Engineering bacterium for expressing interferon alpha-2b and application thereof
Escherichia coli Nissle1917 was genetically engineered to construct the engineered bacteria EcN-IFN-α2b expressing interferon α-2b, which solved the problem of poor treatment effect of HPV infection, achieved effective reduction of HPV infection and improved vaginal flora, and demonstrated The ability to effectively treat vaginal inflammation and regulate inflammatory responses.
Patent Information
- Application Number
- CN202411507808.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-28
- Publication Date
- 2025-01-10
AI Technical Summary
The existing treatment methods for HPV infection cannot completely remove the virus, and the mechanism of action of interferon α-2b is unclear, so the treatment effect needs to be improved.
Escherichia coli Nissle1917 was genetically engineered to construct the engineered bacteria EcN-IFN-α2b that expresses interferon α-2b, which has efficient IFN-α2b production and demonstrates superior growth performance, acid resistance, antioxidant activity and antibacterial properties. Prepare preparations for treating vaginal inflammation.
EcN-IFN-α2b significantly reduces vaginal inflammation caused by HPV infection, improves vaginal flora homeostasis, and only a small number of strains can achieve good therapeutic effects, significantly reduces the expression level of HPV virus, and regulates the inflammatory response.
Smart Images
Figure CN119286749A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to genetic engineering technology, and in particular to an engineering bacterium expressing interferon alpha-2b and application thereof. Background Art
[0002] Human papillomavirus (HPV) is a type of non-enveloped, epithelial-tropic, double-stranded DNA virus that is associated with cervical cancer. There are many treatments for HPV infection, but none of them can completely eliminate the HPV virus and turn HPV from positive to negative.
[0003] Interferon α-2b (IFNα-2b) has been used to treat HPV, but the mechanism of action of IFNα-2b is still unclear and the therapeutic effect needs to be improved. Summary of the invention
[0004] Based on this, the present invention provides an engineered bacterium expressing interferon α-2b and its application, which at least solves one problem in the prior art.
[0005] In a first aspect, the present invention provides an engineered bacterium expressing interferon α-2b ( Escherichia coli Nissle 1917 attB-INFα-2b), which Escherichia coli Nissle It was obtained through genetic engineering in 1917 and contains the coding gene of INFα-2b.
[0006] In some optional embodiments, the nucleotide sequence of the gene encoding INFα-2b is shown as SEQ ID No.8.
[0007] Engineering bacteria expressing interferon α-2b ( Escherichia coli Nissle 1917 attB-INFα-2b), abbreviated as EcN-IFN-α2b, can efficiently produce IFN-α2b in vitro and has superior probiotic properties in terms of growth performance, acid resistance, antioxidant activity and antibacterial properties. More importantly, EcN-IFN-α2b can significantly reduce vaginal inflammation in HPV-positive NSG mice and improve the vaginal flora of HPV-positive NSG mice. These properties indicate that EcN-IFN-α2b can be used to treat vaginal inflammation caused by HPV infection in humans and restore the homeostasis of vaginal flora.
[0008] In a second aspect, the present invention provides an engineered bacterium expressing interferon α-2b ( Escherichia coli Nissle 1917attB-INFα-2b) in the preparation of preparations for treating vaginal inflammation.
[0009] In some optional embodiments, the vaginal inflammation is vaginal inflammation caused by HPV infection.
[0010] In some alternative embodiments, the formulation for treating vaginal inflammation is administered vaginally.
[0011] In a third aspect, the present invention provides a preparation for treating vaginal inflammation, which contains an engineered bacterium expressing interferon α-2b ( Escherichia coli Nissle 1917 attB-INFα-2b).
[0012] In some optional embodiments, the formulation for treating vaginal inflammation is in the form of a solution.
[0013] In some optional embodiments, the solvent of the solution is water or saline.
[0014] In some optional embodiments, the engineered bacteria expressing interferon α-2b in the preparation for treating vaginal inflammation ( Escherichia coli Nissle 1917 attB-INFα-2b) was 1×10 9 CFU / mL-10×10 9 CFU / mL.
