Molecular Markers for Detecting Fusarium Head Blight Resistance QTL QFhb-yaas-4AL and Their Applications

Abstract

The present invention discloses molecular markers for detecting the Fusarium head blight resistance QTL QFhb-yaas-4AL and their applications. Genotype data are obtained by using a Wheat16K high-throughput wheat gene chip, and a QTL locus QFhb-yaas-4AL related to Fusarium head blight resistance derived from resistant materials is detected. One KASP marker and its detection primer set are developed to efficiently screen for high or low Fusarium head blight resistance. By performing PCR amplification on wheat genomic DNA with the primer set of the present invention, it is possible to directly determine whether the gene for high Fusarium head blight resistance of the resistant material is carried through KASP genotyping. The detection method is simple to operate, the detection result is very intuitive, the detection effect is significantly effective, and the use of this molecular marker for screening can greatly improve the efficiency of molecular marker-assisted selection for wheat breeding with high or low Fusarium head blight resistance.

Description

Technical Field

[0001] The present invention belongs to the technical field of wheat disease-resistant breeding, and relates to molecular markers for detecting the QTL QFhb-yaas-4AL resistant to Fusarium head blight and their applications. Background Art

[0002] Wheat Fusarium head blight (FHB) is a fungal disease caused by Fusarium graminearum and other Fusarium species. After the wheat ears are infected, they will wither and dry due to water loss, and are commonly known as rotten wheat heads in the folk. It mainly occurs severely in warm and humid areas such as the middle and lower reaches of the Yangtze River wheat region and the spring wheat region in Northeast China. When wheat is infected with Fusarium head blight, it will affect grain filling and reduce the grain weight, directly affecting the yield. In general, the average yield reduction in normal years is 5%-15%, and in epidemic years, the yield reduction can be as high as 20%-50%. Moreover, the increase in shriveled grains and imperfect grains will also reduce the protein, gluten content and flour yield of wheat grains, further affecting the processing quality. In addition, the infected wheat grains contain toxic substances such as Deoxynivalenol (DON), which seriously endanger the health of humans and livestock. In 2015, 2016, and 2018, the Huang-Huai wheat region had successive epidemics above moderate severity, seriously affecting wheat production and endangering food security.

[0003] The resistance of wheat to Fusarium head blight mainly includes five types: infection resistance type (Type I), spread resistance type (Type II), kernel resistance type (Type III), disease tolerance type (Type IV), and anti-toxin accumulation type (Type V). At present, there are relatively many studies on the spread resistance (Type II) type. The commonly used identification method is the single-flower injection method, that is, by artificially inoculating the Fusarium head blight pathogen into the middle floret of the wheat ear. Under the condition of maintaining moisture, after a certain period of time, the diseased spikelet rate (number of diseased spikelets / total number of spikelets * 100%) is investigated, and the resistance level is evaluated by the high or low of the diseased spikelet rate. Wheat Fusarium head blight is a complex quantitative trait controlled by multiple genes. Over the years, researchers at home and abroad have identified nearly 250 Fusarium head blight resistance genes / QTL on the 21 chromosomes of wheat through methods such as association analysis. After in-depth research, it is found that the resistance of 7 Fusarium head blight resistance genes (QTL) is relatively stable and the effect value is relatively large, namely Fhb1-Fhb7. Among them, Fhb1 and Fhb2 are derived from the 3B and 6B chromosomes of common wheat Sumai 3, respectively. Fhb3 is derived from the 7Lr#1S chromosome of the related species Leymus racemosus. Fhb4 and Fhb5 are derived from the 4B and 5A chromosomes of common wheat Wangshuibai. Fhb6 is derived from the 1E(ts)#1S of the related species Elymus. Fhb7 is derived from the 7E chromosome of the related species Thinopyrum elongatum. Fhb1, Fhb2 and Fhb4, Fhb5, Fhb8, Fhb9 are all derived from common wheat. The former is related to the spread resistance (Type II) of wheat, and the latter is related to the infection resistance (Type I). Among them, Fhb1 is the Fusarium head blight resistance QTL with the largest recognized effect at home and abroad, and the resistance performance is stable. Fhb3, Fhb6 and Fhb7 are derived from wheat related species, and there are relatively few studies and utilizations on them.

