High-expression promoter PETS3 in plant and application thereof

Abstract

The invention discloses a high-expression promoter PETS3 in a plant and application of the high-expression promoter PETS3. The sequence of the high-expression promoter PETS3 is as shown in SEQ ID NO. 1. The promoter PETS3 with a meristem high expression level is successfully cloned from brassica napus, the expression level of the heterologous gene Cas9 driven by the promoter in the stem meristem of the brassica napus is 18 times or more that of the heterologous gene Cas9 driven by pro35S, and in addition, the promoter can also drive the gene to be expressed at a high level in roots and calluses. The invention solves the problem of lack of meristem strong promoters in rape gene editing application in the prior art, has the effects of short period, low workload and high efficiency when being used in gene editing practice, and has good application prospects in the fields of plant genetic breeding and gene engineering.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology and plant genetic engineering, and specifically relates to a high expression promoter PETS3 in plants and an application thereof. Background Art

[0002] Brassica napus is one of the most important oil crops in the world. Improving rapeseed germplasm resources using genetic engineering is an efficient breeding method. Promoters used to drive the expression of exogenous genes in host cells are important tools in genetic engineering. Promoters can be divided into constitutive promoters, tissue-specific promoters, and inducible promoters according to their behavior in driving gene expression. Among them, constitutive promoters drive genes to be expressed in high amounts in all cells or most cells, so there are greater limitations in their application, while tissue-specific promoters and inducible promoters can control the expression of target genes in specific tissues or under specific conditions, and have greater application potential in genetic engineering. For example, the cowpea storage protein gene 8SGα promoter drives the gene to be specifically and efficiently expressed in seeds, and can be used as an efficient specific promoter for bioreactors (Chen MX, Zheng SX, Yang YN, et al. Strong seed-specific protein expression from the Vigna radiata storage protein 8SGα promoter in transgenic Arabidopsis s. Journal of Biotechnology, 2014, 174: 49-56.); the use of egg embryo-specific promoters can significantly improve the working efficiency of the CRISPR / Cas9 system in Arabidopsis (Wang, ZP, Xing, HL, Dong, L, et al. Egg cell-specific promoter-controlled CRISPR / Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome biology, 2015, 16: 144-156).

[0003] Apical meristems are primitive cells and newly derived cells that can maintain the ability to divide for a long time at the top of roots and stems. Meristem cells divide vigorously and are the source of various other tissues and organs in plants. The proliferation and differentiation behavior of meristem cells are strictly regulated, which has a huge impact on the growth of the entire plant, such as affecting stem length, leaf distribution, and fruit number. When using the CRISPR / Cas9 system for gene editing, the longer the expression of Cas9 nuclease and sgRNA is maintained and the higher the expression level, the higher the efficiency will be. The promoter of the CRISPR / Cas9 system is usually a constitutive promoter such as Ubi and 35S promoter, which is not effective in rapeseed; egg cell and young embryo specific promoters have achieved good results in Arabidopsis gene editing, but the rapeseed transformation method is different from Arabidopsis, and this promoter is not applicable. The above problems can be solved by using promoters that are highly expressed in rapeseed meristems, so that Cas nucleases or specific genes are continuously and efficiently expressed and accumulated in meristems.

[0004] At present, some meristem-specific promoters have been identified and applied. For example, a Chinese patent (patent number CN116676307A) reported that the maize root vascular bundle and meristem efficient expression promoter ZmIRT1 is mainly expressed in the root vascular bundle and meristem, but the expression effect is not compared with other promoters. A Chinese patent application (patent number CN115125242A) announced the rice meristem strong expression promoter OsNPY4, which can drive the expression of exogenous genes in the lateral roots and tillering parts of rice. However, the expression level of exogenous genes driven by these promoters in meristems has not been compared with that of constitutive promoters such as Ubi and 35S.

[0005] However, there are no reports on meristem-based promoters that are suitable for rapeseed. Therefore, developing strong endogenous promoters suitable for rapeseed molecular breeding and gene editing is the basis for further developing rapeseed genetic engineering technology, and has important application value in improving rapeseed gene editing efficiency and breeding efficiency. Summary of the invention

[0006] Purpose of the invention: In view of the shortcomings of the prior art, the present invention discloses a high expression promoter PETS3 in plants. The present invention isolates and identifies a rapeseed meristem efficient expression promoter PETS3 and regulates the high expression of the target gene in the meristem, effectively solving the shortcoming of low expression activity in the meristem when using a constitutive promoter to drive the expression of exogenous genes in Brassica napus.