[0015] In some optional embodiments, the engineered bacteria expressing interferon α-2b in the preparation for treating vaginal inflammation ( Escherichia coli Nissle 1917 attB-INFα-2b) was 5×10 9 CFU / mL.
[0016] Due to the adoption of the above technical solution, the embodiments of the present invention have at least the following beneficial effects: (1) EcN-IFN-α2b is prepared into a preparation for treating vaginal inflammation, and only a small amount of engineered bacteria expressing interferon α-2b is needed to achieve a good therapeutic effect; (2) EcN-IFN-α2b can not only significantly reduce vaginal inflammation caused by HPV infection, but also improve the vaginal flora and restore the homeostasis of the vaginal flora. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 1 is a graph showing the PCR identification results of clone colony 1917 attB-T in an example of the present invention, wherein 1-12 are the numbers of randomly selected clone colonies.
[0018] Figure 2 This is a PCR identification result diagram of seamlessly cloned engineered bacteria in an embodiment of the present invention, wherein 1-12 are the colony numbers of seamlessly cloned colonies randomly selected.
[0019] Figure 3The growth curves of EcN-IFN-α2b and EcN in the examples of the present invention are shown.
[0020] Figure 4 The acid resistance of cN-IFN-α2b and EcN in the examples of the present invention at different pH values is shown.
[0021] Figure 5 The results of evaluating the antioxidant capacity of EcN-IFN-α2b and EcN in the examples of the present invention are shown.
[0022] Figure 6 The antibacterial effects of EcN-IFN-α2b and EcN in the examples of the present invention on Escherichia coli O157, Staphylococcus aureus Cowan1 and Gardnerella vaginalis ATCC14018 are shown.
[0023] Figure 7 This is a flow chart of animal experiments in an embodiment of the present invention.
[0024] Figure 8 The example of the present invention shows that the expression level of HPV16 E6 gene in mouse vaginal tissue was detected by RT-qPCR during the 6th to 7th day of the animal experiment.
[0025] Fig. 9 The immunohistochemical analysis results of the number of CD3, CD19 and CD56 positive cells in the spleen tissue of mice during the 6th to 7th day of the animal experiment in the example of the present invention are shown (scale bar = 50 μm).
[0026] Fig.10 The expression level of HPV16 E6 gene in mouse vaginal tissue was detected by RT-qPCR in the examples of the present invention.
[0027] Fig.11 The CD3 + 、CD19 + and CD56 + Results of immunohistochemical analysis of the number of positive cells (scale bar = 50 μm).
[0028] Fig.12 The results of Western blot analysis of key proteins involved in the JAK-STAT pathway in mouse vaginal tissue in an example of the present invention are shown.
[0029] Fig.13 The graph shows the ratio of p-STAT1 to STAT1, the ratio of p-STAT2 to STAT2, and the ratio of IRF9 to β-actin, key proteins involved in the JAK-STAT pathway in the vaginal tissue of mice in the embodiments of the present invention.
[0030] Fig.14 The results of Western blot analysis of key proteins involved in the cGAS-STING pathway in mouse vaginal tissue in an example of the present invention are shown.
[0031] Fig.15 The graph shows the ratio of STING to β-actin, the ratio of cGAS to β-actin, the ratio of p-TBK1 to TBK1, and the ratio of p-IRF3 to IRF3 in the vaginal tissue of mice involved in the cGAS-STING pathway in the embodiments of the present invention.
[0032] Fig.16 The relative mRNA expression levels of TNF-α, IL-1β, and IL-6 in the vaginal tissue of mice in the examples of the present invention are shown.
[0033] Fig.17 The rarefaction curves of vaginal flora of each group of mice after treatment in the examples of the present invention are shown.
[0034] Fig.18 The Chao1 index and Simpson index of each group of mice after treatment in the examples of the present invention are shown.
[0035] Fig.19 The Venn diagram of each group of mice after treatment in the examples of the present invention is shown.
[0036] Fig. 20 The principal coordinate analysis (PCoA) results of the β-diversity index of each group of mice after treatment in the example of the present invention are shown.
