGGCACCGdTdT(SEQ ID NO:92);

[0100] (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 53, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 93:

[0101] AGUGUACAAGGCCCGUGAU(SEQ ID NO:53)

[0102] AUCACGGGCCUUGUACACUdTdT (SEQ ID NO:93);

[0103] (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 54, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 94:

[0104] GCCACUUUGUGGCCCUCAA(SEQ ID NO:54)

[0105] UUGAGGGCCACAAAGUGGCdTdT (SEQ ID NO:94);

[0106] (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 55, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 95:

[0107] GGCCCUCAAGAGUGUGAGA(SEQ ID NO:55)

[0108] UCUCACACUCUUGAGGGCCdTdT (SEQ ID NO:95);

[0109] (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 56, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 96:

[0110] GAGUGUGAGAGUCCCCAAU(SEQ ID NO:56)

[0111] AUUGGGGACUUCACACUCdTdT (SEQ ID NO:96);

[0112] (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 57, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 97:

[0113] GUCCCCAAUGGAGGAGGAG(SEQ ID NO:57)

[0114] CUCCUCCUCCAUUGGGGACdTdT (SEQ ID NO:97);

[0115] (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 58, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 98:

[0116] GCCUUCCCAUCAGCACAGU(SEQ ID NO:58)

[0117] ACUGUGCUGAUGGGAAGGCdTdT (SEQ ID NO:98);

[0118] (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 59, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 99:

[0119] UCCCAUCAGCACAGUUCGU(SEQ ID NO:59)

[0120] ACGAACUGUGCUGAUGGGAdTdT(SEQ ID NO:99);

[0121] (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 60, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 100:

[0122] CGUGAGGUGGCUUUACUGA(SEQ ID NO:60)

[0123] UCAGUAAAGCCACCUCACGdTdT(SEQ ID NO:100);

[0124] (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 61, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 101:

[0125] UGGCUUUACUGAGGCGACU(SEQ ID NO:61)

[0126] AGUCGCCUCAGUAAAGCCAdTdT (SEQ ID NO: 101);

[0127] (41) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 62, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 102:

[0128] GGCUUUACUGAGGCGACUG(SEQ ID NO:62)

[0129] CAGUCCGCCUCAGUAAAGCCdTdT (SEQ ID NO: 102);

[0130] (42) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 63, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 103:

[0131] GCGACUGGAGGCUUUUGAG(SEQ ID NO:63)

[0132] CUCAAAAGCCUCCAGUCGCdTdT (SEQ ID NO: 103);

[0133] (43) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 64, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 104:

[0134] ACUGGAGGCUUUUGAGCAU(SEQ ID NO:64)

[0135] AUGCUCAAAAGCCUCCAGUdTdT (SEQ ID NO: 104);

[0136] (44) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 105:

[0137] GGCUUUUGAGCAUCCCAAU(SEQ ID NO:65)

[0138] AUUGGGAUGCUCAAAAGCCdTdT (SEQ ID NO: 105);

[0139] (45) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 106:

[0140] CCAAUGUUGUCCGGCUGAU(SEQ ID NO:66)

[0141] AUCAGCCGGACAACAUUGGdTdT (SEQ ID NO: 106);

[0142] (46) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 107:

[0143] GUCCGGCUGAUGGACGUCU(SEQ ID NO:67)

[0144] AGACGUCCAUCAGCCGGACdTdT (SEQ ID NO: 107);

[0145] (47) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 108:

[0146] ACCCUGGUGUUUGAGCAUG(SEQ ID NO:68)

[0147] CAUGCUCAAACACCAGGGUdTdT(SEQ ID NO:108);

[0148] (48) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 69, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 109:

[0149] CCUGGUGUUUGAGCAUGUA(SEQ ID NO:69)

[0150] UACAUGCUCAAACCAGGdTdT(SEQ ID NO:109);

[0151] (49) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 70, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 110:

[0152] CCAGGCUUGCCAGCCGAAA(SEQ ID NO:70)

[0153] UUUCGGCUGGCAAGCCUGGdTdT (SEQ ID NO: 110);

[0154] (50) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 71, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 111:

[0155] GGCUUGCCAGCCGAAACGA(SEQ ID NO:71)

[0156] UCGUUUCGGCUGGCAAGCCdTdT (SEQ ID NO: 111);

[0157] (51) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 72, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 112:

[0158] CGAAACGAUCAAGGAUCUG(SEQ ID NO:72)

[0159] CAGAUCCUUGAUCGUUUCGdTdT (SEQ ID NO: 112);

[0160] (52) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 73, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 113:

[0161] CCAGUUUCUAAGAGGCCUA(SEQ ID NO:73)

[0162] UAGGCCUCUUAGAAACUGGdTdT (SEQ ID NO: 113);

[0163] (53) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 74, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 114:

[0164] GCAUCGUUCACCGAGAUCU(SEQ ID NO:74)

[0165] AGAUCUCGGUGAACGAUGCdTdT (SEQ ID NO: 114);

[0166] (54) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 75, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 115:

[0167] UCGUUCACCGAGAUCUGAA(SEQ ID NO:75)

[0168] UUCAGAUCUCGGUGAACGAdTdT(SEQ ID NO:115);

[0169] (55) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 76, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 116:

[0170] CCGAGAUCUGAAGCCAGAG(SEQ ID NO:76)

[0171] CUCUGGCUUCAGAUCUCGGdTdT (SEQ ID NO: 116);

[0172] (56) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 77, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 117:

[0173] CGAGAUCUGAAGCCAGAGA(SEQ ID NO:77)

[0174] UCUCUGGCUUCAGAUCUCGdTdT (SEQ ID NO: 117);

[0175] (57) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 78, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 118:

[0176] UCUGAAGCCAGAGAACAUU(SEQ ID NO:78)

[0177] AAUGUUCUCUGGCUUCAGAdTdT (SEQ ID NO: 118);

[0178] (58) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 79, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 119:

[0179] GAAGCCAGAGAACAUUCUG(SEQ ID NO:79)

[0180] CAGAAUGUUCUCUGGCUUCdTdT (SEQ ID NO: 119);

[0181] (59) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 80, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 120:

[0182] GAACAUUCUGGUGACAAGU(SEQ ID NO:80)

[0183] ACUUGUCACCAGAAUGUUCdTdT(SEQ ID NO:120);

[0184] (60) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 81, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 121:

[0185] GUCAAGCUGGCUGACUUUG(SEQ ID NO:81)

[0186] CAAAGUCAGCCAGCUUGACdTdT (SEQ ID NO: 121).

[0187] In some embodiments, the siRNA is selected from the following double-stranded siRNAs:

[0188]

[0189]

[0190] In another aspect, the present invention provides an shRNA or a salt thereof, wherein the shRNA comprises a sense strand, an antisense strand, and a neck loop sequence separating the sense strand and the antisense strand, wherein each nucleotide in the shRNA is independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II, wherein the nucleotide sequence I and the nucleotide sequence II are at least partially reversely complementary to each other to form a double-stranded region, and the nucleotide sequence I and the nucleotide sequence II are selected from the group consisting of the sequences shown in (1) to (60) below:

[0191] (1) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 2, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 22:

[0192] GAUGAAGGUAAUCCGGAGUGA(SEQ ID NO:2)

[0193] UCACUCCGGAUUACCUUCAUC(SEQ ID NO:22);

[0194] (2) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 3, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 23:

[0195] GAUGACUGGCCUCGAGAUGUA(SEQ ID NO:3)

[0196] UACAUCUCGAGGCCAGUCAUC(SEQ ID NO:23);

[0197] (3) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 4, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 24:

[0198] GGACACUGAGAGGGCAAUCUU(SEQ ID NO:4)

[0199] AAGAUUGCCCUCUCAGUGUCC (SEQ ID NO: 24);

[0200] (4) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 5, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 25:

[0201] GGAUCUGAUGCGCCAGUUUCU(SEQ ID NO:5)

[0202] AGAAACUGGCGCAUCAGAUCC (SEQ ID NO:25);

[0203] (5) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 6, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 26:

[0204] GUCCCUUUCCCUACCUUUAUA(SEQ ID NO:6)

[0205] UAUAAAGGUAGGGAAAGGGAC (SEQ ID NO: 26);

