Application of c-terminal motif of rice d3 protein and its biomaterial in regulating rice tillering

By regulating the C-terminal motif of the rice D3 protein, the shortcomings in the regulation of rice tiller growth and development were addressed, thereby achieving the regulation of the number of rice tillers and increasing rice yield.

CN119286909BActive Publication Date: 2026-02-03INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411476656.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-22
Publication Date
2026-02-03
Estimated Expiration
2044-10-22

AI Technical Summary

Technical Problem

Current technology has limited understanding of the regulatory mechanism of rice tiller growth and development, making it difficult to increase yield by controlling the number of rice tillers.

Method used

By utilizing the C-terminal motif (CTH motif) of the rice D3 protein and related biological materials, the number of rice tillers can be enhanced or inhibited by regulating the expression or activity of the OsD3 gene, including the use of amino acid sequence mutations, fusion proteins, RNA molecules, recombinant vectors, and transgenic technologies.

Benefits of technology

By regulating the number of rice tillers, rice yield was increased, demonstrating the ability of the D3 CTH motif to fine-tune the strigolactone signal in rice, and its potential for increasing yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119286909B_ABST
    Figure CN119286909B_ABST
Patent Text Reader

Abstract

The application discloses a C-terminal motif of rice D3 protein and application of a biomaterial thereof in regulating rice tillering, and belongs to the technical field of biotechnology.The application comprises application of a CTH motif of the rice D3 protein in regulating the number of rice tillers or preparing a product for regulating the number of rice tillers and / or rice breeding.The application shows that the CTH motif of D3 is very important for interaction between D3 and D14 in the rice body, and the number of rice tillers can be increased by deleting the CTH motif by using a CRISPR genome editing technology.The application has the advantages that overexpression of the CTH motif of D3 can fine-tune reception of a strigolactone signal in the rice and moderately increase the number of rice tillers, and has certain yield-increasing potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the C-terminal motif of rice D3 protein and its application in regulating rice tillering. Background Technology

[0002] Rice is one of the most important crops, and the ever-increasing global population places increasingly higher demands on rice production. Despite decades of effort by breeders, rice yields have significantly improved, but they still cannot meet the total demand for food. Rice plant type is a key factor determining yield, primarily determined by plant height, number of tillers, tiller angle, and panicle type.

[0003] Tillering is one of the important agronomic traits of rice. The number of tillers per plant is a key element of plant architecture and significantly affects crop yield. In production practice, appropriate cultivation and management measures need to be taken according to the formation and development patterns of tillers to promote effective tillers while suppressing ineffective tillers. Therefore, studying the regulatory mechanisms of rice tiller growth and development has important guiding significance for agricultural production.

[0004] Strigolactones are hormones synthesized in roots that inhibit branching in plants. They have a wide range of functions within plants. Through physiological and genetic studies of a series of dwarf, multi-tillering mutants, several important members of the strigolactone synthesis and signaling pathways have been cloned in various model plants. These mutant members share the common characteristic of losing apical dominance and releasing lateral bud growth and development, thus producing a dwarf, multi-tillering phenotype. However, our understanding of the biosynthetic processes and signal transduction pathways of strigolactones is still very limited, and their functions in plant growth and development require further exploration.

[0005] The OsD3 gene, derived from rice, is a signaling component of the strigolactone pathway. Its main function is to control rice plant architecture, including the number of tillers and plant height. Creating functional mutants of the rice strigolactone receptor using the OsD3 gene to regulate tiller number and improve plant architecture, thereby increasing rice yield, holds great promise for future applications. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide a polypeptide in the OsD3 gene that regulates the number of tillers in rice. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0008] This invention provides the application of the CTH motif of rice D3 protein in regulating the number of rice tillers, preparing products that regulate the number of rice tillers, and / or in rice breeding.

[0009] In the above applications, the CTH motif is any one of the following;

[0010] A1) The amino acid sequence is the polypeptide from positions 693 to 720 of SEQ ID No. 2;

[0011] A2) A polypeptide obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in A1) has more than 80% identity with the protein shown and has the same function.

[0012] A3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of any of the amino acids shown in A1) or A2).