[0004] At present, in wheat production, the control of Fusarium head blight mainly relies on chemical agents, which can reduce the disease incidence to a certain extent. However, in years with severe outbreaks of Fusarium head blight, the effectiveness of such measures is generally limited. At the same time, chemical control also increases the production cost of wheat and has an extremely adverse impact on the environment. Therefore, measures such as chemical control cannot effectively solve the problem of Fusarium head blight. Long-term practice has proved that cultivating and promoting disease-resistant varieties is the most effective way to address the harm of Fusarium head blight. In the 1940s, Chinese scientists began to improve local disease-resistant varieties and have made remarkable progress, breeding a number of varieties with good resistance. For example, the moderately resistant variety Wannian 2 was bred from the highly disease-susceptible variety Nanda 2419. Yangmai 1 and Yangmai 3 were selected from Funo by the Agricultural Science Institute of the Lixiahe Region in Jiangsu. Subsequently, the Suzhou Agricultural Science Institute used Funo and Taiwan wheat as parents and developed the disease-resistant wheat variety Sumai 3 through cross-breeding. Sumai 3 showed high resistance in multi-year and multi-location Fusarium head blight resistance evaluations and is one of the best disease-resistant sources recognized worldwide for Fusarium head blight. The wheat line Ning 7840, bred by the Jiangsu Academy of Agricultural Sciences through cross-breeding with Funo, Anhui 11, and Sumai 3 as parents, had good resistance in multi-year and multi-location Fusarium head blight resistance evaluations. Compared with Sumai 3, Ning 7840 had significantly improved agronomic traits, but due to its tall plant height and average yield potential, it was not widely promoted in production. Cheng Shunhe et al. proposed that in the work of improving the Fusarium head blight resistance of varieties by conventional methods, in the case where no breakthrough in disease-resistant sources has been achieved, a batch of varieties with certain resistance can be preferentially selected as parents. During the selection of offspring, attention should be paid to both high yield and the screening of comprehensive resistance such as resistance to Fusarium head blight. Based on this breeding route, the moderately resistant variety Yangmai 158 was developed and widely promoted, initially solving the problem of combining high-yield on a large scale with resistance to Fusarium head blight. Subsequently, a number of similar varieties were developed in the wheat-growing areas of the middle and lower reaches of the Yangtze River, such as Ningmai 9, Yangmai 14, and Yangmai 17. Subsequently, using Yangmai 158 and Ningmai 9 as backbone parents, several wheat varieties with good resistance were developed, such as Huamai 5 (Yangmai 158 / ph82-2-2), Ningmaizi 119 (Italian soft wheat / Ningmai 13 2 ), and Shengguan 6 (Ningmai 8 / Ningmai 9), etc. Although these efforts have not bred varieties that are immune to Fusarium head blight, they have significantly improved the Fusarium head blight resistance of wheat varieties in the middle and lower reaches of the Yangtze River.

[0005] Genome-wide association study (GWAS) is to identify and locate genes by identifying and genotyping target traits and using statistical methods to detect the association between the two. It has been widely used in the genetic study of quantitative traits of various crops such as wheat, rice and corn. Commonly used association analysis models are mixed linear model (MLM) and general linear model (GLM). Mixed linear model (MLM model) uses principal component analysis (PCA) and kinship matrix (K) as covariates to calculate the linear regression relationship between genotype and phenotype; general linear model (GLM model) uses population structure (Q) or principal component (PCA) as covariates. With the continuous development of high-throughput SNP marker typing technology and high-throughput sequencing technology, the cost of wheat genotyping has gradually decreased. At the same time, the gradual improvement of the phenotypic identification system has promoted the increasingly accurate phenotypic data. The combination of the two has made genome-wide association study (GWAS) more and more widely used in genetic studies of various complex traits of wheat such as fusarium head blight, spike germination, stripe rust, yield and quality. This analysis method can be used to identify a large number of related genes / QTLs that control complex traits by obtaining individual genotype data and years of phenotypic data. It has become an important tool in crop genetic improvement research.