[0206] (6) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 7, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 27:

[0207] GGCUGAAAUUGGUGUCGGUGC(SEQ ID NO:7)

[0208] GCACCGACACCAAUUUCAGCC(SEQ ID NO:27);

[0209] (7) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 28:

[0210] GUGGAAACUCUGAAGCCGACC(SEQ ID NO:8)

[0211] GGUCGGCUUCAGAGUUUCCAC(SEQ ID NO:28);

[0212] (8) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 29:

[0213] GUCUGUGCCACAUCCCGAACU(SEQ ID NO:9)

[0214] AGUUCGGGAUGUGGCACAGAC (SEQ ID NO: 29);

[0215] (9) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30:

[0216] GGCUUUGCCAUUGUGCGAUUU(SEQ ID NO:10)

[0217] AAAUCGCACAAUGGCAAAGCC(SEQ ID NO:30);

[0218] (10) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31:

[0219] GCCUAUAAUCCCAGCACGUUG(SEQ ID NO:11)

[0220] CAACGUGCUGGGAUUAUAGGC (SEQ ID NO:31);

[0221] (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12:

[0222] UGGCUUUGCCAUUGUGCGAUU(SEQ ID NO:12)

[0223] AAUCGCACAAUGGCAAAGCCA (SEQ ID NO: 32);

[0224] (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33:

[0225] AUGGCACUUACACCCGUGGUU(SEQ ID NO:13)

[0226] AACCACGGGUGUAAAGUGCCAU(SEQ ID NO:33);

[0227] (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 34:

[0228] UCCCAUCAGCACAGUUCGUGA(SEQ ID NO:14)

[0229] UCACGAACUGUGCUGAUGGGA (SEQ ID NO:34);

[0230] (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 35:

[0231] CUGAGAAUGGCUACCUCGA(SEQ ID NO:15)

[0232] UCGAGAGGUAGCCAUUCUCAG (SEQ ID NO:35);

[0233] (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 36:

[0234] GAGAAUGGCUACCUCUCGAUA(SEQ ID NO:16)

[0235] UAUCGAGAGGUAGCCAUUCUC(SEQ ID NO:36);

[0236] (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37:

[0237] GAGCAAGACUCUGUGUCAAAA(SEQ ID NO:17)

[0238] UUUUGACACAGAGUCUUGCUC(SEQ ID NO:37);

[0239] (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38:

[0240] CAGGAAAAACAAAACAAAGAA(SEQ ID NO:18)

[0241] UUCUUUGUUUUGUUUUUCCUG(SEQ ID NO:38);

[0242] (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39:

[0243] ACAGGAAAAACAAAACAAAGA(SEQ ID NO:19)

[0244] UCUUUGUUUUGUUUUUCCUGU(SEQ ID NO:39);

[0245] (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40:

[0246] CACUUACACCCGUGGUUGUUA(SEQ ID NO:20)

[0247] UAACAACCACGGGUAGUAAGUG(SEQ ID NO:40);

[0248] (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 41:

[0249] GUCCUUUUUUAUACAGGAAAA(SEQ ID NO:21)

[0250] UUUUCCUGUAUAAAAAAGGAC(SEQ ID NO:41);

[0251] (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 82:

[0252] GCGGCCUGUGUCUAUGGUC(SEQ ID NO:42)

[0253] GACCAUAGACACAGGCCGCdTdT (SEQ ID NO:82);

[0254] (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 83:

[0255] GGACCGAGCUCGGGUGUAU(SEQ ID NO:43)

[0256] AUACACCCGAGCUCGGUCCdTdT (SEQ ID NO:83);

[0257] (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 84:

[0258] UCGGGUGUAUGGGGCCGUA(SEQ ID NO:44)

[0259] UACGGCCCCAUACACCCGAdTdT (SEQ ID NO:84);

[0260] (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 85:

[0261] GGUGUAUGGGGCCGUAGGA(SEQ ID NO:45)

[0262] UCCUACGGCCCCAUACACCdTdT (SEQ ID NO:85);

[0263] (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 86:

[0264] GCGUGAGGGUCUCCCUUGA(SEQ ID NO:46)

[0265] UCAAGGGAGACCCUCACGCdTdT(SEQ ID NO:86)

[0266] (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 87:

[0267] UGAGGGUCUCCCUUGAUCU(SEQ ID NO:47)

[0268] AGAUCAAGGGAGACCCUCAdTdT (SEQ ID NO:87);

[0269] (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 48, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 88:

[0270] GUCUCCCUUGAUCUGAGAA(SEQ ID NO:48)

[0271] UUCUCAGAUCAAGGGAGACdTdT (SEQ ID NO:88);

[0272] (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 49, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 89:

[0273] GGCUACCUCUCGAUAUGAG(SEQ ID NO:49)

[0274] CUCAUAUCGAGAGGUAGCCdTdT (SEQ ID NO:89);

[0275] (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 50, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 90:

[0276] UGAGCCAGUGGCUGAAAUU(SEQ ID NO:50)

[0277] AAUUUCAGCCACUGGCUCAdTdT (SEQ ID NO:90);

[0278] (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 51, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 91:

[0279] GCCAGUGGCUGAAAUUGGU(SEQ ID NO:51)

[0280] ACCAAUUUCAGCCACUGGCdTdT (SEQ ID NO:91);

[0281] (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 52, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 92:

[0282] CGGUGCCUAUGGGACAGUG(SEQ ID NO:52)

[0283] CACUGUCCCAUAGGCACCGdTdT(SEQ ID NO:92);

[0284] (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 53, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 93:

[0285] AGUGUACAAGGCCCGUGAU(SEQ ID NO:53)

[0286] AUCACGGGCCUUGUACACUdTdT (SEQ ID NO:93);

[0287] (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 54, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 94:

[0288] GCCACUUUGUGGCCCUCAA(SEQ ID NO:54)

[0289] UUGAGGGCCACAAAGUGGCdTdT (SEQ ID NO:94);

[0290] (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 55, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 95:

[0291] GGCCCUCAAGAGUGUGAGA(SEQ ID NO:55)

[0292] UCUCACACUCUUGAGGGCCdTdT (SEQ ID NO:95);

[0293] (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 56, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 96:

[0294] GAGUGUGAGAGUCCCCAAU(SEQ ID NO:56)

[0295] AUUGGGGACUUCACACUCdTdT (SEQ ID NO:96);

[0296] (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 57, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 97:

[0297] GUCCCCAAUGGAGGAGGAG(SEQ ID NO:57)

[0298] CUCCUCCUCCAUUGGGGACdTdT (SEQ ID NO:97);

[0299] (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 58, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 98:

[0300] GCCUUCCCAUCAGCACAGU(SEQ ID NO:58)

[0301] ACUGUGCUGAUGGGAAGGCdTdT (SEQ ID NO:98);

[0302] (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 59, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 99:

[0303] UCCCAUCAGCACAGUUCGU(SEQ ID NO:59)

[0304] ACGAACUGUGCUGAUGGGAdTdT(SEQ ID NO:99);

[0305] (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 60, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 100:

[0306] CGUGAGGUGGCUUUACUGA(SEQ ID NO:60)

[0307] UCAGUAAAGCCACCUCACGdTdT(SEQ ID NO:100);

[0308] (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 61, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 101:

[0309] UGGCUUUACUGAGGCGACU(SEQ ID NO:61)

[0310] AGUCGCCUCAGUAAAGCCAdTdT (SEQ ID NO: 101);

[0311] (41) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 62, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 102:

[0312] GGCUUUACUGAGGCGACUG(SEQ ID NO:62)

[0313] CAGUCCGCCUCAGUAAAGCCdTdT (SEQ ID NO: 102);

[0314] (42) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 63, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 103:

[0315] GCGACUGGAGGCUUUUGAG(SEQ ID NO:63)

[0316] CUCAAAAGCCUCCAGUCGCdTdT (SEQ ID NO: 103);

[0317] (43) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 64, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 104:

[0318] ACUGGAGGCUUUUGAGCAU(SEQ ID NO:64)

[0319] AUGCUCAAAAGCCUCCAGUdTdT (SEQ ID NO: 104);

[0320] (44) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 105:

[0321] GGCUUUUGAGCAUCCCAAU(SEQ ID NO:65)