[0013] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0014] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.

[0015] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0016] In the above applications, the regulation refers to upregulating or enhancing or increasing the expression of the gene encoding the aforementioned polypeptide or the content or activity of the polypeptide.

[0017] In the above applications, the regulation refers to downregulating or inhibiting or reducing the expression of the gene encoding the aforementioned protein, or the content or activity of the protein.

[0018] In the above applications, the substance is a biological material, and the biological material is any one of the following:

[0019] B1) RNA molecules that inhibit, reduce, or downregulate the expression of genes encoding the aforementioned proteins, or RNA molecules that inhibit, reduce, or downregulate the activity or content of the aforementioned proteins.

[0020] B2) The gene encoding the RNA molecule described in B1);

[0021] B3), an expression cassette containing the gene described in B2);

[0022] B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3);

[0023] B5) Recombinant microorganisms containing the gene described in B2), or recombinant microorganisms containing the expression cassette described in B3), or recombinant microorganisms containing the recombinant vector described in B4);

[0024] B6) A transgenic plant cell line containing the gene described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4);

[0025] B7) Transgenic plant tissue containing the gene described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4);

[0026] B8) Transgenic plant organs containing the gene described in B2), or transgenic plant organs containing the expression cassette described in B3), or transgenic plant organs containing the recombinant vector described in B4);

[0027] B9) Nucleic acid molecules that encode the aforementioned proteins;

[0028] B10), an expression cassette containing the nucleic acid molecule described in B9);

[0029] B11) A recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10); B12) A recombinant microorganism containing the nucleic acid molecule described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B3);

[0030] B13), a transgenic plant cell line containing the nucleic acid molecule described in B9), or a transgenic plant cell line containing the expression cassette described in B10;

[0031] B14) transgenic plant tissue containing the nucleic acid molecules described in B9), or transgenic plant tissue containing the expression cassette described in B10;

[0032] B15), transgenic plant organs containing the nucleic acid molecules described in B9), or transgenic plant organs containing the expression cassette described in B10).

[0033] In the above application, the RNA molecule described in B1) targets the gene encoding the protein.

[0034] In the above applications, the gene encoding the protein is the wild-type genome sequence of the OsD3 gene, and B1) the RNA molecule targets nucleotides 2158-2177, 2209-2228, or 2233-2252 of the wild-type genome sequence of the OsD3 gene.

[0035] In the above application, the coding sequence of the nucleic acid molecule described in B9) is SEQ ID No. 2.

[0036] The present invention also provides a method for regulating the number of tillers in rice, comprising the following steps: regulating the expression of the encoding gene of the aforementioned protein in the target plant or regulating the activity and / or content of the protein, thereby changing the number of tillers in the target plant.

[0037] The present invention also provides a method for increasing the number of tillers in rice, comprising the following steps: downregulating or inhibiting or reducing the expression of the coding gene of the aforementioned protein in recipient rice, or downregulating or inhibiting or reducing the activity and / or content of the protein, thereby increasing the number of tillers in the recipient rice; wherein the recipient rice contains the coding gene.

[0038] In the above method, the recipient rice can specifically be Nipponbare.

[0039] In the above method, the recipient plant may or may not contain the gene encoding the protein.

[0040] In the above applications or substances, the expression cassette containing nucleic acid molecules described in B3) refers to DNA capable of expressing the RNA molecules described above in host cells. The expression cassette containing nucleic acid molecules described in B10) refers to DNA capable of expressing the proteins described above in host cells. The expression cassette may also include single-stranded or double-stranded nucleic acid molecules containing all the regulatory sequences necessary for expressing the DNA of any of the aforementioned proteins or the RNA molecules. The regulatory sequences, under compatible conditions, can guide the coding sequence to express the DNA of any of the aforementioned proteins or the RNA molecules in suitable host cells. The regulatory sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences must include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for linking the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule, a regulator-linked regulatory sequence may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates the expression of the DNA of the protein or the RNA molecule. The promoter can be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutated, truncated, and heterozygous promoters, and can be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to those of the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell to terminate transcription. The termination sequence is operatively linked to the 3' end of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule. Any terminator that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operatively linked to the 5' end of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule. Any leader sequence that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a signal peptide coding region that encodes an amino acid sequence attached to the amino terminus of a protein, which guides the DNA encoding the protein or the RNA molecule into the cellular secretion pathway. Signal peptide coding regions that guide the DNA of expressed proteins or RNA molecules into the secretory pathway of the host cell can be used in this invention. Adding regulatory sequences that can modulate the expression of protein or RNA molecules according to the growth status of the host cell may also be necessary. Examples of regulatory sequences are systems that respond to chemical or physical stimuli (including in the presence of regulatory compounds) to turn gene expression on or off. Other examples of regulatory sequences are those that enable gene amplification.