[0006] The genetic mechanism of wheat fusarium head blight is relatively complex, and phenotypic identification is cumbersome and easily affected by the environment, which greatly limits the genetic improvement of wheat fusarium head blight resistance. With the continuous deepening of the positioning and cloning of fusarium head blight resistance genes (QTLs) and the research on molecular markers, the application of molecular marker-assisted selection technology has become more and more extensive in the process of breeding disease-resistant varieties. Compared with conventional breeding, molecular breeding can perform rapid and accurate screening in low generations, significantly improving the selection efficiency of fusarium head blight resistant varieties and shortening the breeding cycle. Therefore, it is of great significance to collect wheat variety resources in the middle and lower reaches of the Yangtze River, and to mine new fusarium head blight resistance genes / QTLs through whole genome association analysis, and to convert them into selectable molecular markers to create excellent fusarium head blight resistance germplasm resources for wheat fusarium head blight resistance breeding. Summary of the invention

[0007] The purpose of the present invention is to overcome the defects in the prior art and provide a molecular marker for detecting the resistance to fusarium head blight QTL QFhb-yaas-4AL and its application. The present invention uses the Wheat16K wheat high-throughput gene chip to obtain genotype data, detects a major effect QTL locus QFhb-yaas-4AL related to fusarium head blight resistance from a disease-resistant variety, and develops a KASP marker and primer set based on this, which is used to efficiently screen the resistance to fusarium head blight.

[0008] On the one hand, the present invention provides a KASP molecular marker linked to the major QTL QFhb-yaas-4A L for wheat Fusarium head blight resistance, and the nucleotide sequence of the KASP molecular marker is as shown in SEQ ID No. 4.

[0009] On the other hand, the present invention provides a primer set for detecting whether the 23rd allelic variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T,

[0010] The primer set contains two upstream primers and one downstream primer;

[0011] The upstream primers are designed according to the 23rd deoxyribonucleotide and its upstream sequence in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome, and the 3'-terminal deoxyribonucleotide of one upstream primer is C, and the 3'-terminal deoxyribonucleotide of the other upstream primer is T;

[0012] The downstream primer is designed according to the downstream sequence of the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome.

[0013] Further, the nucleotide sequence of one upstream primer is as shown in SEQ ID No. 1, the nucleotide sequence of the other upstream primer is as shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No. 3.

[0014] Further, the 5'-end of one upstream primer is linked with a fluorescent label sequence FAM, and the 5'-end of the other upstream primer is linked with a fluorescent label sequence HEX.

[0015] On the other hand, the present invention also provides a detection kit containing the primer set.

[0016] On the other hand, the present invention also provides the application of the primer set or the kit in any of the following:

[0017] (A) Identifying or assisting in identifying wheat Fusarium head blight resistance traits;

[0018] (B) Comparing the Fusarium head blight resistance of the wheat grains to be tested;

[0019] (C) Breeding or screening wheat single plants or lines or strains or varieties with relatively strong Fusarium head blight resistance;

[0020] (D) Breeding or screening wheat single plants or lines or strains or varieties with relatively weak Fusarium head blight resistance;

[0021] (E) Preparing a product for comparing the resistance of wheat to Fusarium head blight;

[0022] (F) Preparing a product for breeding or screening wheat individual plants or lines or strains or varieties with relatively strong resistance to Fusarium head blight;

[0023] (G) Preparing a product for breeding or screening wheat individual plants or lines or strains or varieties with relatively weak resistance to Fusarium head blight.