[0322] AUUGGGAUGCUCAAAAGCCdTdT (SEQ ID NO: 105);

[0323] (45) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 106:

[0324] CCAAUGUUGUCCGGCUGAU(SEQ ID NO:66)

[0325] AUCAGCCGGACAACAUUGGdTdT (SEQ ID NO: 106);

[0326] (46) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 107:

[0327] GUCCGGCUGAUGGACGUCU(SEQ ID NO:67)

[0328] AGACGUCCAUCAGCCGGACdTdT (SEQ ID NO: 107);

[0329] (47) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 108:

[0330] ACCCUGGUGUUUGAGCAUG(SEQ ID NO:68)

[0331] CAUGCUCAAACACCAGGGUdTdT(SEQ ID NO:108);

[0332] (48) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 69, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 109:

[0333] CCUGGUGUUUGAGCAUGUA(SEQ ID NO:69)

[0334] UACAUGCUCAAACCAGGdTdT(SEQ ID NO:109);

[0335] (49) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 70, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 110:

[0336] CCAGGCUUGCCAGCCGAAA(SEQ ID NO:70)

[0337] UUUCGGCUGGCAAGCCUGGdTdT (SEQ ID NO: 110);

[0338] (50) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 71, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 111:

[0339] GGCUUGCCAGCCGAAACGA(SEQ ID NO:71)

[0340] UCGUUUCGGCUGGCAAGCCdTdT (SEQ ID NO: 111);

[0341] (51) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 72, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 112:

[0342] CGAAACGAUCAAGGAUCUG(SEQ ID NO:72)

[0343] CAGAUCCUUGAUCGUUUCGdTdT (SEQ ID NO: 112);

[0344] (52) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 73, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 113:

[0345] CCAGUUUCUAAGAGGCCUA(SEQ ID NO:73)

[0346] UAGGCCUCUUAGAAACUGGdTdT (SEQ ID NO: 113);

[0347] (53) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 74, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 114:

[0348] GCAUCGUUCACCGAGAUCU(SEQ ID NO:74)

[0349] AGAUCUCGGUGAACGAUGCdTdT (SEQ ID NO: 114);

[0350] (54) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 75, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 115:

[0351] UCGUUCACCGAGAUCUGAA(SEQ ID NO:75)

[0352] UUCAGAUCUCGGUGAACGAdTdT(SEQ ID NO:115);

[0353] (55) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 76, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 116:

[0354] CCGAGAUCUGAAGCCAGAG(SEQ ID NO:76)

[0355] CUCUGGCUUCAGAUCUCGGdTdT (SEQ ID NO: 116);

[0356] (56) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 77, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 117:

[0357] CGAGAUCUGAAGCCAGAGA(SEQ ID NO:77)

[0358] UCUCUGGCUUCAGAUCUCGdTdT (SEQ ID NO: 117);

[0359] (57) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 78, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 118:

[0360] UCUGAAGCCAGAGAACAUU(SEQ ID NO:78)

[0361] AAUGUUCUCUGGCUUCAGAdTdT (SEQ ID NO: 118);

[0362] (58) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 79, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 119:

[0363] GAAGCCAGAGAACAUUCUG(SEQ ID NO:79)

[0364] CAGAAUGUUCUCUGGCUUCdTdT (SEQ ID NO: 119);

[0365] (59) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 80, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 120:

[0366] GAACAUUCUGGUGACAAGU(SEQ ID NO:80)

[0367] ACUUGUCACCAGAAUGUUCdTdT(SEQ ID NO:120);

[0368] (60) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 81, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 121:

[0369] GUCAAGCUGGCUGACUUUG(SEQ ID NO:81)

[0370] CAAAGUCAGCCAGCUUGACdTdT (SEQ ID NO: 121).

[0371] In some embodiments, in the siRNA or shRNA of the present invention, each nucleotide is independently a modified or unmodified nucleotide. In some embodiments, the siRNA or shRNA of the present invention may contain at least one modified nucleotide and / or at least one interstrand modification.

[0372] In some embodiments, all nucleotides on the sense strand are modified nucleotides.

[0373] In some embodiments, all nucleotides on the antisense strand are modified nucleotides.

[0374] In some embodiments, substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides.

[0375] In some embodiments, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.

[0376] The modified nucleotides include, but are not limited to, 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP and other modified nucleotides.

[0377] 2'-F, 2'-OME, and 2'-MOE modifications refer to the replacement of the hydroxyl group at the 2' position of the furanose ring of the nucleotide with fluorine (F), methoxy (OMe), or methoxyethoxy (MOE), respectively.

[0378] GNA modification refers to glycerol nucleotides, which are composed of glycerol (a five-carbon sugar in DNA and RNA) linked by phosphate bonds.

[0379] UNA modification refers to open-ring nucleotides. UNA lacks the C2' and C3' chemical bonds of the RNA ribose ring, but can still mimic unmodified RNA when bound to the RNA double-stranded structure.

[0380] PNA modification refers to peptide nucleic acid, a class of DNA analogs that replace the sugar-phosphate backbone with a polypeptide backbone.

[0381] 5'-VP modification refers to the modification of the 5' end of the siRNA by vinyl-phosphodiesterase.

[0382] The interchain modifications include, but are not limited to, phosphorothioate, -OEt, -OME and other modifications. Phosphorothioate modification refers to the replacement of the hydroxyl group on the phosphate backbone by a thiol group, -OEt modification refers to the replacement of the hydrogen of the hydroxyl group on the phosphate backbone by an ethyl group, and -OME modification refers to the replacement of the hydrogen of the hydroxyl group on the phosphate backbone by a methyl group.

[0383] In another aspect, the present invention provides a method for preparing the above shRNA or siRNA.

[0384] The shRNA or siRNA of the present invention can be chemically synthesized or prepared by transcribing an expression cassette in a recombinant nucleic acid structure into a single-stranded RNA. Nucleic acid inhibitors such as siRNA or shRNA (or constructs or expression vectors containing shRNA) can be delivered into cells by using appropriate transfection reagents, or can also be delivered into cells using a variety of techniques known in the art.

[0385] In yet another aspect, the present invention provides a conjugate, comprising: the siRNA or shRNA or a salt thereof according to the present invention; and a conjugation group conjugated to the siRNA or shRNA.

[0386] In some embodiments, the conjugate group comprises a pharmaceutically acceptable targeting group and a linker, and the siRNA, the linker and the targeting group are sequentially covalently or non-covalently linked.

[0387] In some embodiments, the conjugate group may be derived from a tissue-specific targeting molecule. The conjugate may be a conjugate formed by chemically coupling a tissue-specific targeting molecule with a nucleic acid inhibitor. The targeting molecules that can target different cell surface molecules include, but are not limited to, specifically targeted antibodies, antibody fragments, polypeptides, ligands, inhibitors, and the like.

[0388] In yet another aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned siRNA and / or shRNA and / or salts thereof, and optionally a pharmaceutically acceptable carrier.

[0389] As used herein, "pharmaceutically acceptable carriers" refer to carriers for administering therapeutic agents, including various excipients and diluents. In the composition, pharmaceutically acceptable carriers may contain liquids, such as water, saline, buffers, etc. In addition, auxiliary substances may also be present in these carriers, such as fillers, lubricants, glidants, wetting agents and emulsifiers, pH buffer substances, etc. The carriers may also contain cell transfection reagents.

[0390] In some embodiments, the pharmaceutical composition of the present invention can be administered in various forms, including but not limited to intravenous administration, subcutaneous injection, intramuscular injection, transdermal administration, topical administration, implantation, sustained-release administration, and the like.

[0391] In the present invention, the salt of the product, for example, the above-mentioned siRNA, shRNA, for example, can be an alkali metal salt, such as a potassium salt, a sodium salt or a lithium salt, or can be an ammonium salt. In particular, the salt is a sodium salt.

[0392] In another aspect, the present invention provides a method for treating a subject who would benefit from reduced expression of cyclin-dependent kinase 4 (CDK4), the method comprising administering to the subject a therapeutically effective amount of the siRNA and / or shRNA and / or pharmaceutical composition of the present invention.

[0393] In some embodiments, the method comprises administering to the subject a fixed dose of about 50 mg to 800 mg of the active substance of the siRNA and / or shRNA and / or pharmaceutical composition.