[0007] The present invention also provides application of the high expression promoter PETS3 in the plant.

[0008] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a high expression promoter in plants, the nucleotide sequence of which is one of the following sequences:

[0009] (1) the sequence shown in SEQ ID NO.1;

[0010] (2) a DNA molecule sequence that has more than 90% similarity to the nucleotide sequence described in (1) and can regulate the efficient expression of the gene in meristems;

[0011] (3) A DNA molecule that can hybridize with the nucleotide sequence described in (1) or (2) under stringent conditions and has a promoter function.

[0012] The invention discloses a gene expression frame or a recombinant plasmid containing the promoter with high expression in plants.

[0013] The method for constructing the recombinant plasmid of the present invention comprises the following steps:

[0014] Extract genomic DNA of Brassica napus, design primers for PCR amplification, connect the PCR product with the rapid cloning kit vector, transform into competent cells to obtain TA-PETS3 plasmid, digest the TA-PETS3 plasmid and the plant expression vector, connect the obtained fragments to obtain a recombinant plasmid.

[0015] Wherein, the primer is:

[0016] PETS3-cF AATTAACCTGCAGGAAAAGTC;

[0017] PETS3-cR CCATGGCCTGCAGGATTGTTA.

[0018] Wherein, the rapid cloning kit vector is a TA / Blunt-Zero rapid cloning kit vector, and the plant expression vector is pBI101.

[0019] Preferably, the method for constructing the recombinant plasmid comprises the following steps:

[0020] Genomic DNA of Brassica napus was extracted and PCR amplified using designed primers. The PCR product was ligated with the vector of TA / Blunt-Zero rapid cloning kit and transformed into Escherichia coli DH5α by heat shock method to obtain TA-PETS3 plasmid. The TA-Pets3 plasmid and the plant expression vector pBI101 plasmid were digested with Hind III and Xma I restriction endonucleases, and the PETS3 sequence and the linearized pBI101 plasmid were recovered after electrophoresis, and the obtained fragments were ligated with T4 ligase to obtain the recombinant plasmid pBI101-PETS3.

[0021] Furthermore, the PCR reaction system includes: 10 μl of 5×Phanta Buffer; 2 μl of dNTP; 1 μl of Pets3-cF / cR; 1 μl of Phanta enzyme; 1 μl of DNA template, and 34 μl of ddH2O.

[0022] Furthermore, the PCR program was: pre-denaturation at 95°C for 10 min; 32 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 1 min; and 72°C for 7 min.

[0023] Furthermore, the genomic DNA of young leaves of Brassica napus was extracted using the CTAB method.

[0024] The invention discloses a recombinant microorganism or transgenic plant cell containing the plant meristem high expression promoter or the gene expression frame or recombinant plasmid.

[0025] The high expression promoter in plants or the gene expression frame or recombinant plasmid of the present invention, or the recombinant microorganism, transgenic plant cell or transgenic animal cell line are used to improve the expression level of target genes in plants.

[0026] Wherein, the plant is Brassica napus.

[0027] Furthermore, the application of improving the expression level of the target gene in plant meristem, root and callus tissue.

[0028] Wherein, the target gene is the driving heterologous gene Cas9 or the commonly used reporter gene GUS.

[0029] Furthermore, the following primer sequences were used to detect the expression level:

[0030] Cas9-qF GGAGGGGAAGGAGACTAACAGAGATG;

[0031] Cas9-qR CTTGTCCCAGCCGCCCATGAACTG;

[0032] BnUBQ9-qFTCCATCCGACAGCCCTTACTCT;

[0033] BnUBQ9-qR ACACTTTGGTCCTAAAAGCCACC.

[0034] Furthermore, the promoter, gene expression cassette and recombinant plasmid are used in creating and screening transgenic microorganisms, plants or animal cells, and in gene editing of microorganisms, plants and animal cells.