[0024] On the other hand, the present invention also provides any one of the following methods:

[0025] Method A: A method for detecting whether the 23rd allelic variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, or TT, or C and T, comprising the following steps (A1) or (A2):

[0026] (A1) Direct sequencing;

[0027] (A2) Performing PCR amplification on the genomic DNA of the wheat to be tested using the primer set or the kit, performing fluorescence signal scanning on the amplified product, analyzing the scanning data, and then determining whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is CC, or TT, or C and T according to the following:

[0028] If the fluorescence signal data of the amplified product of the wheat to be tested shows red after analysis by Kluster Caller software, the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is a homozygote of C;

[0029] If the fluorescence signal data of the amplified product of the wheat to be tested shows blue after analysis by Kluster Caller software, the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is a homozygote of T;

[0030] If the fluorescence signal data of the amplified product of the wheat to be tested shows green after analysis by Kluster Caller software, the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is a heterozygote of C and T;

[0031] Method B: A method for comparing the resistance of wheat to Fusarium head blight to be tested, comprising the following steps:

[0032] (B1) Detect whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the wheat genome is CC, TT, or C and T;

[0033] (B2) Determine the Fusarium head blight resistance of the tested wheat as follows: The Fusarium head blight resistance of the tested wheat that is a homozygote with T at the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome is stronger than that of the tested wheat that is a homozygote with C or a heterozygote with C and T at the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome;

[0034] Method C: A method for breeding or screening wheat plants or lines or strains or varieties with relatively strong Fusarium head blight resistance, comprising the following steps:

[0035] (C1) Detect whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the wheat genome is CC, TT, or C and T;

[0036] (C2) Select the tested wheat that is a homozygote with T at the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome as a parent for breeding, and select the wheat that is a homozygote with T at the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome in each generation of breeding, and finally obtain wheat plants or lines or strains or varieties with relatively strong Fusarium head blight resistance;

[0037] Method D: A method for breeding or screening wheat plants or lines or strains or varieties with relatively weak Fusarium head blight resistance, comprising the following steps:

[0038] (D1) Detect whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the wheat genome is CC, TT, or C and T;

[0039] (D2) Select the tested wheat that is a homozygote with C at the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome as a parent for breeding, and select the wheat that is a homozygote with C at the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the genome in each generation of breeding, and finally obtain wheat plants or lines or strains or varieties with relatively weak Fusarium head blight resistance.

[0040] Further, in the Method B, the Method C, and the Method D, the method for detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A of the wheat genome is CC, TT, or C and T is the Method A.

[0041] On the other hand, the present invention also provides the application of the primer set or the method in wheat molecular marker-assisted breeding.

[0042] Compared with the prior art, the present invention uses a Wheat16K high-throughput wheat gene chip to obtain genotype data, detects a major QTL locus QFhb-yaas-4AL related to Fusarium head blight resistance derived from a disease-resistant variety on chromosome 4A, and further develops a KASP marker and a dedicated primer set KASP-4AL-Fhb. Experiments have proved that the KASP molecular marker of the present invention can be used for molecular marker-assisted selection breeding of the major QTL QFhb-yaas-4AL for Fusarium head blight resistance in wheat. The present invention provides a good tool for the effective utilization of the QTL locus QFhb-yaas-4AL for resistance to Fusarium head blight in breeding. This marker can quickly screen for Fusarium head blight resistance in wheat, provide convenience for screening wheat materials carrying excellent allelic variations, and improve breeding efficiency. Description of the Drawings

[0043] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments.

[0044] Figure 1 Manhattan plot of the genome-wide association study based on the 16K chip for 244 wheat varieties.

[0045] Figure 2 Quantile-Quantile plot (QQ plot) of the genome-wide association study based on the 16K chip for 244 wheat varieties.

[0046] Figure 3 Test marker amplification detection results of the KASP marker for verifying the genotypes of Fusarium head blight resistance of 244 varieties and 63 wheat lines in Examples 1 and 2. Specific Embodiments

[0047] The following will describe in detail the embodiments of the technical solutions of the present invention with reference to the drawings. The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and thus are only examples and cannot be used to limit the protection scope of the present invention. It should be noted that unless otherwise specified, the technical terms or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art to which the present invention belongs.