[0394] In another aspect, the present invention provides use of the above siRNA or shRNA or a salt or pharmaceutical composition thereof in the preparation of a drug capable of inhibiting the expression of cyclin-dependent kinase 4 (CDK4) gene.

[0395] In another aspect, the present invention provides use of the above siRNA or shRNA or a salt or pharmaceutical composition thereof in the preparation of a medicament for preventing or treating a disease or disorder related to cyclin-dependent kinase 4 (CDK4).

[0396] In the present invention, the cyclin-dependent kinase 4 (CDK4)-related diseases or conditions are diseases or conditions caused by or associated with high expression of CDK4. The term "CDK4-related disease" includes diseases or conditions that benefit from reduced CDK4 gene expression or replication. Non-limiting examples of CDK4-related diseases include tumors. So-called tumors include solid tumors and malignant hematological tumors. Solid tumors include, but are not limited to, head and neck cancer, lung cancer, mesothelioma, septal tumors, esophageal cancer, gastric cancer, pancreatic cancer, bile duct cancer, small intestine cancer, colon cancer, colorectal cancer, rectal cancer, anal cancer, kidney cancer, urinary tract cancer, bladder cancer, prostate cancer, penis cancer, testicular cancer, ovarian cancer, breast cancer, endocrine system tumors, skin cancer, central nervous system tumors, soft tissue and osteosarcoma, skin and eye endogenous melanoma, etc. Malignant hematological tumors include, but are not limited to, childhood leukemia and lymphoma, Hodgkin's disease, lymphocytes and skin-derived lymphomas, acute and chronic leukemias, plasma cell tumors, AIDS-related cancers, etc.

[0397] In another aspect, the present invention provides a method for inhibiting the expression of cyclin-dependent kinase 4 (CDK4) gene in a cell, the method comprising contacting the cell with an effective amount of siRNA, shRNA, salts thereof and / or pharmaceutical composition of the present invention, thereby inhibiting the expression of CDK4 gene in the cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0398] Figure 1 and Figure 2 The results of the dual-concentration inhibitory activity of siRNA in Example 2 on human CDK4 in a human breast cancer cell line (MCF7) are shown.

[0399] Figure 3 The results of the inhibitory activity of siRNA in Example 3 on human CDK4 at multiple concentration points in MCF7 cells are shown.

[0400] Figures 4 to 5 The concentration inhibitory activity of siRNA in Example 3 on human CDK4 in MCF7 cells is shown.

[0401] Figure 6 to Figure 7The concentration inhibitory activity of siRNA in Example 4 on human CDK4 in MCF7 cells is shown. DETAILED DESCRIPTION

[0402] Hereinafter, the specific embodiments of the present invention will be described in detail. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0403] In the present invention, cyclin-dependent kinase 4 (CDK4) mRNA refers to mRNA having a sequence shown in Genbank registration number NM_000075.4. Further, unless otherwise specified, the term "target gene" used in the present invention refers to a gene that transcribes the above CDK4 mRNA, and the term "target mRNA" refers to the above CDK4 mRNA. In some embodiments, the nucleotide sequence of the CDK4 gene is shown in SEQ ID NO: 1.

[0404] definition

[0405] The term "linked" as used herein, when referring to the connection between two molecules, means that the two molecules are connected by a covalent bond or the two molecules are associated via a non-covalent bond (eg, a hydrogen bond or an ionic bond).

[0406] As used herein, the term "inhibit", when referring to the expression of a given gene, means that gene expression is reduced when the cell, cell population or tissue is treated with the siRNA, shRNA, conjugate and pharmaceutical composition of the present invention, compared to cells, cell populations or tissues that have not been so treated.

[0407] The term "inhibit" in the present invention is used interchangeably with "reduce", "silence", "downregulate" and other similar terms, and includes any level of inhibition. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.

[0408] As used herein, the phrase "inhibiting the expression of CDK4" or "inhibiting the expression of a CDK4 gene" includes inhibiting the expression of any CDK4 gene (e.g., a CDK4 gene expressed by an expression construct in a cell) as well as variants or mutants of a CDK4 gene encoding a CDK4 protein.

[0409] Each nucleotide in the sense strand and the antisense strand is independently a modified or unmodified nucleotide.

[0410] In the context of the present invention, the expressions "complementary" or "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one chain are each paired with the bases on the other chain in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always paired with the pyrimidine base cytosine (G). Each base pair includes a purine and a pyrimidine. When adenine on one chain is always paired with thymine (or uracil) on the other chain, and guanine is always paired with cytosine, the two chains are considered to be complementary to each other, and the sequence of the chain can be inferred from the sequence of its complementary chain. Correspondingly, "mismatch" means in the art that in a double-stranded nucleic acid, the bases at corresponding positions are not paired in a complementary form.

[0411] In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; "completely reverse complementary" means that there is no base mismatch between the two nucleotide sequences. In the above and below, the existence of "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the base type of the nucleotide at the same position of the former is changed compared with the latter. For example, when a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position of the former is U, C, G or T, it is determined that there is a nucleotide difference at that position between the two nucleotide sequences. In some embodiments, when a nucleotide at the original position is replaced by an abasic nucleotide or its equivalent, it can also be considered that a nucleotide difference has occurred at that position.

[0412] In the above and below, particularly when describing the preparation method of the siRNA of the present invention, the pharmaceutical composition containing siRNA, unless otherwise specified, the nucleoside monomer (nucleoside monomer) refers to the modified or unmodified nucleoside phosphoramidite monomer (unmodified or modified RNA phosphoramidites, sometimes RNA phosphoramidites are also referred to as Nucleoside phosphoramidites) used in the phosphoramidite solid phase synthesis according to the type and order of nucleotides in the siRNA to be prepared. Phosphoramidite solid phase synthesis is a method used in RNA synthesis known to those skilled in the art. The nucleoside monomer used in the present invention can be obtained by commercial purchase.

[0413] As used herein, "optional" or "optionally" means that the event or situation described thereafter may or may not occur, and the description includes instances where the event or situation occurs and instances where it does not occur. For example, "optionally substituted" "alkyl" includes "alkyl" and "substituted alkyl" as defined below. It will be understood by those skilled in the art that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is sterically impractical, synthetically unfeasible, and / or inherently unstable.

[0414] The term "subject", as used herein, refers to any animal, such as a mammal or marsupial. Subjects of the present invention include, but are not limited to, humans, non-human primates (e.g., monkeys and gorillas), mice, rabbits, dogs, cats, pigs, horses, cows, rats, or poultry of any kind.

[0415] As used herein, "treatment" refers to a method for obtaining a beneficial or desired result, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradicating or improving the underlying disorder being treated. In addition, the therapeutic benefit is obtained by eradicating or improving one or more physiological symptoms associated with the underlying disorder, thereby observing improvement in the subject, although the subject may still be afflicted with the underlying disorder. "Improvement" refers to the alleviation of at least one indicator, marker, sign and / or symptom of a related disease, disorder or condition. In certain embodiments, improvement includes delaying or slowing down the progress of one or more indicators of a condition, disorder and / or disease. The severity of the indicator can be determined by subjective or objective metrics known to those skilled in the art.

[0416] The term "cyclin-dependent kinase 4-related diseases and / or conditions" or "CDK4-related diseases" described in the present invention refers to diseases or conditions caused by or related to high expression of CDK4. The term "CDK4-related diseases" includes diseases or conditions that benefit from reduced expression or replication of the CDK4 gene. Non-limiting examples of CDK4-related diseases include tumors. The so-called tumors include solid tumors and malignant hematological tumors. Solid tumors include, but are not limited to, head and neck cancer, lung cancer, mesothelioma, septal tumors, esophageal cancer, gastric cancer, pancreatic cancer, bile duct system cancer, small intestine cancer, colon cancer, colorectal cancer, rectal cancer, anal cancer, kidney cancer, urinary tract cancer, bladder cancer, prostate cancer, penile cancer, testicular cancer, ovarian cancer, breast cancer, endocrine system tumors, skin cancer, central nervous system tumors, soft tissue and bone sarcomas, skin and eye endogenous melanoma, etc. Hematological malignancies include, but are not limited to, childhood leukemia and lymphoma, Hodgkin's disease, lymphocytic and cutaneous lymphomas, acute and chronic leukemias, plasma cell neoplasms, AIDS-related cancers, etc.

