siRNA targeting and inhibiting chicken PRKCD expression and its application

Abstract

The invention belongs to the technical field of molecular biology, and discloses a siRNA for targeted inhibition of chicken PRKCD expression and an application thereof. The siRNA comprises PRKCD-339, which is an siRNA capable of targeted inhibition of chicken PRKCD gene expression. After the siRNA is transferred into chicken primary myoblasts, the expression of the chicken PRKCD gene can be effectively reduced, and the inhibition efficiency is more than 50%, and the knockdown efficiency is very high. The siRNA identifies the gene function by specifically knocking down the expression of the chicken PRKCD gene in vitro, and can be used as a molecular marker in the genetic breeding of high-quality broiler muscle development, and has great economic value and scientific research value.

Description

Technical Field

[0001] The invention belongs to the technical field of poultry breeding, and particularly relates to siRNA for targeted inhibition of chicken PRKCD expression and application thereof. Background Art

[0002] Protein Kinase C (PKC) is a family of serine and threonine-specific protein kinases. PKCδ is a 78 kDa protein with 676 residues, known as a novel PKCs. It is a protein encoded by the protein kinase Cδ (PRKCD) gene located at 3p21.1 on chromosome 3. It has catalytic and regulatory hinge domains and many phosphorylation sites that adapt to its enzymatic activity, allowing PKCδ to play a role in multiple signaling pathways. Studies have shown that PRKCD plays a role in the survival, programmed cell death, and cytokine release of lymphocytes, B cells, T cells, macrophages, neutrophils, and NK cells. These findings emphasize the importance of PRKCD in maintaining immune homeostasis in adaptive and innate immunity. In poultry, PRKCD has been rarely studied and there are no reports in the prior art on knocking down the expression of the chicken PRKCD gene using siRNA. Therefore, using exogenous siRNA to specifically knock down the expression of the chicken PRKCD gene and determine the role of the PRKCD gene in the development of chicken pectoral muscle can be used as a molecular marker in the genetic breeding of high-quality broiler pectoral muscle development, accelerate breeding progress, and shorten the generation interval, which has great economic and scientific research value. Summary of the invention

[0003] The purpose of the present invention is to solve the deficiencies in the prior art and provide a siRNA for inhibiting the expression of chicken PRKCD and its application. After being transferred into chicken primary myoblasts, the expression of chicken PRKCD gene can be effectively reduced, and the inhibition efficiency is more than 50%, and the knockdown efficiency is very high.

[0004] In order to achieve the above object, the present invention is achieved through the following technical solutions:

[0005] In a first aspect, the present invention provides a siRNA for inhibiting the expression of chicken PRKCD, wherein the siRNA comprises PRKCD-534, PRKCD-339, PRKCD-1772,

[0006] The sequence of the PRKCD-534 sense strand is UUACUGUUCCCUCUUCUUCCCTT, and the sequence of the antisense strand is GAAGAAGAGGGAACAGUAACUTT, and each siRNA sequence is suffixed with a TT base overhang;

[0007] The sequence of the PRKCD-339 sense strand is GCGUGAUUCAGAUUGUUCUTT, and the sequence of the antisense strand is AGAACAAUCUGAAUCACGCTT, and each siRNA sequence is suffixed with a TT base overhang;

[0008] The sequence of the PRKCD-1772 sense strand is AGAGAAUGUGUACUUCAAGCC, and the sequence of the antisense strand is CUUGAAGUACACAUUCUCUGUTT, and each siRNA sequence is suffixed with a TT base overhang;

[0009] In a second aspect, the present invention provides the use of the siRNA that targets and inhibits the expression of chicken PRKCD in promoting the proliferation of chicken primary myoblasts and inhibiting the genetic breeding of chicken pectoral muscle development.

[0010] The application is specifically as follows: designing siRNA for PRKCD expression, transfecting the siRNA into primary chicken myoblasts, and utilizing the exogenous siRNA to specifically knock down the expression of the chicken PRKCD gene.

[0011] Furthermore, 125ul of DEPC water was added to dilute every 1OD of synthesized siRNA to a final concentration of 20uM / ul and stored at -20°C until use.

[0012] Furthermore, the specific steps of transfecting chicken primary myoblasts with siRNA are as follows:

[0013] The primary chicken myoblasts isolated from the breast muscle tissue of 13-embryonic-age chickens were used as transfected cells. The isolated primary chicken myoblasts were inoculated into a 12-well culture plate. When the cell density grew to 60%, the original culture medium in the culture dish was aspirated and replaced with fresh serum-free culture medium. The siRNA was transfected into the primary chicken myoblasts with the help of the transfection reagent Lipofectamine3000.