[0041] Among the aforementioned substances, the carrier may be a plasmid, a granule, a bacteriophage, or a viral vector.

[0042] Among the aforementioned substances, the microorganisms may be yeast, bacteria, algae, or fungi, such as Agrobacterium.

[0043] The aforementioned substances do not include propagation material in the transgenic plant cell lines.

[0044] The plant mentioned above is any one of the following:

[0045] G1) Monocotyledons;

[0046] G2) Gramineae plants;

[0047] G3) Plants of the genus Oryza;

[0048] G4) Rice plants;

[0049] G5) Rice.

[0050] The aforementioned proteins or substances that regulate the expression of the gene encoding the protein or regulate the activity and / or content of the protein are also within the scope of protection of this invention.

[0051] The advantages of this invention are that it demonstrates the crucial role of the CTH motif of D3 in the interaction between D3 and D14 in rice, and that deleting the CTH motif using CRISPR genome editing technology can increase the number of rice tillers. More importantly, overexpression of the D3 CTH motif can fine-tune the sensing of strigolactones in rice, moderately increasing the number of rice tillers and demonstrating potential for yield enhancement. Attached Figure Description

[0052] Figure 1 For D3 CTH The influence of D14 and D3 amino acid sites on the D14-GR24 complex interaction interface. (A) The D14 and D3 sites used in this study are marked with red and blue arrows, respectively, on D3. CTH –D14–GR24 complex (PDB: 6BRT) interface. (B) Effect of key amino acid site mutations at the D14-D3-CTH interaction interface on the interaction between D3 and D14 in yeast, where D14ΔN represents the deletion of 50 amino acids at the N-terminus of rice D14. H183A This indicates that the 183rd amino acid in the full-length rice D14 variety is mutated from histidine to alanine, while simultaneously losing 50 amino acids at the N-terminus. (D14ΔN) S274A This indicates that the 274th amino acid in the full-length rice D14 variety is mutated from serine to alanine, with a 50-amino acid deletion at the N-terminus. (D14ΔN) S274E This indicates that the 274th amino acid in the full-length rice D14 variety is mutated from histidine to glutamic acid, while simultaneously losing 50 amino acids at the N-terminus. (D14ΔN) A276VThis indicates that the 276th amino acid in the full-length rice D14 protein is mutated from alanine to valine, with a 50-amino acid deletion at the N-terminus. OsSKP1-D3 represents a fusion protein of rice OsSKP1 and D3. E700A This indicates that in the OsSKP1-D3 fusion protein, position 700 of D3 is mutated from glutamic acid to alanine. L707A This indicates that in the OsSKP1-D3 fusion protein, position 707 of D3 is mutated from leucine to alanine.

[0053] Figure 2 D14 S274E The mutation enhanced the ability of rice to sense strigolactone signals. (A) Immunoprecipitation in rice protoplasts revealed D14 S274E –FLAG and D3–GFP interactions in vivo. (B) Rice d14, d14-GFP / d14 and D14 S274E Ubiquitination of D53-HA protein in GFP / d14 callus. (C) Rice Act:D14-GFP / D14 and Act:D14 S274E - Degradation of endogenous D53 protein in GFP / D14 callus. (D) Wild-type Nipponbare rice (WT), d14 mutant, Act:d14-GFP / d14 and Act:D14 S274E -GFP / d14 plant phenotype. (E) Wild-type Nipponbare rice (WT), rice t20 mutant, Act:D14-GFP / t20 and Act:D14 S274A -Phenological and tillering statistics of the GFP / t20 line. Scale bar, 20 cm. Data are mean ± standard deviation.