[0417] The present invention is further described below in conjunction with examples, but these examples are not intended to limit the scope of the present invention. Experimental methods in the examples of the present invention that do not specify specific conditions are generally carried out under conventional conditions or under conditions recommended by raw material or commodity manufacturers. Reagents that do not specify specific sources can be obtained from any supplier of molecular biology reagents with quality / purity for molecular biology applications.

[0418] Example 1 Sequence Design of Human CDK4 siRNA

[0419] Human (Homo sapiens) CDK4 gene (NM_000075.4, SEQ ID NO: 1) was used as the target gene, and 21 / 21nt siRNA was designed to meet the general rules of active siRNA, or 19 / 19nt siRNA was designed to meet the general rules of active siRNA and two thymine deoxyribonucleic acids were added to the 3' end of the antisense strand. The unmodified sense strand and antisense strand sequences are shown in Tables 1 and 2.

[0420] Table 1. Unmodified sense and antisense strands of human siRNA

[0421]

[0422] Table 2. Unmodified sense and antisense strands of human siRNA

[0423]

[0424]

[0425] Example 2 Inhibition of CDK4 in human breast cancer cell line (MCF7) by siRNA - Inhibitory activity at two concentration points

[0426] The dosage experiment was conducted in the human breast cancer cell line (MCF7) using two concentrations, namely 10 nM and 0.1 nM final duplex concentration. The experimental consumables are shown in Tables 3 and 4.

[0427] 24 h before transfection, MCF7 cells were plated on 96-well plates at approximately 20,000 cells / well, with 100 μL of culture medium per well. During transfection, siRNA was transfected using Lipofectamine RNAi MAX (ThermoFisher, 13778150) according to the product manual, and the final concentration of siRNA transfection was 10 nM and 0.1 nM. After 24 h of treatment, total RNA was extracted from cells using a high-throughput cell RNA extraction kit (QIAGEN, RNeasy 96 Kit) and RNA reverse transcription experiments (Takara PrimeScript TMII 1st Strand cDNA Synthesis Kit (6210A) and quantitative real-time PCR (ThermoFisher TaqMan TM Fast Advanced Master Mix (4444554) was used for detection. For Taqman probe primer information, see Table 3. The mRNA level of human CDK4 was measured and corrected according to the level of the GAPDH internal reference gene.

[0428] After the Taqman probe Q-PCR test is completed, the corresponding Ct value is obtained according to the threshold automatically set by the system. The expression of a gene can be relatively quantified by comparing the Ct values: Comparative Ct refers to calculating the difference in gene expression by the difference between the Ct value of the internal reference gene, also known as 2 -ΔΔCt , ΔΔCt = [(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)]. Inhibition rate (%) = (1 - target gene expression residual amount) * 100%.

[0429] Table 3. Consumables for cell activity screening (nucleic acid extraction instrument) experiment

[0430] name company Part Number / Model Lipofectamine RNAi Max Invitrogen 13778150 High-throughput Cellular RNA Extraction Kit QIAGEN 74181 <![CDATA[PrimeScript TM II 1st Strand cDNA Synthesis Kit]]> Takara 6210B(A×4) <![CDATA[TaqMan TM Fast Advanced Master Mix]]> Thermo 4444964

[0431] Table 4. Taqman probe primer information table

[0432] Primer name SEQ ID NO: Sequence information hCDK4-PF1-MGB 123 CTTGCCAGCCGAAACGAT hCDK4-PR1-MGB 124 GAACGATGCAATTGGCATGA hCDK4-P1-MGB 125 ATGCGCCAGTTTCTAAGA hGAPDH-PF1-MGB 126 GACCCCTTCATTGACCTCAACTAC hGAPDH-PR1-MGB 127 TTGACGGTGCCATGGAATTT hGAPDH-P1-MGB 128 TTACATGTTCCAATATGATTCC

[0433] The results are expressed as the remaining percentage of human CDK4 mRNA expression relative to that of cells treated with control siRNA. The IC 50 The results are shown in Tables 5 and 6. Figure 1 , Figure 2 .

[0434] Table 5 Results of dual concentration inhibition of siRNA on human CDK4 in human breast cancer cell line (MCF7)

[0435]

[0436] Table 6. Results of dual concentration inhibition of human CDK4 by siRNA in human breast cancer cell line (MCF7)

[0437]

[0438] Example 3 Inhibition of CDK4 in human breast cancer cell line (MCF7) by siRNA - Inhibitory activity at multiple concentrations

[0439] A dose response experiment was performed in a human breast cancer cell line (MCF7) using siRNA at 7 concentration gradients.

[0440] 24h before transfection, MCF7 cells were plated on 96-well plates at approximately 20,000 cells / well, with 100 μL of culture medium per well. During transfection, siRNA was transfected using Lipofectamine RNAi MAX (ThermoFisher, 13778150) with reference to the product manual, and the gradient final concentration of siRNA transfection was 10, 2, 0.4, 0.08, 0.016, 0.0032 and 0.00064 nM. After 24 hours of treatment, total cell RNA extraction, RNA reverse transcription experiment and quantitative real-time PCR detection were performed using a high-throughput cell RNA extraction kit to determine the mRNA level of human CDK4, and the mRNA level of human CDK4 was corrected according to the level of the GAPDH internal reference gene.

[0441] The results are expressed as the remaining percentage of human CDK4 mRNA expression relative to cells treated with control siRNA. The IC50 results of inhibition are shown in Tables 7 , 8 and Figure 3 , Figure 4 , Figure 5 The experimental operation is referred to Example 2.

[0442] Table 7. Concentration inhibitory activity of siRNA on human CDK4 in MCF7 cells

[0443]

[0444] Table 8. Concentration inhibitory activity of siRNA on human CDK4 in MCF7 cells

[0445]

[0446] Example 4 Inhibitory activity of siRNA on cell proliferation in human breast cancer cell line (MCF7)

[0447] 24h before transfection, MCF7 cells were plated on a 96-well plate at approximately 4,000 cells / well, with 100 μL of culture medium per well. During transfection, refer to the product manual and use Lipofectamine RNAi MAX (ThermoFisher, 13778150) to transfect siRNA. The final gradient concentrations of siRNA transfection were 1000, 250, 62.5, 15.625, 3.90625, 0.9765625 and 0.244140625 nM. After 72 hours of treatment, the number of viable cells was determined using the CCK-8 cell proliferation detection kit (Biyuntian, C0038). The specific experimental operations were referred to the product manual. The inhibition rate of siRNA compounds on MCF7 cells was obtained by comparing with the control group. The inhibition rate = (blank control group-treated group) / blank control group * 100%. The results are shown in Table 9 and Figure 6 , Figure 7 .

[0448] Table 9 siRNA inhibits the proliferation activity of MCF7 cells

[0449]

[0450]