[0014] The specific transfection system is as follows: 180uL opti-MEM culture medium + 5ul siRNA with a final concentration of 20uM + 8ul Hiperfect transfection; incubate for 9 minutes to form a transfection complex, and transfect into the culture medium.

[0015] The present invention has the following beneficial effects: provides a siRNA capable of targeting and inhibiting the expression of the chicken PRKCD gene, which can effectively reduce the expression of the chicken PRKCD gene after being transferred into chicken primary myoblasts, with an inhibition efficiency of more than 50%, and a high knockdown efficiency. The siRNA of the present invention identifies the gene function by specifically knocking down the expression of the chicken PRKCD gene in vitro, and can be used as a molecular marker in the genetic breeding of high-quality broiler breast muscle development, accelerates breeding progress, shortens the generation interval, and has great economic value and scientific research value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The expression of PRKCD in breast muscle tissue of different strains of chickens (different letters represent significant differences (P < 0.05), the same letters represent insignificant differences (P > 0.05); ** represents significant differences (P < 0.01)); S3, H, and F analysis represent S3 strain chickens, H strain chickens, and F strain chickens;

[0017] Figure 2 is the expression of PRKCD in chicken myoblasts (different letters indicate significant differences (P<0.05));

[0018] Figure 3 The expression changes of PRKCD gene after exogenous transfection of PRKCD siRNA (different letters represent significant differences (P < 0.05), and the same letters represent no significant differences (P > 0.05));

[0019] Figure 4 The proliferation changes of chicken myoblasts after exogenous transfection of PRKCD siRNA (* indicates significant difference (P<0.05));

[0020] Figure 5 The expression changes of myoblast differentiation marker genes after exogenous transfection of PRKCD siRNA. DETAILED DESCRIPTION

[0021] The present invention is further described and defined by the following examples but is not limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified. The present invention is further described below in conjunction with the accompanying drawings.

[0022] Example 1 Detection of PRKCD gene expression in chicken breast muscle tissue by fluorescence quantitative PCR

[0023] 1.1 Expression of PRKCD in pectoral muscle tissue

[0024] QPCR technology was used to detect the expression of PRKCD in breast muscle tissue of different strains of chickens at different developmental stages. Figure 1As shown, there are significant breed and developmental differences in the expression level of PRKCD in the pectoral muscle tissue of different strains at different developmental stages, indicating that PRKCD is involved in the developmental regulation of chicken pectoral muscle.

[0025] 1.2 Expression of PRKCD in myoblasts

[0026] QPCR technology was used to detect the expression of PRKCD in the proliferation and differentiation stages of myoblasts. Figure 2 As shown, the expression of PRKCD in myoblast proliferation stage is higher than that in differentiation stage, and the expression level of 50% in proliferation stage is the highest and significantly higher than that in each differentiation stage (P<0.01). This preliminarily indicates that PRKCD may have the effect of inhibiting the development of chicken breast muscle.

[0027] Example 2 Screening of the best siRNA sequence targeting chicken PRKCD gene

[0028] 2.1 PRKCD siRNA design

[0029] According to the NCBI online database, the mRNA sequence information of the chicken PRKCD gene was obtained (accession number: NM_001006133.2), and si Catch TM siRNA design software was used to design 3 pairs of siRNAs targeting the CDS region of the chicken PRKCD gene, and each siRNA sequence was suffixed with a TT base overhang. The designed siRNA was synthesized by Suzhou Jima Biotechnology Co., Ltd. After synthesis, each 1OD of siRNA was diluted with 125ul of DEPC water, and the final concentration was 20uM / ul, and stored at -20°C for use. The sequences of the 3 pairs of siRNAs designed are shown in Table 1.

[0030] Table 1 Three pairs of siRNA sequences

[0031]

[0032] 2.2siRNA transfection of primary chicken myoblasts

[0033] Chicken primary myoblasts isolated and extracted from 13-embryonic chicken breast muscle tissue were used as transfected cells. The isolated and extracted chicken primary myoblasts were inoculated into a 12-well culture plate. When the cell density grew to 60%, the original culture medium in the culture dish was aspirated and replaced with fresh serum-free culture medium. Three pairs of siRNAs targeting the chicken PRKCD gene and negative control siRNA (NC) were transfected into the chicken myoblasts with the help of transfection reagent Lipofectamine3000, and 3 replicate wells were set up in each group.