[0054] Figure 3 Overexpression of the CTH motif of D3 negatively regulates tillering development in rice. (A)Act:D3 CTH - Schematic diagram of the GFP vector structure. (B) Wild-type Nipponbare (NP) and Act:D3 CTH - Morphology and tiller number of GFP transgenic plants at maturity. Scale bar, 20 cm. Data are mean ± standard deviation. (C) Wild-type Nipponbare (NP) and Act:D3 CTH - Protein levels of endogenous D53 in the stem base of 2-week-old GFP transgenic seedlings. Data are mean ± standard deviation. (D) Wild-type (NP) and Act:D3 CTH - Degradation of endogenous D53 in GFP / NP callus after treatment with 1 μM rac-GR24. Data are presented as mean ± standard deviation, n = 3.

[0055] Figure 4Creation of the OsD3 protein CTH motif knockout mutant in rice. (A) Information on the rice d3ΔCTH mutant. The left side shows the gDNA sequences of the wild type and the mutants d3ΔCTH-1 and d3ΔCTH-2. The blue line highlights the C-terminal domain (CTH) of D3, and the gray and red text shows the deleted sequence and the inserted base pair, respectively. The left side shows the amino acid sequences of the wild type and the mutants d3ΔCTH-1 and d3ΔCTH-2. The blue line highlights the CTH amino acid sequence, and the green and orange text shows the truncated CTH and the mutant CTH, respectively. (B) Morphology and tiller number of wild-type (NP), d3ΔCTH-1, and d3ΔCTH-2 plants at maturity. Scale bar, 20 cm. (C) Endogenous D53 protein levels in the stem base of wild-type (NP), d3ΔCTH-1, and d3ΔCTH-2 seedlings. (D) OsTB1 transcription levels in the stem base of wild-type (NP), d3ΔCTH-1, and d3ΔCTH-2 seedlings. Data are presented as mean ± standard deviation. (E) Yeast two-hybrid analysis of the interaction between truncated D3 and D14ΔN in d3ΔCTH-1 and d3ΔCTH-2 plants. Detailed Implementation

[0056] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0057] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0058] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0059] rac-GR24, a strigolactone analogue, was purchased from Chiralix, catalog number CX2388.

[0060] Y2HGold yeast strain was purchased from Clontech, catalog number 630498.

[0061] MG132 (a proteasome inhibitor) was purchased from Sigma-Aldrich, catalog number Cat#474790.

[0062] GR24 4DOThe description is found in the non-patent literature “Wang, L., Wang, B., Yu, H., Guo, H., Lin, T., Kou, L., Wang, A., Shao, N., Ma, H., Xiong, G., et al. (2020). Transcriptional regulation of strigolactone signalling in Arabidopsis. Nature 583, 277-281.” This biomaterial is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. It is intended solely for repeating experiments related to this invention and may not be used for any other purpose.

[0063] The preparation of the AHLG vector, pBI221 vector, rice d14 mutant, and D53 rabbit polyclonal antibody is described in the non-patent literature “Jiang, L., Liu, X., Xiong, G., Liu, H., Chen, F., Wang, L., Meng, X., Liu, G., Yu, H., Yuan, Y., et al. (2013). DWARF 53acts as a repressor of strigolactone signing in rice. Nature 504, 401-405.” This material is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. It is intended solely for repeating experiments related to this invention and should not be used for any other purpose.

[0064] The 35S:GFP plasmid, 35S:D14-Flag, and 35S:D3-GFP are described in the non-patent literature “Hu, Q., He, Y., Wang, L., Liu, S., Meng, X., Liu, G., Jing, Y., Chen, M., Song, X., Jiang, L. et al. (2017). DWARF14, a receptor covalently linked with the active form of strigolactones, undergoes strigolactone-dependent degradation in rice. Front. Plant Sci. 8, 1935.” These materials are available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is intended solely for repeating experiments related to this invention and may not be used for any other purpose.