Claims

1. An siRNA or a salt thereof, wherein the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein: The sense strand contains a nucleotide sequence I, and the antisense strand contains a nucleotide sequence II. The nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to each other to form a double-stranded region. The nucleotide sequence I and the nucleotide sequence II are selected from the group consisting of the sequences shown in (1) to (60): (1) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 2, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 22: GAUGAAGGUAAUCCGGAGUGA(SEQ ID NO:2) UCACUCCGGAUUACCUUCAUC(SEQ ID NO:22); (2) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 3, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 23: GAUGACUGGCCUCGAGAUGUA(SEQ ID NO:3) UACAUCUCGAGGCCAGUCAUC(SEQ ID NO:23); (3) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 4, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 24: GGACACUGAGAGGGCAAUCUU(SEQ ID NO:4) AAGAUUGCCCUCUCAGUGUCC (SEQ ID NO: 24); (4) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 5, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 25: GGAUCUGAUGCGCCAGUUUCU(SEQ ID NO:5) AGAAACUGGCGCAUCAGAUCC (SEQ ID NO:25); (5) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 6, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 26: GUCCCUUUCCCUACCUUUAUA(SEQ ID NO:6) UAUAAAGGUAGGGAAAGGGAC (SEQ ID NO: 26); (6) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 7, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 27: GGCUGAAAUUGGUGUCGGUGC(SEQ ID NO:7) GCACCGACACCAAUUUCAGCC(SEQ ID NO:27); (7) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 28: GUGGAAACUCUGAAGCCGACC(SEQ ID NO:8) GGUCGGCUUCAGAGUUUCCAC(SEQ ID NO:28); (8) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 29: GUCUGUGCCACAUCCCGAACU(SEQ ID NO:9) AGUUCGGGAUGUGGCACAGAC (SEQ ID NO: 29); (9) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30: GGCUUUGCCAUUGUGCGAUUU(SEQ ID NO:10) AAAUCGCACAAUGGCAAAGCC(SEQ ID NO:30); (10) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31: GCCUAUAAUCCCAGCACGUUG(SEQ ID NO:11) CAACGUGCUGGGAUUAUAGGC (SEQ ID NO:31); (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12: UGGCUUUGCCAUUGUGCGAUU(SEQ ID NO:12) AAUCGCACAAUGGCAAAGCCA (SEQ ID NO: 32); (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33: AUGGCACUUACACCCGUGGUU(SEQ ID NO:13) AACCACGGGUGUAAAGUGCCAU(SEQ ID NO:33); (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 34: UCCCAUCAGCACAGUUCGUGA(SEQ ID NO:14) UCACGAACUGUGCUGAUGGGA (SEQ ID NO:34); (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 35: CUGAGAAUGGCUACCUCGA(SEQ ID NO:15) UCGAGAGGUAGCCAUUCUCAG (SEQ ID NO:35); (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 36: GAGAAUGGCUACCUCUCGAUA(SEQ ID NO:16) UAUCGAGAGGUAGCCAUUCUC(SEQ ID NO:36); (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37: GAGCAAGACUCUGUGUCAAAA(SEQ ID NO:17) UUUUGACACAGAGUCUUGCUC(SEQ ID NO:37); (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38: CAGGAAAAACAAAACAAAGAA(SEQ ID NO:18) UUCUUUGUUUUGUUUUUCCUG(SEQ ID NO:38); (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39: ACAGGAAAAACAAAACAAAGA(SEQ ID NO:19) UCUUUGUUUUGUUUUUCCUGU(SEQ ID NO:39); (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40: CACUUACACCCGUGGUUGUUA(SEQ ID NO:20) UAACAACCACGGGUAGUAAGUG(SEQ ID NO:40); (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 41: GUCCUUUUUUAUACAGGAAAA(SEQ ID NO:21) UUUUCCUGUAUAAAAAAGGAC(SEQ ID NO:41); (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 82: GCGGCCUGUGUCUAUGGUC(SEQ ID NO:42) GACCAUAGACACAGGCCGCdTdT (SEQ ID NO:82); (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 83: GGACCGAGCUCGGGUGUAU(SEQ ID NO:43) AUACACCCGAGCUCGGUCCdTdT (SEQ ID NO:83); (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 84: UCGGGUGUAUGGGGCCGUA(SEQ ID NO:44) UACGGCCCCAUACACCCGAdTdT (SEQ ID NO:84); (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 85: GGUGUAUGGGGCCGUAGGA(SEQ ID NO:45) UCCUACGGCCCCAUACACCdTdT (SEQ ID NO:85); (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 86: GCGUGAGGGUCUCCCUUGA(SEQ ID NO:46) UCAAGGGAGACCCUCACGCdTdT(SEQ ID NO:86) (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 87: UGAGGGUCUCCCUUGAUCU(SEQ ID NO:47) AGAUCAAGGGAGACCCUCAdTdT (SEQ ID NO:87); (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 48, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 88: GUCUCCCUUGAUCUGAGAA(SEQ ID NO:48) UUCUCAGAUCAAGGGAGACdTdT (SEQ ID NO:88); (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 49, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 89: GGCUACCUCUCGAUAUGAG(SEQ ID NO:49) CUCAUAUCGAGAGGUAGCCdTdT (SEQ ID NO:89); (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 50, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 90: UGAGCCAGUGGCUGAAAUU(SEQ ID NO:50) AAUUUCAGCCACUGGCUCAdTdT (SEQ ID NO:90); (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 51, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 91: GCCAGUGGCUGAAAUUGGU(SEQ ID NO:51) ACCAAUUUCAGCCACUGGCdTdT(SEQ ID NO:91); (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 52, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 92: CGGUGCCUAUGGGACAGUG(SEQ ID NO:52) CACUGUCCCAUAGGCACCGdTdT(SEQ ID NO:92); (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 53, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 93: AGUGUACAAGGCCCGUGAU(SEQ ID NO:53) AUCACGGGCCUUGUACACUdTdT (SEQ ID NO:93); (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 54, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 94: GCCACUUUGUGGCCCUCAA(SEQ ID NO:54) UUGAGGGCCACAAAGUGGCdTdT (SEQ ID NO:94); (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 55, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 95: GGCCCUCAAGAGUGUGAGA(SEQ ID NO:55) UCUCACACUCUUGAGGGCCdTdT (SEQ ID NO:95); (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 56, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 96: GAGUGUGAGAGUCCCCAAU(SEQ ID NO:56) AUUGGGGACUCACACUCdTdT (SEQ ID NO:96); (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 57, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 97: GUCCCCAAUGGAGGAGGAG(SEQ ID NO:57) CUCCUCCUCCAUUGGGGACdTdT (SEQ ID NO:97); (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 58, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 98: GCCUUCCCAUCAGCACAGU(SEQ ID NO:58) ACUGUGCUGAUGGGAAGGCdTdT (SEQ ID NO:98); (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 59, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 99: UCCCAUCAGCACAGUUCGU(SEQ ID NO:59) ACGAACUGUGCUGAUGGGAdTdT(SEQ ID NO:99); (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 60, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 100: CGUGAGGUGGCUUUACUGA(SEQ ID NO:60) UCAGUAAAGCCACCUCACGdTdT(SEQ ID NO:100); (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 61, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 101: UGGCUUUACUGAGGCGACU(SEQ ID NO:61) AGUCGCCUCAGUAAAGCCAdTdT (SEQ ID NO: 101); (41) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 62, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 102: GGCUUUACUGAGGCGACUG(SEQ ID NO:62) CAGUCCGCCUCAGUAAAGCCdTdT (SEQ ID NO: 102); (42) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 63, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 103: GCGACUGGAGGCUUUUGAG(SEQ ID NO:63) CUCAAAAGCCUCCAGUCGCdTdT (SEQ ID NO: 103); (43) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 64, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 104: ACUGGAGGCUUUUGAGCAU(SEQ ID NO:64) AUGCUCAAAAGCCUCCAGUdTdT (SEQ ID NO: 104); (44) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 105: GGCUUUUGAGCAUCCCAAU(SEQ ID NO:65) AUUGGGAUGCUCAAAAGCCdTdT (SEQ ID NO: 105); (45) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 106: CCAAUGUUGUCCGGCUGAU(SEQ ID NO:66) AUCAGCCGGACAACAUUGGdTdT (SEQ ID NO: 106); (46) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 107: GUCCGGCUGAUGGACGUCU(SEQ ID NO:67) AGACGUCCAUCAGCCGGACdTdT (SEQ ID NO: 107); (47) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 108: ACCCUGGUGUUUGAGCAUG(SEQ ID NO:68) CAUGCUCAAACACCAGGGUdTdT(SEQ ID NO:108); (48) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 69, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 109: CCUGGUGUUUGAGCAUGUA(SEQ ID NO:69) UACAUGCUCAAACCAGGdTdT(SEQ ID NO:109); (49) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 70, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 110: CCAGGCUUGCCAGCCGAAA(SEQ ID NO:70) UUUCGGCUGGCAAGCCUGGdTdT (SEQ ID NO: 110); (50) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 71, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 111: GGCUUGCCAGCCGAAACGA(SEQ ID NO:71) UCGUUUCGGCUGGCAAGCCdTdT (SEQ ID NO: 111); (51) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 72, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 112: CGAAACGAUCAAGGAUCUG(SEQ ID NO:72) CAGAUCCUUGAUCGUUUCGdTdT (SEQ ID NO: 112); (52) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 73, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 113: CCAGUUUCUAAGAGGCCUA(SEQ ID NO:73) UAGGCCUCUUAGAAACUGGdTdT (SEQ ID NO: 113); (53) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 74, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 114: GCAUCGUUCACCGAGAUCU(SEQ ID NO:74) AGAUCUCGGUGAACGAUGCdTdT (SEQ ID NO: 114); (54) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 75, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 115: UCGUUCACCGAGAUCUGAA(SEQ ID NO:75) UUCAGAUCUCGGUGAACGAdTdT (SEQ ID NO: 115); (55) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 76, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 116: CCGAGAUCUGAAGCCAGAG(SEQ ID NO:76) CUCUGGCUUCAGAUCUCGGdTdT (SEQ ID NO: 116); (56) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 77, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 117: CGAGAUCUGAAGCCAGAGA(SEQ ID NO:77) UCUCUGGCUUCAGAUCUCGdTdT (SEQ ID NO: 117); (57) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 78, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 118: UCUGAAGCCAGAGAACAUU(SEQ ID NO:78) AAUGUUCUCUGGCUUCAGAdTdT (SEQ ID NO: 118); (58) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 79, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 119: GAAGCCAGAGAACAUUCUG(SEQ ID NO:79) CAGAAUGUUCUCUGGCUUCdTdT (SEQ ID NO: 119); (59) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 80, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 120: GAACAUUCUGGUGACAAGU(SEQ ID NO:80) ACUUGUCACCAGAAUGUUCdTdT(SEQ ID NO:120); (60) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 81, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 121: GUCAAGCUGGCUGACUUUG(SEQ ID NO:81) CAAAGUCAGCCAGCUUGACdTdT (SEQ ID NO: 121).