[0048] Example 1 Screening for Stable SNP Loci Significantly Associated with Fusarium Head Blight Resistance and Verification

[0049] In this example, 244 approved varieties in Jiangsu Province were used as materials. In two consecutive growing seasons of 2021 and 2022, this natural population was planted in the Fusarium head blight identification nursery of the Wantou Experimental Base and the Gaoyou Experimental Base in the Lixiahe area of Jiangsu. A randomized block design was used. At the Wantou Experimental Base, each variety was planted in two rows, with 30 seeds per row, row length of 1.3 m, row spacing of 0.26 m, and two replicates, with conventional field management. Further, traditional inoculation identification of wheat Fusarium head blight resistance was carried out in the field in 2021 and 2022. Prepare a spore suspension of Fusarium graminearum (1×10 5 -5×10 5 spores / mL -1 ). The single-flower drip method was used for inoculation. At the early stage of wheat flowering, 12 μL of spore solution was sucked with a syringe and injected into any floret of the fourth row of florets from the top spikelet of the wheat ear from top to bottom. 15 spikes were inoculated for each variety. After inoculation, artificial mist spraying was used for moisturizing (spraying mist for 5 min every half hour). The number of diseased spikelets of the inoculated spikes was investigated 21 days after inoculation, and the diseased spikelet rate was calculated. Diseased spikelet rate = number of diseased spikelets / total number of spikelets × 100%.

[0050] At the Gaoyou Experimental Base, each variety was planted in one row, with 30 seeds per row, row length of 1.0 m, row spacing of 0.26 m, and one replicate, with conventional field management. Further, traditional inoculation identification of wheat Fusarium head blight resistance was carried out in the field in 2022. Prepare a spore suspension of Fusarium graminearum (1×10 5 -5×10 5 spores / mL -1 ). The single-flower drip method was used for inoculation. At the early stage of wheat flowering, 12 μL of spore solution was sucked with a syringe and injected into any floret of the fourth row of florets from the top spikelet of the wheat ear from top to bottom. 10 spikes were inoculated for each variety. After inoculation, bagging was used for moisturizing for 3 days. The number of diseased spikelets of the inoculated spikes was investigated 21 days after inoculation, and the diseased spikelet rate was calculated. Diseased spikelet rate = number of diseased spikelets / total number of spikelets × 100%.

[0051] The above disease resistance investigation and identification standards follow the "Technical Regulations for Identification of Resistance to Fusarium Head Blight of Wheat Varieties in Regional Trials - NY / T 2954-2016" of the People's Republic of China's agricultural industry standard.

[0052] Genomic DNA was extracted using the PVP-40 method, and genotype data were obtained using a 16K SNP chip developed by BGI Genomics. Using Tassel software, with principal component analysis (PCA) and kinship matrix (K) as covariates, GWAS analysis of the MLM model was performed. In the results, markers with P≤0.001 (-log10(p value)≥3.0) were considered important markers significantly associated with the phenotype. Loci within a 5Mb interval on the physical map were identified as the same candidate locus. Referring to Meta-QTL, the loci stably associated with Fusarium head blight resistance identified in this experiment were compared with the reported loci to determine whether they were new QTL loci.

[0053] One relatively stable locus QFhb-yaas-4AL related to Fusarium head blight resistance was obtained in the experiment, which could explain 7.68 - 7.78% of the phenotypic variation.

[0054] Table 1 Stable Fusarium head blight resistance loci

[0055]

[0056] As Figure 1 and Figure 2 shown, in this application, one significant SNP locus QFhb-yaas-4AL related to Fusarium head blight resistance was mapped through association analysis (GWAS). The physical position was 628023813b on chromosome 4A. After comparison with the Meta-QTL interval, it was found that this locus was a new Fusarium head blight resistance locus. Further, the flanking sequence of this locus was downloaded from the wheat genome website. The flanking sequence was SEQ ID NO:4. KASP primer design was performed using Polymarker (http: / / polymarker.tgac.ac.uk / ), and the primers were synthesized by Beijing Jiacheng Biotechnology Co., Ltd. Finally, it was successfully transformed into the KASP marker KASP-4AL-Fhb, and its corresponding variant site was C / T, that is, the 23rd position in the nucleotide sequence shown in SEQ ID No.4, TGAGTTATTCATTCCGCACATA[C / T]CACACACGCCACATGGTCATCA GGACTATCATACGTCTAGCATCAGGTAGATGCTCCAGTAGTGAG (SEQ ID NO.4).