[0037] Fig.21 The results of linear discriminant analysis (LEFSe) of each group of mice after treatment in the examples of the present invention are shown.
[0038] Fig. 22 The composition of the microbial community at the post-treatment level of each group of mice in the examples of the present invention is shown.
[0039] Fig.23 The relative abundance of Firmicutes, Proteobacteria, Actinobacteria, and Bacteroidetes microorganisms in each group of mice after treatment in the examples of the present invention is shown.
[0040] Fig.24 The microbial community composition at the genus level after treatment of each group of mice in the examples of the present invention is shown.
[0041] Fig.25 The relative abundance levels of Streptococcus, Vibrionaceae_Vibrio, Staphylococcaceae_Staphylococcus, and Lactobacillus microorganisms in each group of mice after treatment in the examples of the present invention are shown.
[0042] In the figures, * indicates p < 0.05, and ** indicates p < 0.01. DETAILED DESCRIPTION
[0043] The following is a clear and complete description of the concept of the present invention and the technical effects produced, so as to fully explain the purpose, scheme and effect of the present invention.
[0044] Example 1: Construction of EcN-IFN-α2b by Escherichia coli Nissle The DNA of 1917 (abbreviated as EcN) was used as a template, and the homology arm sequence was amplified with primers 1917 attB-F / 1917 attB-R. The amplification conditions were: 94℃ 5min, 30 cycles (94℃ 30sec, 55℃ 30sec, 68℃ 30sec), and 10℃ extension. The amplified product was added with A-linked pUX-T vector and transformed into E. coli DH5α competent cells were coated on Amp resistance plates, and the cloned colony 1917 attB-T was identified by PCR. The identification results were as follows Figure 1 As shown; according to the identification results, the colonies containing the constructed vector were selected, and their DNA was used as a template. PCR amplification was performed with primers attB-tnf2b-F / attB-tnf2b-R. The amplification conditions were: 94℃ 5min, 2 cycles (94℃ 30sec, 55℃ 30sec, 68℃ 2min), and 10℃ extension; then, the gene synthesis plasmid was used as a template, and the INFα-2b encoding gene fragment was amplified with primers tnf2b-attb-F / tnf2b-attb-R. The amplification conditions were: 94℃ 5min, 32 cycles (94℃ 30sec, 55℃ 30sec, 68℃ 30sec), and 10℃ extension; then, the engineered bacteria were seamlessly cloned and identified by PCR. The identification results are shown as follows Figure 2 As shown; finally, repair homology arm amplification was performed and CrispR editing was performed to obtain an engineered bacterium expressing interferon α-2b (EcN-IFN-α2b).
[0045] Among them, the nucleotide sequence of 1917 attB-F is CAGTCGGCAGGGCTCATGCCAC (SEQ ID No.1), and the nucleotide sequence of 1917 attB-R is GGTTTGGCTCTGGTCTGGTAGC (SEQ ID No.2); the nucleotide sequence of attB-tnf2b-F is CTCAAAAGAATAAatactaacttgagcgaaacgggaag (SEQ ID No.3), and the nucleotide sequence of attB-tnf2b-R is cgatgattaattgtcaaaaaagcaggcttcaacggattc (SEQ ID No.4); the nucleotide sequence of tnf2b-attB-F is gaagcctgcttttttgacaattaatcatcggctcgt (SEQ ID No.5), and the nucleotide sequence of tnf2b-attB-R is tttcgctcaagttagtatTTATTCTTTTGAGCGCAGTG (SEQ ID No.6).