[0035] The present invention also provides a method for expressing a target gene, wherein the method uses the above DNA molecule as a promoter to initiate the expression of the target gene.

[0036] Wherein, in the above method, the above DNA molecule is operably connected to the upstream of the target gene to be expressed to initiate the expression of the target gene.

[0037] The promoter, gene expression frame and recombinant plasmid of the invention are used in cultivating improved germplasm of Brassica napus.

[0038] The present invention successfully cloned a meristem high expression level promoter PETS3 from Brassica napus. The promoter drives the expression level of heterologous gene Cas9 in the meristem of Brassica napus to be more than 18 times that of the expression driven by pro35S. In addition, the promoter can also drive the gene to be expressed at a high level in the root and callus. The present invention solves the problem of the lack of meristem strong promoters in the application of rapeseed gene editing in the prior art. The use of the promoter with high expression level in gene editing practice can improve the efficiency of base editing, and has the effects of short cycle, low workload and high efficiency, and has a good application prospect in the field of plant genetic breeding and genetic engineering.

[0039] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0040] (1) The present invention obtains a meristem efficient expression promoter PETS3 from Brassica napus.

[0041] (2) The promoter PETS3 can efficiently and stably drive the expression of exogenous genes in Brassica napus. The expression level in the meristem is approximately 18.57 times that of Cas9 driven by the constitutive promoter P35s.

[0042] (3) Efficiently express gene editing components in meristems, with high editing efficiency, short cycle and low cost.

[0043] (4) The promoter of the present invention has important application value in improving the germplasm of Brassica napus. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is GUS histochemical staining. The callus of proETS3:GUS:pBI101-PETS3 transgenic explants can be stained darker blue, and the roots are also stained; NTC: the callus of non-transgenic explants cannot be stained blue.

[0045] Figure 2 The following are the electrophoresis results of proETS3 promoter cloning products. Lane M is DNA Marker, and lanes 1-5 are the electrophoresis results of proETS3 cloning products.

[0046] Figure 3 The results of electrophoresis of TA-PETS3 recombinant plasmid positive colony PCR identification. Lane M is DNA Marker; Lane + is positive control; Lanes 1-11 are colony electrophoresis results.

[0047] Figure 4 Fluorescence quantitative PCR was used to detect the expression level of the proETS3 promoter-driven Cas9 gene in the meristem of Brassica napus. The expression level of Cas9 driven by P35S was set to 1 relative to the expression level of the internal reference gene, the expression level of the Cas9 gene driven by the PETS3 promoter was a multiple of the expression level of Cas9 driven by 35S, and the rapeseed BnUBQ9 was used as the internal reference gene. DETAILED DESCRIPTION

[0048] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0049] The raw materials or reagents in the present invention are all commercially available, and the carriers are all well-known or can be directly purchased.

[0050] Test Materials:

[0051] The plant material was the Brassica napus variety “J9712” provided by Yangzhou University (Natural variation in BnaA07. MKK9 confers resistance to Sclerotinia stem rot in oilseed rape. Nat Commun. 2024 Jun 13; 15(1): 5059. doi: 10.1038 / s41467-024-49504-6. PMID: 38871727; PMCID: PMC11176195.). Escherichia coli DH5α competent cells, PCR mix, high-fidelity enzyme Phanta, T4 DNA ligase, plasmid mini-extraction kit and gel recovery kit were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; plant RNA extraction kit, reverse transcription kit and fluorescent quantitative PCR kit were purchased from Beijing Jingquanshijin Biotechnology Co., Ltd.; X-Gluc was purchased from Beijing Solebow Technology Co., Ltd.; restriction endonucleases HindIII and XmaI were purchased from New England Biolabs; Agrobacterium strains C58C1 and GV310 were purchased from Shanghai Weidi Biotechnology Co., Ltd., and overexpression vectors pBI101 (#175557) and pRGEB32 (#63142) were purchased from Addgene. TA / Blunt-Zero rapid cloning kit vectors were purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0052] Example 1

[0053] DNA Extraction from Young Leaves of Rapeseed and Cloning of Promoter Fragments

[0054] The CTAB method was used to extract genomic DNA from young leaves of the Brassica napus variety "J9712". Primers were designed based on the sequence information of the Brassica napus genome database "ZS11". Using this as a template, PCR amplification was performed using the high-fidelity enzyme Phanta and specific primers PETS3-cF / cR (sequence shown in Table 1).