[0057] In this example, a KASP-4AL-Fhb primer set was designed for this SNP locus. The primer set includes an upstream primer with a nucleotide sequence of 5'-TGAGTTATTCATTCCGCACATAc-3' (SEQ ID NO.1), another upstream primer with a nucleotide sequence of 5'-TGAGTTATTCATTCCGCACATAt-3' (SEQ ID NO.2), and a common downstream primer with a nucleotide sequence of 5'-CTCACTACTGGAGCATCTACCTGA-3' (SEQ ID NO.3). At the same time, a fluorescent tag sequence FAM is linked to the 5' end of the upstream primer SEQ ID No.1, and a fluorescent tag sequence HEX is linked to the 5' end of the other upstream primer SEQ ID No.2. The 3' end of the upstream primer is the allelic variant base C / T of this locus, and the downstream primer ensures the specificity of the 4A chromosome for PCR amplification.

[0058] Preparation of KASP marker primer working solution:

[0059] Take 12 μL (100 μM) of each of the upstream primers with fluorescent labels (nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2), take 30 μL (100 μM) of the downstream primer with fluorescent label (nucleotide sequence as shown in SEQ ID NO.3), and make up to 100 μL with sterile ultrapure water. Mix well and use it as the primer working solution for KASP marker for standby.

[0060] PCR amplification reaction system: 2 μL of the wheat DNA template to be tested (about 30 ng / μL), 0.08 μL of the primer working solution, 2.5 μL of KASP Master Mix (LGC company, KBS-1016-002), and make up to 5 μL with sterile ultrapure water;

[0061] PCR reaction procedure: First step, pre-denaturation at 95 °C for 15 min; second step, denaturation at 95 °C for 20 s, annealing at 65 - 57 °C (decreasing 1 °C per cycle) for 60 s, a total of 9 cycles; third step, denaturation at 95 °C for 20 s, renaturation at 57 °C for 1 min, 32 cycles; store at 10 °C. At the same time, a blank control (NTC) without adding template DNA is set in the reaction system during the experiment, and one or more blank controls are set for each plate.

[0062] Take wheat seedlings and extract the genomic DNA of the wheat to be tested by the PVP-40 method

[0063] Using the genomic DNA of the wheat to be tested as a template, perform PCR amplification with the above KASP primer set and PCR reagents to obtain the PCR amplification product P. The PCR reaction is carried out on an S1000 TMPerformed on a Thermal Cycler PCR instrument (Bio-Rad Laboratories Inc.), and the fluorescence values of the PCR amplification products were scanned and read using a multifunctional microplate reader (PHERAstar Plus, BMG LABTECH, Germany). The excitation wavelength of FAM was 485 nm, and the emission wavelength was 520 nm; the excitation wavelength of VIC was 535 nm, and the emission wavelength was 556 nm. The excitation wavelength of the system reference fluorescence ROX was 575 nm, and the emission wavelength was 610 nm. Gene typing was performed using the Klust er Caller software (KBioscience), and the genotype of the Fusarium head blight resistance-related locus QFhfb-yaas-4AL was determined according to the analysis results.