[0034] The specific transfection system is as follows: experimental group: 180uL opti-MEM culture medium + 5ul final concentration of 20uM siRNA + 8ul Hiperfect transfection; control group: 180uL opti-MEM culture medium + 5ul final concentration of 20uMNegative + 8ul Hiperfect transfection, incubate for 9 minutes to form a transfection complex, and transfect into the culture medium.

[0035] 2.3 RNA extraction and cDNA preparation

[0036] After 24 hours of transfection, each well was washed 3 times with PBS, and 0.6 ml of TROZL was added to the culture dish to collect the cells. The RNA isolater Total RNA Extraction Reagent of Nanjing Novozyme Biotechnology Co., Ltd. was used to extract the total RNA of the cells in the PRKCD siRNA transfected group and the control group. The RNA concentration was determined by a nucleic acid quantifier. cDNA synthesis was performed according to the instructions of the reverse transcription kit of Dalian Bao Bioengineering Co., Ltd.

[0037] 2.4 Real-time fluorescence quantitative PCR detection of siRNA interference efficiency

[0038] Hi ScriptⅢRT Super Mix for q PCR (+g DNA wiper) reagent from Nanjing Novozyme Biotechnology Co., Ltd. was selected, and the SYBR Green Ι method was used for real-time fluorescence quantitative PCR to detect the efficiency of siRNA specific interference with chicken PRKCD gene expression, with 3 replicates for each sample. Q-PCR reaction program: 95℃15min; 40 cycles (94℃15s, 55℃30s, 70℃30s).

[0039] The primer sequences for PRKCD gene fluorescence quantitative PCR are as follows

[0040] Upstream primer (SEQ ID NO:7): 5'-CACACCTCACTACCCACGATG-3'

[0041] Downstream primer (SEQ ID NO: 8): 5'-CTCTTCTCTAGGGTCGTCCA-3'

[0042] The nucleic acid sequence of the internal reference gene GAPDH primer is as follows:

[0043] Upstream primer (SEQ ID NO:9): 5'-AGAAGGCTGGGGCTCATCT-3'

[0044] Downstream primer (SEQ ID NO: 10): 5'-CAATGCCAAAGTTGTCATG-3'

[0045] The efficiency of 3 pairs of siRNA in specifically knocking down the expression of chicken PRKCD gene is as follows Figure 3 As shown. Figure 3 It can be seen that compared with the control group, among the three pairs of siRNA, PRKCD-339 siRNA can significantly inhibit the expression of PRKCD gene in cells (P<0.05), with the best interference efficiency, and the inhibition efficiency is more than 50%. In subsequent experiments, PRKCD-339 was selected to study the function of PRKCD gene in chicken breast muscle development. The sense strand of PRKCD-339 is GCGUGAUUCAGAUUGUUCUTT, and the antisense strand is AGAACAAUCUGAAUCACGCTT.

[0046] 2.5 Effects of PRKCD gene knockdown on cell proliferation and myoblast differentiation marker gene expression

[0047] After 24h and 72h of PRKCD-339 siRNA transfection, the CCK8 kit was used to detect the changes in cell proliferation. Figure 4 As shown in the figure, after transfection with PRKCD-853 siRNA, the proliferation of chicken primary myoblasts increased significantly (P<0.05). After 4 days of transfection, QPCR was used to detect the expression changes of myoblast differentiation marker genes Myod and Myog. Compared with the control group, the expression of Myod and Myog genes in the siRNA2 transfection group was extremely significantly reduced (P<0.01). Figure 5 The experiment proved that the PRKCD gene has the effect of promoting the proliferation of chicken primary myoblasts and inhibiting the development of chicken breast muscle.

[0048] The above description is only a preferred embodiment of the present invention, but is not intended to limit the present invention. Those skilled in the art may make possible changes and modifications to the present invention using the technical contents disclosed above without departing from the scope of the technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

1. A siRNA targeting and inhibiting the expression of chicken PRKCD, characterized in that: The siRNA is PRKCD-339, The sequence of the positive strand of PRKCD-339 is GCGUGAUUCAGAUUGUUCUTT, and the sequence of the antisense strand is AGAACAAUCUGAAUCACGCTT.

2. Use of the siRNA targeting and inhibiting the expression of chicken PRKCD according to claim 1 in genetic breeding for promoting the proliferation of chicken primary myoblasts and inhibiting the development of chicken pectoral muscle.

Images