[0055] PCR reaction system: 5×Phanta Buffer 10μl; dNTP (2.5mM) 2μl; PETS3-cF / cR (10μM) 1μl each; Phanta enzyme 1μl; DNA template 1μl, ddH2O 34μl.

[0056] PCR program: 95℃10min pre-denaturation; 95℃30s, 58℃30s, 72℃1min, 33 cycles; 72℃7min. Electrophoresis was performed using 1% agarose gel. The results are as follows: Figure 2 After the electrophoresis, the gel containing the target band was cut and the PCR product was recovered using a gel recovery kit. The recovered product was connected to the TA / Blunt-Zero rapid cloning kit vector and transformed into E. coli DH5α by heat shock method. The colonies were selected for PCR identification. The identification results are shown in Figure 3 The positive clones were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. After the sequencing was correct, the plasmid was extracted and named TA-PETS3. The promoter fragment was PETS3, and the sequence was shown in SEQ ID NO.1.

[0057] Table 1: Primer sequence information used in the experiment

[0058]

[0059] Example 2

[0060] 1. Cloning of PETS3 promoter and construction of GUS reporter gene expression vector driven by it

[0061] The TA-PETS3 plasmid and the plant expression vector pBI101 plasmid constructed in Example 1 were digested with HindIII and XmaI restriction endonucleases, respectively, and the PETS3 sequence and the linearized pBI101 plasmid were recovered after electrophoresis, and the obtained fragments were connected by T4 ligase. The heat shock method was used to transform Escherichia coli DH5α, and the plasmid was extracted after screening positive clones and sequencing was correct. The plasmid obtained was named pBI101-PETS3. At this time, the reporter gene GUS in the pBI101 vector was driven by the PETS3 promoter and could be expressed in plant cells.

[0062] 2. Agrobacterium-mediated genetic transformation of Brassica napus

[0063] The constructed plasmid pBI101-PETS3 was transformed into Agrobacterium rhizogenes C58C1 by heat shock method, and then transformed into Brassica napus by hypocotyl genetic transformation method. Specifically, Brassica napus strain "J9712" was used to grow 5-7 days old seedlings, and the hypocotyls were cut into about 1 cm; 4 ml of Agrobacterium containing the target plasmid was shaken and cultured at 28°C for about 16 hours until the OD value was 0.2-0.4, the culture medium supernatant was removed by centrifugation, and 40 ml of the culture medium (MS+30 g / l sucrose+1 00μM acetosyringone) was resuspended to make Agrobacterium infection solution, the hypocotyl segments were immersed in the Agrobacterium suspension for infection for 15min, then taken out and placed on 1 / 2MS medium for co-culture for 2 days. The hypocotyl explants were transferred to root induction medium (MS+30g / l sucrose+18g / l mannitol+100μM acetosyringone) and cultured for 4 weeks at 22℃ and 16 / 8h photoperiod. The hypocotyl explants with induced callus and roots were taken for GUS histochemical staining.

[0064] 3. GUS Histochemical Staining

[0065] Prepare 10 ml of GUS staining solution (0.1M sodium phosphate buffer; 10mM EDTA; 0.5mM potassium ferrocyanide; 0.5mM potassium ferrocyanide; 0.5mg / ml X-Gluc; 0.1% Triton X-100; 1×PBS). Place the test material in the GUS staining solution and place it at 37°C for 8-12 hours. Decolorize the sample with 70% ethanol and change the decolorizing solution every hour. Take photos when the explants are free of chlorophyll.

[0066] The results showed that the rapeseed explants transformed with pBI101-PETS3 plasmid were stained with a darker blue color ( Figure 1 ), while the control explants were not stained blue. This result shows that the PETS3 promoter of rapeseed can drive the expression of the exogenous reporter gene GUS in the callus and adventitious roots of rapeseed, so this promoter can be used for plant genetic improvement.