[0046] The sequencing results of EcN-IFN-α2b are as follows:
[0047] Among them, the IFN-α2b coding gene sequence was inserted into the sequence near the attB site of EcN. The nucleotide sequence of the IFN-α2b coding gene is: GATCTGCCGCAGACGCACAGCCTGGGTAGCCGTCGTACCCTGATGCTGCTGGCGCAGATGCGTCGTATCAGCCTGTTTAGCTGTCTGAAAGATCGTCATGATTTTGGCTTCCCGCAGGAAGAAT TCGGTAACCAGTTTCAGAAAGCGGAAACATTCCGGTTCTGCATGAAATGATTCAGCAGATTCTTTAACCTGTTCTCGACGAAAGATAGCAGCGCGGCGTGGGATGAAACGCTGCTGGATAAATTC TACACGGAACTGTATCAGCAGCTGAATGATCTGGAAGCATGTGTTATCCAGGGTGTTGGCGTGACGGAAACCCCGCTGATGAAAGAAGACTCGATCCTGGCGGTTCGCAAATACTTCCAGCGCAT TACGCTGTACCTGAAAGAAAAAAAATACTCGCCGTGTGCGTGGGAAGTGGTTCGTGCCGAAATCATGCGCTCATTTTCGCTGAGCACGAATCTGCAGGAATCACTGCGCTCAAAAGAATAA (SEQ ID No.8).
[0048] Example 2: Detection of properties of EcN-IFN-α2b (1) Growth performance The EcN and EcN-IFN-α2b strains were activated, and 1 mL of each was inoculated into 100 mL of LB liquid medium. The culture was anaerobically cultured at 37°C, and the optical density (OD) at a wavelength of 600 nm was measured at 0, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 h. 600 ); Draw a growth curve with time as the horizontal axis and optical density as the vertical axis.
[0049] like Figure 3 As shown in Figure 2, in terms of growth performance, EcN-IFN-α2b showed a faster growth rate than EcN in the first 8 hours. However, both strains entered the stationary phase at 24 hours, with an OD 600 The values are 2.080 and 2.067, respectively, showing a high similarity.
[0050] (2) Acid resistance EcN and EcN-IFN-α2b were cultured in LB liquid medium in an anaerobic incubator at 37°C overnight, and 100 μL was taken out and diluted 10 times with PBS buffer. 1 , 10 3 , 10 5 times, centrifuge at 4000 rpm for 3 min and discard the supernatant; add PBS buffer with pH = 2, 3, 4, 5, 6, and 7 respectively, let it stand for 4 h, mix well, take 10 μL to spread on the plate, culture in an anaerobic incubator at 37°C for 48 h, and count the viable bacteria.
[0051] like Figure 4 As shown, EcN-IFN-α2b and EcN have different degrees of tolerance in the pH range of 2.0-7.0; and at pH=7.0, the counts of both strains reached 9.244 CFU / mL.
[0052] (3) Antioxidant activity EcN and EcN-IFN-α2b were cultured in LB liquid medium, respectively. The cells were precipitated by centrifugation at 10,000 rpm for 10 min, and the supernatant was aspirated and stored in a refrigerator for later use.
[0053] (3.1) Determination of DPPH free radical scavenging ability Take 2 mL of bacterial culture supernatant, add 2 mL of DPPH methanol solution (0.2 mmol / L) and 2 mL of deionized water, react at room temperature in the dark for 30 min, take the supernatant and measure the OD at 517 nm; the experimental grouping and the calculation formula of DPPH free radical scavenging rate are as follows: A empty = 2 mL deionized water + 2 mL DPPH methanol solution; A1 = 2 mL bacterial culture supernatant + 2 mL DPPH methanol solution; A2 = 2 mL bacterial culture supernatant + 2 mL deionized water; DPPH free radical scavenging rate = [Aspace-(A1-A2) / Aspace] × 100%.
[0054] (3.2) Determination of hydroxyl radical scavenging ability In a test tube, add 1 mL of 2 mmol / L FeSO4 solution, 1 mL of 6 mmol / L H2O2, and 1 mL of bacterial culture supernatant in turn, let stand for 10 minutes, add 2 mL of 6 mmol / L salicylic acid, let stand for 30 minutes at room temperature, and measure the absorbance at 510 nm; the experimental grouping and the calculation formula for the scavenging rate of hydroxyl free radicals are as follows: A blank = blank solvent (1 mL of FeSO4 solution, 1 mL of H2O2) + 2 mL of salicylic acid; A1 = 1 mL of bacterial culture supernatant + 2 mL of salicylic acid; A2 = 1 mL of bacterial culture supernatant + blank solvent (1 mL of FeSO4 solution, 1 mL of H2O2); Hydroxyl radical scavenging rate = [Aspace-(A1-A2) / Aspace] × 100%.