2. The siRNA or a salt thereof according to claim 1, wherein the siRNA is selected from the following double-stranded siRNAs:

3. The siRNA or a salt thereof according to claim 1 or 2, wherein The siRNA comprises at least one modified nucleotide and / or at least one interstrand modification, Preferably, all nucleotides on the sense strand are modified nucleotides, and / or all nucleotides on the antisense strand are modified nucleotides, More preferably, substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides, Still more preferably, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides, in particular, the modified nucleotides are selected from 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP modified nucleotides; and the interchain modifications are selected from thiophosphate, -OEt, -OME modifications.

4. A shRNA or a salt thereof, wherein the shRNA comprises a sense strand, an antisense strand, and a neck loop sequence separating the sense strand and the antisense strand, wherein each nucleotide in the shRNA is independently a modified or unmodified nucleotide, wherein: The sense strand contains a nucleotide sequence I, and the antisense strand contains a nucleotide sequence II. The nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to each other to form a double-stranded region. The nucleotide sequence I and the nucleotide sequence II are selected from the group consisting of the sequences shown in (1) to (60): (1) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 2, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 22: GAUGAAGGUAAUCCGGAGUGA(SEQ ID NO:2) UCACUCCGGAUUACCUUCAUC(SEQ ID NO:22); (2) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 3, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 23: GAUGACUGGCCUCGAGAUGUA(SEQ ID NO:3) UACAUCUCGAGGCCAGUCAUC(SEQ ID NO:23); (3) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 4, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 24: GGACACUGAGAGGGCAAUCUU(SEQ ID NO:4) AAGAUUGCCCUCUCAGUGUCC (SEQ ID NO: 24); (4) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 5, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 25: GGAUCUGAUGCGCCAGUUUCU(SEQ ID NO:5) AGAAACUGGCGCAUCAGAUCC (SEQ ID NO:25); (5) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 6, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 26: GUCCCUUUCCCUACCUUUAUA(SEQ ID NO:6) UAUAAAGGUAGGGAAAGGGAC (SEQ ID NO: 26); (6) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 7, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 27: GGCUGAAAUUGGUGUCGGUGC(SEQ ID NO:7) GCACCGACACCAAUUUCAGCC(SEQ ID NO:27); (7) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 28: GUGGAAACUCUGAAGCCGACC(SEQ ID NO:8) GGUCGGCUUCAGAGUUUCCAC(SEQ ID NO:28); (8) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 29: GUCUGUGCCACAUCCCGAACU(SEQ ID NO:9) AGUUCGGGAUGUGGCACAGAC (SEQ ID NO: 29); (9) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30: GGCUUUGCCAUUGUGCGAUUU(SEQ ID NO:10) AAAUCGCACAAUGGCAAAGCC(SEQ ID NO:30); (10) the nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31: GCCUAUAAUCCCAGCACGUUG(SEQ ID NO:11) CAACGUGCUGGGAUUAUAGGC (SEQ ID NO:31); (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 12: UGGCUUUGCCAUUGUGCGAUU(SEQ ID NO:12) AAUCGCACAAUGGCAAAGCCA (SEQ ID NO: 32); (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33: AUGGCACUUACACCCGUGGUU(SEQ ID NO:13) AACCACGGGUGUAAAGUGCCAU(SEQ ID NO:33); (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 34: UCCCAUCAGCACAGUUCGUGA(SEQ ID NO:14) UCACGAACUGUGCUGAUGGGA (SEQ ID NO:34); (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 35: CUGAGAAUGGCUACCUCGA(SEQ ID NO:15) UCGAGAGGUAGCCAUUCUCAG(SEQ ID NO:35); (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 36: GAGAAUGGCUACCUCUCGAUA(SEQ ID NO:16) UAUCGAGAGGUAGCCAUUCUC(SEQ ID NO:36); (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37: GAGCAAGACUCUGUGUCAAAA(SEQ ID NO:17) UUUUGACACAGAGUCUUGCUC(SEQ ID NO:37); (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38: CAGGAAAAACAAAACAAAGAA(SEQ ID NO:18) UUCUUUGUUUUGUUUUUCCUG(SEQ ID NO:38); (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39: ACAGGAAAAACAAAACAAAGA(SEQ ID NO:19) UCUUUGUUUUGUUUUUCCUGU(SEQ ID NO:39); (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40: CACUUACACCCGUGGUUGUUA(SEQ ID NO:20) UAACAACCACGGGUAGUAAGUG(SEQ ID NO:40); (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 41: GUCCUUUUUUAUACAGGAAAA(SEQ ID NO:21) UUUUCCUGUAUAAAAAAGGAC(SEQ ID NO:41); (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 82: GCGGCCUGUGUCUAUGGUC(SEQ ID NO:42) GACCAUAGACACAGGCCGCdTdT (SEQ ID NO:82); (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 83: GGACCGAGCUCGGGUGUAU(SEQ ID NO:43) AUACACCCGAGCUCGGUCCdTdT (SEQ ID NO:83); (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 84: UCGGGUGUAUGGGGCCGUA(SEQ ID NO:44) UACGGCCCCAUACACCCGAdTdT (SEQ ID NO:84); (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 85: GGUGUAUGGGGCCGUAGGA(SEQ ID NO:45) UCCUACGGCCCCAUACACCdTdT (SEQ ID NO:85); (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 86: GCGUGAGGGUCUCCCUUGA(SEQ ID NO:46) UCAAGGGAGACCCUCACGCdTdT(SEQ ID NO:86) (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 87: UGAGGGUCUCCCUUGAUCU(SEQ ID NO:47) AGAUCAAGGGAGACCCUCAdTdT (SEQ ID NO:87); (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 48, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 88: GUCUCCCUUGAUCUGAGAA(SEQ ID NO:48) UUCUCAGAUCAAGGGAGACdTdT (SEQ ID NO:88); (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 49, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 89: GGCUACCUCUCGAUAUGAG(SEQ ID NO:49) CUCAUAUCGAGAGGUAGCCdTdT (SEQ ID NO:89); (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 50, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 90: UGAGCCAGUGGCUGAAAUU(SEQ ID NO:50) AAUUUCAGCCACUGGCUCAdTdT (SEQ ID NO:90); (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 51, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 91: GCCAGUGGCUGAAAUUGGU(SEQ ID NO:51) ACCAAUUUCAGCCACUGGCdTdT(SEQ ID NO:91); (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 52, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 92: CGGUGCCUAUGGGACAGUG(SEQ ID NO:52) CACUGUCCCAUAGGCACCGdTdT(SEQ ID NO:92); (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 53, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 93: AGUGUACAAGGCCCGUGAU(SEQ ID NO:53) AUCACGGGCCUUGUACACUdTdT (SEQ ID NO:93); (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 54, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 94: GCCACUUUGUGGCCCUCAA(SEQ ID NO:54) UUGAGGGCCACAAAGUGGCdTdT (SEQ ID NO:94); (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 55, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 95: GGCCCUCAAGAGUGUGAGA(SEQ ID NO:55) UCUCACACUCUUGAGGGCCdTdT (SEQ ID NO:95); (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 56, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 96: GAGUGUGAGAGUCCCCAAU(SEQ ID NO:56) AUUGGGGACUUCACACUCdTdT (SEQ ID NO:96); (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 57, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 97: GUCCCCAAUGGAGGAGGAG(SEQ ID NO:57) CUCCUCCUCCAUUGGGGACdTdT (SEQ ID NO:97); (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 58, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 98: GCCUUCCCAUCAGCACAGU(SEQ ID NO:58) ACUGUGCUGAUGGGAAGGCdTdT (SEQ ID NO:98); (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 59, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 99: UCCCAUCAGCACAGUUCGU(SEQ ID NO:59) ACGAACUGUGCUGAUGGGAdTdT(SEQ ID NO:99); (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 60, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 100: CGUGAGGUGGCUUUACUGA(SEQ ID NO:60) UCAGUAAAGCCACCUCACGdTdT(SEQ ID NO:100); (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 61, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 101: UGGCUUUACUGAGGCGACU(SEQ ID NO:61) AGUCGCCUCAGUAAAGCCAdTdT (SEQ ID NO: 101); (41) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 62, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 102: GGCUUUACUGAGGCGACUG(SEQ ID NO:62) CAGUCCGCCUCAGUAAAGCCdTdT (SEQ ID NO: 102); (42) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 63, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 103: GCGACUGGAGGCUUUUGAG(SEQ ID NO:63) CUCAAAAGCCUCCAGUCGCdTdT (SEQ ID NO: 103); (43) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 64, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 104: ACUGGAGGCUUUUGAGCAU(SEQ ID NO:64) AUGCUCAAAAGCCUCCAGUdTdT (SEQ ID NO: 104); (44) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 105: GGCUUUUGAGCAUCCCAAU(SEQ ID NO:65) AUUGGGAUGCUCAAAAGCCdTdT (SEQ ID NO: 105); (45) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 106: CCAAUGUUGUCCGGCUGAU(SEQ ID NO:66) AUCAGCCGGACAACAUUGGdTdT (SEQ ID NO: 106); (46) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 107: GUCCGGCUGAUGGACGUCU(SEQ ID NO:67) AGACGUCCAUCAGCCGGACdTdT (SEQ ID NO: 107); (47) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 108: ACCCUGGUGUUUGAGCAUG(SEQ ID NO:68) CAUGCUCAAACACCAGGGUdTdT(SEQ ID NO:108); (48) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 69, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 109: CCUGGUGUUUGAGCAUGUA(SEQ ID NO:69) UACAUGCUCAAACCAGGdTdT(SEQ ID NO:109); (49) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 70, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 110: CCAGGCUUGCCAGCCGAAA(SEQ ID NO:70) UUUCGGCUGGCAAGCCUGGdTdT (SEQ ID NO: 110); (50) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 71, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 111: GGCUUGCCAGCCGAAACGA(SEQ ID NO:71) UCGUUUCGGCUGGCAAGCCdTdT (SEQ ID NO: 111); (51) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 72, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 112: CGAAACGAUCAAGGAUCUG(SEQ ID NO:72) CAGAUCCUUGAUCGUUUCGdTdT (SEQ ID NO: 112); (52) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 73, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 113: CCAGUUUCUAAGAGGCCUA(SEQ ID NO:73) UAGGCCUCUUAGAAACUGGdTdT (SEQ ID NO: 113); (53) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 74, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 114: GCAUCGUUCACCGAGAUCU(SEQ ID NO:74) AGAUCUCGGUGAACGAUGCdTdT (SEQ ID NO: 114); (54) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 75, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 115: UCGUUCACCGAGAUCUGAA(SEQ ID NO:75) UUCAGAUCUCGGUGAACGAdTdT (SEQ ID NO: 115); (55) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 76, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 116: CCGAGAUCUGAAGCCAGAG(SEQ ID NO:76) CUCUGGCUUCAGAUCUCGGdTdT (SEQ ID NO: 116); (56) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 77, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 117: CGAGAUCUGAAGCCAGAGA(SEQ ID NO:77) UCUCUGGCUUCAGAUCUCGdTdT (SEQ ID NO: 117); (57) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 78, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 118: UCUGAAGCCAGAGAACAUU(SEQ ID NO:78) AAUGUUCUCUGGCUUCAGAdTdT (SEQ ID NO: 118); (58) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 79, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 119: GAAGCCAGAGAACAUUCUG(SEQ ID NO:79) CAGAAUGUUCUCUGGCUUCdTdT (SEQ ID NO: 119); (59) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 80, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 120: GAACAUUCUGGUGACAAGU(SEQ ID NO:80) ACUUGUCACCAGAAUGUUCdTdT(SEQ ID NO:120); (60) The nucleotide sequence I comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 81, and the nucleotide sequence II comprises at least 15 consecutive nucleotides which optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 121: GUCAAGCUGGCUGACUUUG(SEQ ID NO:81) CAAAGUCAGCCAGCUUGACdTdT (SEQ ID NO: 121).