[0064] 244 natural populations were amplified as described above, and the detection results are shown in the appendix Figure 3 as follows. The fluorescence signal data of the amplification products were analyzed by the Kluster Caller software and aggregated at a position close to the X-axis (blue) in the fluorescence signal coordinate system of the genotyping results, which proved that the genotype of the 36th base (SNP locus) of the nucleotide sequence flanking the SNP locus (such as SEQ ID NO.5) of these wheat was C; while the fluorescence signal data of the amplification products were analyzed by the Kluster Caller software and aggregated at a position close to the Y-axis (red) in the coordinate system, which proved that the genotype of these wheat at this SNP locus was T; the KASP detection results of 244 varieties and the average diseased spikelet rate results of field trials in 2021 and 2022 are shown in Tables 2, 3 and Figure 2 as follows.

[0065] Table 2 Average diseased spikelet rate of Fusarium head blight and KASP genotyping results of 244 varieties

[0066]

[0067]

[0068]

[0069] Table 3 T-test results of the average diseased spikelet rate of varieties carrying different genotypes at the QFhb-yaas-4AL locus

[0070]

[0071] Table 3 shows the genotypes and phenotypes of 244 varieties using the two-sample T-test in Excel 2019. The results show that the average diseased spikelet rate of the varieties with the genotype T at the QFhb-yaas-4AL locus is reduced by 24.69%, and there is a significant difference at the p<0.05 level. This indicates that the primer set and genotype detection system of the above KASP marker KASP-4AL-Fhb can be applied to molecular marker-assisted breeding for wheat scab resistance (the statistical method in Table 3 is a conventional method in this field, and specifically, reference can also be made to the content disclosed in the literature "Gai Junyi, 'Experimental Statistics Methods', China Agricultural Press, September 2000"). Attachment Figure 2 It shows that the material genotyping results are good, and the material genotyping is completely consistent with the chip detection data, indicating that the KASP marker development is successful and can be further used for the detection of breeding materials.

[0072] Example 2 Application of KASP primer set in breeding

[0073] Field experiment: In this example, 63 wheat test lines from the middle and lower reaches of the Yangtze River were planted in the Wantou Experimental Base of the Agricultural Science Institute of the Lixiahe Region in Jiangsu in 2022, and further carried out in the field using the traditional natural identification of wheat scab resistance. 15 spikes were investigated for each variety, and the resistance investigation and identification standards were in accordance with the "Technical Regulations for the Identification of Wheat Varieties Resistant to Scab in Regional Trials of Wheat - NY / T 2954-2016, Agricultural Industry Standard of the People's Republic of China", and the average severity was calculated.

[0074] The KASP primer set obtained in Example 1 was used to genotype 63 wheat test lines from the middle and lower reaches of the Yangtze River planted in the Wantou Experimental Base of the Agricultural Science Institute of the Lixiahe Region in Jiangsu in 2022. The average severity of the natural identification results of scab in the 2022 field experiment and the KASP detection results are shown in Table 4 and Attachment Figure 2 as shown. The fluorescence signal data of the amplification products were analyzed by the Kluster Caller software and aggregated to be the same as that of Yangmai 4 in the fluorescence signal data of the genotyping results, which proved that the genotypes of these wheat lines at this locus were T; if the fluorescence signal data of the amplification products of the wheat lines were analyzed by the Kluster Caller software and aggregated differently from that of Yangmai 4 in the genotyping, it was proved that the genotypes of these wheat lines at this SNP locus were C.

[0075] Table 4 Average severity and genotype detection results of 63 wheat lines

[0076]

[0077]

[0078] Table 5 Results of the average severity T-test of the test lines carrying different genotypes

[0079]

[0080] Table 5 shows the results of the two-sample T-test using Excel 2019: In 2020, the average diseased spikelet rate of the variety with genotype T was 18.55% lower than that of the variety with genotype C. The t-value of the T-test result was t = 2.28, and there was a significant difference at the p < 0.05 level, indicating that the resistance of wheat with allele T to Fusarium head blight was higher than that of wheat with allele C. At the same time, it shows that the primer set and genotype detection system of the above KASP marker KASP-4AL-Fhb can be applied to molecular marker-assisted selection breeding for Fusarium head blight resistance in wheat.