[0055] (3.3) Determination of superoxide radical scavenging ability Add 2 mL of 150 mmol / L Tris-HCl solution (pH=8.0) and 1 mL of 1.2 mmol / L pyrogallol solution to 0.5 mL of bacterial culture solution, shake well, and measure the absorbance at 330 nm. Measure the absorbance every 30 seconds until 150 seconds, and calculate the rate: A0: The absorbance value of pyrogallol self-oxidation every 30 seconds is fitted into a straight line, and its slope is taken to obtain the self-oxidation rate; A1: The oxidation rate is obtained by fitting a straight line with the absorbance value of the mixed reaction solution of pyrogallol and bacterial supernatant every 30 seconds and taking its slope; Superoxide radical scavenging rate = (A0-A1) / A0×100%.
[0056] (3.4) Fe 2+ Determination of the chelating capacity Add 0.1 mL of 0.4% ferrous sulfate solution to 0.5 mL of bacterial culture medium, gently invert and mix, then add 0.1 mL of 1% VC and 1 mL of 0.2 mol / L NaOH solution, react at room temperature for 20 min, then add 1 ml of 10% trichloroacetic acid, centrifuge at 6000 rpm at 4°C for 10 min to remove protein, take 0.4 mL of the above solution and add 4 mL of 0.1% o-phenanthroline, react at room temperature for 10 min, and measure the absorbance at 536 nm: A0: absorbance after replacing the bacterial culture medium in the reaction system with 0.5 mL of deionized water; A1: absorbance of 0.5mL sample solution after reaction; A2: absorbance after 0.1 mL of deionized water replaced the ferrous sulfate solution in the reaction system; Fe 2+ The chelating capacity = [A0-(A1-A2)] / A0×100%.
[0057] like Figure 5As shown, the results of antioxidant experiments showed that EcN-IFN-α2b and EcN could scavenge 78.100% and 89.166% of DPPH free radicals, 67.600% and 58.633% of hydroxyl radicals, 31.800% and 35.266% of superoxide anions, and 24.866% and 22.733% of iron ions, respectively, showing significant antioxidant potential.
[0058] (4) Antibacterial properties EcN and EcN-IFN-α2b were inoculated into LB liquid culture medium, cultured in an anaerobic incubator at 37°C for 48 hours, and centrifuged at 6000 rpm for 10 minutes before removing the supernatant. Escherichia coli O157, Gardnerella vaginalis ATCC14018, and Staphylococcus aureus Cowan 1 were spread on LB solid culture medium, respectively. An Oxford cup was gently placed on the plate, and 250 μL of bacterial culture supernatant was pipetted into the Oxford cup (two replicates were made for each group). The culture was maintained at a constant temperature of 37°C, and the size of the inhibition zone was observed every 2 hours. The diameter of the inhibition zone was measured after 8 hours.
[0059] like Figure 6 As shown, both strains showed mild antibacterial activity, with inhibition zone diameters ranging from 8 to 11 mm.