[0067] Example 3

[0068] Construction of Cas9 gene expression vector

[0069] The TA-PETS3 plasmid and the plant expression vector pRGEB32 plasmid were digested with SbfI and BstBI restriction endonucleases, and the PETS3 sequence and the linearized pRGEB32 plasmid were recovered after electrophoresis, and the obtained fragments were connected by T4 ligase. Escherichia coli DH5α was transformed by heat shock method, and after screening positive clones and sequencing correctly, the plasmid obtained by extracting the plasmid was named pRGEB32-PETS3. The artificially synthesized CaMV 35S promoter (35S) promoter (GenBank: FJ362600.1, 10382-11162nt) was added with SbfI and BstBI restriction sites at both ends, and inserted into the pRGEB32 plasmid by restriction digestion and ligation to construct pRGEB32-P35s as a control.

[0070] The constructed plasmids pRGEB32-PETS3 and pRGEB32-P35s were transformed into Agrobacterium GV3101 respectively by heat shock method, and then the brassica napus was transformed by hypocotyl genetic transformation method, and the brassica napus line "J9712" was specifically used to grow 5-7 days of seedling hypocotyls for Agrobacterium infection, and the infection method was the same as Example 2. When the transgenic seedlings grew to about 6-8 true leaves, about 0.1g of stem apical meristem was taken, and RNA was extracted and reverse transcribed into cDNA using a plant RNA extraction kit. The expression level of the Cas9 gene in each tissue was detected by fluorescent quantitative PCR, and the endogenous gene BnUBQ9 of rapeseed was used as an internal reference gene (the quantitative detection primer sequence is shown in Table 1), wherein the expression level of Cas9 driven by P35S was set to 1 relative to the expression level of the internal reference gene, and the expression level of the Cas9 gene driven by the PETS3 promoter was a multiple of the expression level of Cas9 driven by 35S, and rapeseed BnUBQ9 was used as an internal reference gene.

[0071] PCR program: pre-denaturation at 95°C for 3 min; 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, 40 cycles.

[0072] Quantitative results are shown in Figure 4 : The expression level of Cas9 gene driven by pETS3 promoter was 18.57 times that driven by P35s, indicating that this promoter can efficiently drive the expression of foreign genes in callus tissue.

[0073] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A high expression promoter in plants, characterized in that Its nucleotide sequence is one of the following: (1) the sequence shown in SEQ ID NO.1; (2) a DNA molecule sequence that has a similarity of more than 90% with the nucleotide sequence described in (1) and can regulate the efficient expression of the gene in meristems; (3) A DNA molecule that can hybridize with the nucleotide sequence described in (1) or (2) under stringent conditions and has a promoter function.

2. A gene expression cassette or recombinant plasmid containing the plant high expression promoter according to claim 1.

3. A method for constructing the recombinant plasmid according to claim 2, characterized in that: The steps include: Extract genomic DNA of Brassica napus, design primers for PCR amplification, connect the PCR product with the rapid cloning kit vector, transform into competent cells to obtain TA-PETS3 plasmid, digest the TA-PETS3 plasmid and the plant expression vector, connect the obtained fragments to obtain a recombinant plasmid.

4. The construction method according to claim 3, characterized in that: The primers are: PETS3-cF AATTAACCTGCAGGAAAAGTC; PETS3-cR CCATGGCCTGCAGGATTGTTA.

5. The construction method according to claim 3, characterized in that: The rapid cloning kit vector is preferably a TA / Blunt-Zero rapid cloning kit vector, and the plant expression vector is preferably pBI101.

6. A recombinant microorganism or transgenic plant cell containing the plant meristem high expression promoter according to claim 1 or the gene expression cassette or recombinant plasmid according to claim 2.

7. Use of the high expression promoter in plants according to claim 1, the gene expression cassette or recombinant plasmid according to claim 2, or the recombinant microorganism, transgenic plant cell or transgenic animal cell line according to claim 6 in improving the expression level of a target gene in a plant.

8. The use according to claim 7, characterized in that: The plant is Brassica napus.

9. The use according to claim 7, characterized in that: Application in improving the expression level of target genes in plant meristems, roots and callus.

10. The use according to claim 7, characterized in that: The target gene is the driving heterologous gene Cas9 or the commonly used reporter gene GUS.

Images