[0081] From the above experimental results, it can be concluded that by performing PCR amplification on wheat genomic DNA using the primer set of the present invention, the genotype at this locus can be directly detected by KASP. The detection method is simple to operate, the detection result is very intuitive, the detection effect is significantly effective, and screening using this molecular marker can greatly improve the efficiency of molecular marker-assisted selection for wheat breeding with high or low resistance to Fusarium head blight.

[0082] Unless otherwise specifically stated, the numerical values set forth in these examples do not limit the scope of the present invention. In all the examples shown and described herein, any specific value should be construed as merely exemplary and not as a limitation, and thus other examples of the exemplary embodiments may have different values.

Claims

1. A major QTL for wheat fusarium head blight resistance QFhb-yaas-4AL The linked KASP molecular marker is characterized by: The nucleotide sequence of the KASP molecular marker is shown in SEQ ID No.

4.

2. A primer set for detecting whether the allele variation at position 23 in the nucleotide sequence shown in SEQ ID No. 4 of claim 1 is CC, TT, or C and T, characterized in that: The primer set contains two upstream primers and one downstream primer; The upstream primer is designed according to the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome and its upstream sequence, and the 3' terminal deoxyribonucleotide of one of the upstream primers is C, and the 3' terminal deoxyribonucleotide of the other upstream primer is T; The downstream primer is designed according to the downstream sequence of the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome.

3. The primer set according to claim 2, characterized in that The nucleotide sequence of one upstream primer is shown as SEQ ID No.1, the nucleotide sequence of another upstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.

3.

4. The primer set according to claim 3, characterized in that: The 5' end of one of the upstream primers is connected to a fluorescent label sequence FAM, and the 5' end of the other upstream primer is connected to a fluorescent label sequence HEX.

5. A detection kit comprising the primer set according to any one of claims 2 to 4.

6. Use of the primer set according to any one of claims 2 to 4 or the kit according to claim 5 in any of the following: (A) identifying or assisting in identifying wheat resistance to fusarium head blight; (B) Comparing the resistance of wheat grains to fusarium head blight; (C) breeding or selecting wheat plants, strains, lines or varieties that are relatively resistant to ergot; (D) preparing a product for comparing the resistance of tested wheat to fusarium head blight; (E) preparing a product for breeding or screening wheat plants, strains, lines or varieties with relatively strong resistance to Fusarium head blight.

7. Either of the following methods: Method B: A method for comparing the resistance of wheat to fusarium head blight, comprising the following steps: (B1) detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T; (B2) determining the fusarium head blight resistance of the wheat to be tested as follows: the fusarium head blight resistance of the wheat to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A in the genome is T is stronger than the fusarium head blight resistance of the wheat to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A in the genome is C or a heterozygote of C and T; Method C: A method for breeding or screening wheat plants, strains, lines or varieties with relatively strong resistance to scab, comprising the following steps: (C1) detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC, TT, or C and T; (C2) selecting a wheat plant to be tested in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A of the genome is homozygous for T as a parent for breeding, and selecting wheat plants in which the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4A of the genome is homozygous for T in each breeding generation, and finally obtaining wheat plants, strains, lines or varieties with relatively strong ergot disease.

8. The method according to claim 7, characterized in that: In the method B and the method C, the method for detecting whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat genome is CC or TT or C and T comprises the following steps (A1) or (A2): (A1) Direct sequencing; (A2) using the primer set of any one of claims 2 to 4 or the kit of claim 5 to perform PCR amplification on the wheat genomic DNA to be tested, scanning the amplified product for fluorescence signals, analyzing the scanned data, and then determining whether the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the wheat gene to be tested is CC, TT, or C and T as follows: If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as red, then the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is a homozygous C; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as blue, then the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 of chromosome 4A in the wheat genome to be tested is a homozygous T; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as green, the 23rd deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4A in the genome of the wheat to be tested is a hybrid of C and T.

9. Use of the KASP molecular marker according to claim 1, the primer set according to any one of claims 3 to 5, the kit according to claim 6, or the method according to any one of claims 7 to 8 in molecular marker-assisted breeding for wheat resistance to Fusarium head blight.

Images