[0060] Example 3: EcN-IFN-α2b is used to treat HPV-positive NSG mice like Figure 7 As shown, 50 NOD.Cg-PrkdcscidIL2rgtm1Wjl / SzJ female mice (NSG mice) aged 6-8 weeks and weighing 22-25 g were selected and raised in a specific pathogen-free (SPF) laboratory animal center. The NSG mice were divided into 5 groups, with 10 mice in each group, specifically: a. Blank group (Group C): 100 μL sterile PBS was administered into the vagina of mice once a day for 7 days; b. Model group (M group): 1×10 human PBMCs were injected into the peritoneal cavity of mice. 6 / 100 μL was injected once for immune reconstruction, and 20 μL of vaginal secretion suspension from human HPV16-positive patients was transplanted into the vagina once. After the model was evaluated, 100 μL of sterile PBS was administered to the vaginal opening of the successfully modeled mice once a day for 7 days. c. Recombinant human interferon α-2b group (IFN-α2b group): Based on the model group, 100 μL of interferon α-2b drug (concentration of 1.5×10 8 IU / kg) was administered to the mice vaginally, once a day, for 7 days; d. Escherichia coli treatment group (EcN group): Based on the model group, 100 μL of the E. coli was added with a concentration of 5×10 9 CFU / mL EcN was administered to the mice vaginally once a day for 7 days; e. Engineered bacteria treatment group (EcN-IFN-α2b group): Based on the model group, 100 μL of the engineered bacteria was 5×10 9 CFU / mL of EcN-IFN-α2b was administered into the vaginal opening of mice once a day for 7 days.
[0061] Among them, immune reconstruction mainly uses intraperitoneal injection of PBMC to rebuild the immune system. The specific steps are as follows: ① Add an appropriate amount of lymphocyte separation solution into the centrifuge tube; ② Take the anticoagulated blood and an equal amount of Hank's solution or balanced salt solution and mix them thoroughly. Use a dropper to slowly superimpose them on the stratified liquid surface along the wall. Pay attention to keeping the interface between the two liquid surfaces clear. Centrifuge horizontally at 2000 rpm and 20 min. ③After centrifugation, the liquid in the tube is divided into three layers. The upper layer is plasma and Hank's solution; the lower layer is mainly red blood cells and granulocytes; the middle layer is lymphocyte separation fluid. There is a narrow band of white cloud layer at the surface of the upper and middle layers, which is the mononuclear cells (PBMC) and platelets rich in lymphocytes and monocytes; ④ Aspirate the top layer of plasma, collect the mononuclear cells at the interface between the plasma layer and the lymphocyte separation fluid, try to aspirate all the PBMCs, and transfer them to a new centrifuge tube; ⑤ Add Hank's solution or serum-free culture medium, mix well, centrifuge at 200×g for 10 min, and discard the supernatant (low-speed centrifugation is beneficial for removing platelets retained in the cell suspension); ⑥ Wash the cells twice with the same washing solution, centrifuge at 500×g for 10 min each time to wash away the residual lymphocyte separation solution, and then adjust the cells to 1×10 7 / 100 μL concentration; ⑦ Use a 1mL syringe to inject 100 μL of PBMC suspension into the tail vein of mice in the experimental group.
[0062] The physical condition of the mice was monitored daily, and the general characteristics of the mice were observed and recorded once a week, that is, the mental state, activity, reaction, diet, weight, coat color, and whether there was rash, diarrhea, gait change, etc. of the mice were observed every day.
[0063] After implantation of human PBMC, 3 mice were anesthetized each week, and peripheral blood was collected from the retro-orbital venous plexus of the mice. Blood cells and plasma were routinely separated after heparin anticoagulation, and liver and spleen tissues of the mice were collected by puncture using a homemade puncture needle. Human CD3 in the peripheral blood of the mice was detected by flow cytometry. + T, CD19 + B.CD56 + NK cells were detected by immunohistochemistry in the liver and spleen of mice. + T, CD19 + B.CD56 + The NK cell status was determined by ELISA, and the IgG content in the mouse serum was detected. HE staining was used to observe the vaginal epithelial cell lesions after HPV16 virus infection; the expression of E6 / E7 protein by HPV16 virus was detected by immunohistochemistry to observe the HPV virus colonization in the vagina; RT-qPCR was used to detect the expression of E6 / E7 gene of HPV16 virus in vaginal tissue to determine the virus load.
[0064] During days 6-7, a small number of mice were euthanized (ZM group) for model evaluation. Figure 8 As shown in Figure 2, RT-qPCR analysis showed that the expression of HPV16 E6 gene in the ZM group was significantly higher than that in the blank group (C group), reaching 6 times, thus confirming the successful colonization of HPV virus in NSG mice. Fig. 9 As shown, immunohistochemistry experiments showed that there was no significant difference in the positive rates of CD3, CD19 and CD56 cells in the spleen of mice in the ZM group compared with those in the C group.