5. The shRNA or a salt thereof according to claim 4, wherein The shRNA comprises at least one modified nucleotide and / or at least one interstrand modification, Preferably, all nucleotides on the sense strand are modified nucleotides, and / or all nucleotides on the antisense strand are modified nucleotides, More preferably, substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides, Still more preferably, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides, Particularly, the modified nucleotides are selected from 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP modified nucleotides; and the interchain modifications are selected from phosphorothioate, -OEt, -OME modifications.

6. A conjugate comprising: The siRNA or a salt thereof according to any one of claims 1 to 3 or the shRNA or a salt thereof according to any one of claims 4 to 5; as well as Conjugation A conjugation group is attached to the siRNA or shRNA.

7. A pharmaceutical composition comprising the siRNA or salt thereof according to any one of claims 1 to 3 and / or the shRNA or salt thereof according to any one of claims 4 to 5 and / or the conjugate according to claim 6, and optionally a pharmaceutically acceptable carrier.

8. Use of the siRNA or salt thereof according to any one of claims 1 to 3, or the shRNA or salt thereof according to any one of claims 4 to 5, or the conjugate according to claim 6, or the pharmaceutical composition according to claim 7 in the preparation of a drug capable of inhibiting cyclin-dependent kinase 4 gene expression.

9. Use of the siRNA or salt thereof according to any one of claims 1 to 3, or the shRNA or salt thereof according to any one of claims 4 to 5, or the conjugate according to claim 6, or the pharmaceutical composition according to claim 7 in the preparation of a medicament for preventing or treating a cyclin-dependent kinase 4-related disease or disorder; In particular, the cyclin-dependent kinase 4-related disease or disorder refers to a disease or disorder caused by or associated with high expression of CDK4, in particular, including tumors, preferably, the tumors include solid tumors and malignant blood tumors, preferably, the solid tumors include head and neck cancer, lung cancer, mesothelioma, septal tumors, esophageal cancer, gastric cancer, pancreatic cancer, bile duct system cancer, small intestine cancer, colon cancer, colorectal cancer, rectal cancer, anal cancer, kidney cancer, urinary tract cancer, bladder cancer, prostate cancer, penis cancer, testicular cancer, ovarian cancer, breast cancer, endocrine system tumors, skin cancer, central nervous system tumors, soft tissue and bone sarcomas, skin and eye endogenous melanoma, the malignant blood tumors include childhood leukemia and lymphoma, Hodgkin's disease, lymphocytic and cutaneous lymphomas, acute and chronic leukemias, plasma cell tumors, and AIDS-related cancers.

10. A method for inhibiting cyclin-dependent kinase 4 (CDK4) gene expression in a cell, the method comprising contacting an effective amount of the siRNA or a salt thereof according to any one of claims 1 to 3, and / or the shRNA or a salt thereof according to any one of claims 4 to 5, and / or the conjugate according to claim 6, and / or the pharmaceutical composition according to claim 7 with the cell, thereby inhibiting the CDK4 gene expression in the cell.

Images