[0065] The t20 mutant rice is described in non-patent literature “Liu, X., Hu, Q., Yan, J., Sun, K., Liang, Y., Jia, M., Meng, X., Fang, S., Wang, Y., Jing, Y., et al. (2020). ζ-carotene isomerase suppresses tillering in rice through the coordinated biosynthesis of strigolactone and abscisic acid. Mol. Plant 13, 1784-1801.” It is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is intended solely for repeating experiments related to this invention and may not be used for any other purpose.

[0066] The following examples use GraphPad Prism 8 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. Two-tailed Student's t-tests were used, with P < 0.05 (*), P < 0.01 (**), P < 0.001 (***), and ns (not significant) as values. Alternatively, one-way ANOVA tests were used, with P < 0.05 (*) indicating a significant difference.

[0067] Example 1: D3 in rice CTH Biological functions of the D14–GR24 complex

[0068] 1. D3 CTH The influence of D14 and D3 amino acid sites at the –D14–GR24 complex interaction interface on the D14 and D3 interactions.

[0069] 1. Analyze D3 using PyMol software CTH -D14-GR24 complex interaction interface D14 and D3 amino acid sites

[0070] The results are as follows Figure 1 As shown in Figure A, the H183, S274, and A276 amino acid sites of D14 and the E700 and L707 amino acid sites of D3 are located at the interaction interface between CTH and D14.

[0071] 2. Analysis of D3 using yeast two-hybrid experiments CTH The influence of D14 and D3 amino acid sites on the D14-D3 interaction at the -D14-GR24 complex interaction interface

[0072] The plasmid transformation of yeast was based on the experimental procedure of the DUAL membrane starter kits. The specific operation procedure is as follows: (1) Streak the Y2HGold yeast strain on YPDA solid medium and incubate at 30℃ upside down for 2-3 days until single colonies appear. (2) Pick 3-4 single colonies and incubate them in 3mL YPDA liquid medium at 30℃ and 250rpm for 12-14h. (3) Transfer 3mL of bacterial culture to 30mL YPDA liquid medium and continue to incubate at 30℃ and 250rpm for 3-5h until OD is obtained. 600 (3) Reach 0.6-0.8, centrifuge at 700g for 5 min at room temperature. (4) After discarding the supernatant, resuspend the precipitate in 30 mL of sterile water and centrifuge again at 700g for 5 min. (5) After discarding the supernatant, determine the amount of sterile medium added to resuspend the yeast cells according to the number of experimental reactions. Place the resuspended competent yeast cells on ice and wait for transformation. (6) When preparing competent yeast cells, denature the salmon sperm single-stranded ssDNA by boiling at 100℃ for 5 min and then placing it on ice for 5 min, repeating 2-3 times. (7) Determine the amount of PEG / LiOAc reaction mixture to be prepared according to the number of experimental reactions. Each reaction contains 240 μL of 50% PEG, 36 μL of LiOAc and 25 μL of salmon sperm single-stranded ssDNA. (8) Add the corresponding vector (200-300 ng each), 300 μL of PEG / LiOAc reaction mixture and 100 μL of competent yeast cells to a sterilized 1.7 mL centrifuge tube, mix well and incubate at 42℃ for 45 min. (9) Centrifuge at 700g for 5 min at room temperature to collect the cells, discard the supernatant and resuspend in 200 μL of 0.9% NaCl solution, spread evenly on SD-Leu / -Trp solid yeast deficient medium, and incubate at 30℃ inverted for 3-4 days until colonies appear. (10) Pick about 10 single clones from SD-Leu / -Trp solid yeast deficient medium and place them in 100 μL of 0.9% NaCl solution, and prepare yeast solutions at 10-fold and 100-fold dilutions. (11) Take 6 μL of yeast suspension and spot it on SD-Leu / -Trp, SD-Leu / -Trp / -His / -Ade containing acetone and SD-Leu / -Trp / -His / -Ade solid yeast deficiency medium containing 10 μM rac-GR24. Incubate at 30℃ upside down for 3-7 days and then take pictures for analysis.

[0073] YPAD liquid culture medium: 10 g / L Bacto-yeast extract, 20 g / L Bacto-peptone, 20 g / L Lextrose, 100 mg Adenine sulfate.