[0065] In order to clarify the effect of EcN-IFN-α2b on virus clearance after 7 days of intervention, RT-qPCR technology was used to detect the viral load in the mouse vagina. Fig.10 As shown in the figure, both EcN-IFN-α2b and IFN-α2b treatment significantly reduced the positive rate of HPV virus in the vagina. RT-qPCR data also supported this finding, showing that the expression level of HPV16 E6 gene in the EcN-IFN-α2b and IFN-α2b treatment groups was significantly reduced compared with the untreated group (M group) (p<0.01), while no significant difference was observed in the group that only received EcN intervention. Fig.11 As shown, the results of spleen immune function showed that the numbers of CD3, CD19, and CD56 positive cells in the spleen tissue of mice in group C were increased compared with those in other groups.
[0066] In order to explore whether EcN-IFN-α2b can eliminate HPV by regulating the JAK-STAT signaling pathway, the expression levels of key proteins were detected by Western Blot. Figure 12-13As shown in the figure, compared with group C, the expression levels of p-STAT1 / STAT1, p-STAT2 / STAT2 and IRF9 in group M were significantly decreased. However, after intervention with IFN-α2b, EcN and EcN-IFN-α2b, the expression levels of p-STAT1 / STAT1, p-STAT2 / STAT2 and IRF9 were upregulated to varying degrees, especially in the IFN-α2b group, which confirmed that EcN-IFN-α2b may have the ability to activate the JAK-STAT signaling pathway. Moreover, Figure 14-15 As shown in the figure, compared with group C, the expression levels of cGAS, STING, p-TBK1 / TBK1, and p-IRF3 / IRF3 in group M were significantly downregulated. The intervention of EcN-IFN-α2b effectively reversed the downregulation trend of the expression levels of cGAS, STING, p-TBK1 / TBK1, and p-IRF3 / IRF3. EcN-IFN-α2b may exert its potential to clear HPV by activating the JAK / STAT / cGAS / STING signaling pathway.
[0067] To investigate the effect of EcN-IFN-α2b on alleviating vaginitis via IFN-α2b secretion, the inflammatory status was evaluated. Fig.16 As shown, RT-qPCR analysis results showed that the mRNA transcription levels of key inflammatory factors (IL-1β, IL-6, and TNF-α) in group M were significantly upregulated compared with group C, indicating a strong inflammatory response. It is worth noting that both IFN-α2b and EcN-IFN-α2b alone significantly reduced the expression of these inflammatory factors, indicating their effectiveness in alleviating the inflammatory response triggered by HPV infection, emphasizing the potential of EcN-IFN-α2b in regulating the inflammatory response during HPV infection.
[0068] In order to study the effect of EcN-IFN-α2b on the composition of vaginal flora in the HPV-infected mouse model, the microbial community in vaginal secretion samples was comprehensively analyzed using 16S rDNA high-throughput sequencing. 200 µL of sterile saline was taken with a micropipette, and the mouse vagina was repeatedly rinsed 3-5 times. The mouse vaginal secretions were collected and placed in a 1 mL centrifuge tube and LB medium containing 15% glycerol was added until the centrifuge tube was full. Vaginal flora DNA was extracted according to the instructions of the Solebo Bacterial Genomic DNA Extraction Kit and sent to Shanghai Paisono Biotechnology Co., Ltd. for high-throughput sequencing. The V4 region of the 16S rDNA gene was amplified using genomic DNA as a template and 515F / 806R as primers; the nucleotide sequence of 515F is 5'-GCACCTAAYTGGGYDTAAAGNG-3' (SEQ ID No.9), and the nucleotide sequence of 806R is 5'-TACNVGGGTATCTAATCC-3' (SEQ ID No.10). The PCR products were sequenced using an Illumina HiSeq 2000 sequencer, and the results were processed using UPARSE software. Based on the above valid sequencing data, α diversity (OTUs, Shannon and Simpson) and β diversity (principal component analysis, principal coordinate analysis, and non-metric multidimensional scaling analysis) were analyzed using QIIME software, and SIMCA-P software was used to identify different abundant taxa, perform cluster analysis, and perform partial least squares discriminant analysis.
[0069] like Fig.17 As shown in Figure 2, at the same sequencing depth, there are significant differences in the data between different groups, indicating that there are substantial differences between most sequences. Fig.18 As shown in Figure 2, the Chao1 index of group M was lower than that of group C, but it increased after treatment with EcN-IFN-α2b. In addition, there was no significant difference in the Simpson index among the groups. Fig.19 As shown in the figure, all groups shared 104 operational taxonomic units (OTUs), but the number of unique OTUs varied significantly, with 2375 in group C, 780 in group M, 1021 in group IFN-α2b, 750 in group EcN, and 1120 in group EcN-IFN-α2b, reflecting the different effects of different treatment interventions on the composition of the vaginal microbiota. Fig. 20 As shown in Figure 2, principal coordinate analysis (PCoA) showed that the β-diversity of each group was closely consistent with no significant difference. Fig.21 As shown, LEFSe analysis highlighted that only groups C, M, and EcN-IFN-α2b had unique microbial communities.
[0070] like Fig. 22As shown in Figure 2, at the phylum level, Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes are the three most common dominant bacterial phyla in all groups. Fig.23 As shown, the relative abundance of Proteobacteria increased, while the relative abundance of Firmicutes, Actinobacteria, and Bacteroidetes decreased in group M compared with group C.
[0071] like Fig.24 and Fig.25 As shown in the detailed examination at the genus level, the abundance of pathogenic bacteria such as Vibrionaceae_Vibrio, Streptococcus, and Staphylococcaceae_Staphylococcus was found to be significantly increased in the M group, while IFN-α2b, EcN, and EcN-IFN-α2b treatments reduced the relative abundance of these pathogens to varying degrees. In addition, the relative abundance of Lactobacillus, a common beneficial vaginal bacterium, decreased significantly in the M group, but EcN-IFN-α2b effectively increased its abundance.
[0072] The above is only a preferred embodiment of the present invention. The present invention is not limited to the above implementation. As long as the technical effect of the present invention is achieved by the same or equivalent means, it should belong to the protection scope of the present invention. Within the protection scope of the present invention, its technical scheme and / or implementation method can have various modifications and changes.
Claims
1. An engineered bacterium expressing interferon α-2b, characterized in that: Through Escherichia coli Nissle It was obtained through genetic engineering in 1917 and contains the coding gene of INFα-2b.
2. The engineered bacteria expressing interferon α-2b according to claim 1, characterized in that: The nucleotide sequence of the gene encoding INFα-2b is shown in SEQ ID No.
8.
3. Use of the engineered bacteria expressing interferon α-2b according to claim 1 in the preparation of a preparation for treating vaginal inflammation.
4. The use according to claim 3, characterized in that: The vaginal inflammation is vaginal inflammation caused by HPV infection.
5. The use according to claim 3, characterized in that: The preparation for treating vaginal inflammation is administered vaginally.
6. A preparation for treating vaginal inflammation, characterized in that: Contains the engineered bacteria expressing interferon α-2b as claimed in claim 1.
7. The preparation for treating vaginal inflammation according to claim 6, characterized in that: The dosage form of the preparation for treating vaginal inflammation is a solution.
8. The preparation for treating vaginal inflammation according to claim 7, characterized in that: The solvent of the solution is water or physiological saline.
9. The preparation for treating vaginal inflammation according to claim 6, characterized in that: The concentration of the engineered bacteria expressing interferon α-2b in the preparation for treating vaginal inflammation is 1×10 9 CFU / mL-10×10 9 CFU / mL.
10. The preparation for treating vaginal inflammation according to claim 9, characterized in that: The concentration of the engineered bacteria expressing interferon α-2b in the preparation for treating vaginal inflammation is 5×10 9 CFU / mL.