[0074] YPAD solid medium: Add 15 g / L Agar to the above YPAD liquid medium.

[0075] Yeast amino acid-deficient medium: 1.39-1.92 g / L yeast synthetic drop-out medium supplement, 6.7 g / L yeast nitrogen base without amino acids. Dissolve in ddH2O and bring the volume to 960 mL. Autoclave at 121 °C for 15 min. After sterilization, add 40 mL of 50% (w / v) glucose solution that has been filtered through a 0.22 μm filter for sterilization. For solid medium, add 20% (w / v) agar to the above composition and store at 4 °C.

[0076] Yeast conversion reagent: 50% (m / v) PEG, 50g, PEG 3350 (Sigma), dissolved in 100mL ddH2O and then filtered through a 0.22μm filter for sterilization.

[0077] 1M LiOAc: 10.2g LiOAc·2H2O (Sigma) was sterilized by filtration through a 0.22μm filter after being added to 100mL ddH2O.

[0078] Single-stranded carrier DNA: Dissolve 200mg salmon sperm DNA type III sodium salt (Sigma) in 100mL ddH2O, stir for 2-3 hours to completely dissolve the DNA, aliquot, and repeat 2-3 times before each use, alternating between 100℃ for 5 minutes and 4℃ for 5 minutes.

[0079] The results showed that the key D14 site at the CTH-D14 interaction interface... H183E D14 S274A D14 S274E and D14 A276V The mutation did not inhibit the interaction between D14 and D3 induced by strigolactone. Figure 1 (A and B). Key site of D3 at the interaction interface. L707A The mutation did not affect the interaction between D14 and D3, while D3 E700A The mutation partially suppressed the interaction between D14 and D3. Figure 1 (A and C in the middle). Data in yeast indicate that the D14-D3-CTH interaction interface is not necessary for the direct interaction between D14 and D3.

[0080] 3. Detecting the effect of the S274E mutation of D14 on the interaction between D14 and D3 in the protoplast system.

[0081] The 35S:D14-GFP plasmid is a recombinant expression plasmid obtained by inserting the CDS nucleotide sequence of the OsD14 gene into 35S:GFP. S274E -GFP plasmid is D14 S274E The recombinant expression plasmid was obtained by inserting the sequence into 35S:GFP. D14 S274E It is obtained by mutating amino acid position 274 of the D14 amino acid sequence by the S mutation site E.

[0082] Rice seedling protoplasts were prepared according to the reference "Bart, R., Chern, M., Park, CJ, Bartley, L., and Ronald, PC (2006). A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts. Plant Methods 2, 13." The plasmids 35S:D14-FLAG and 35S:D14 were then used. S274E -FLAG plasmid was co-transformed with 35S:D3-GFP plasmid into the aforementioned rice protoplasts.

[0083] The method for rice protoplast immunoprecipitation is as follows: 10 reactions for each combination (10 x 2mL centrifuge tubes), cultured at 28℃ in the dark for 14 h, followed by centrifugation at 150g for 3 min to collect protoplasts; 0.2mL of W5 solution (154mM NaCl, 125mM CaCl2, 5mM KCl, 2mM MES, pH 5.7) was added to each 2mL centrifuge tube to resuspend the previously transformed 35S:D14-FLAG plasmid + 35S:D3-GFP or transformed 35S:D14 S274E Protoplasts obtained from the FLAG+35S:D3-GFP plasmid were first combined into a 5mL centrifuge tube with 10 reactions from each combination, and then aliquoted into two new 2mL centrifuge tubes. 1μL of 50mM rac-GR24 or 1μL of acetone was added to the protoplasts, and the tubes were incubated at 28℃ in the dark for 1h. The protoplasts were then collected by centrifugation at 150g for 3min. The protoplasts were then extracted with 1mL of IP protein extraction buffer (50mM Tris-HCl (pH 7.5), 150mM NaCl, 10% (v / v) glycerol, 0.5% Nonidet P-40, 1x Roche cOmplete). TMProtoplasts were lysed using a protease inhibitor cocktail (1 mM PMSF and 50 μM MG132), centrifuged at 18,000 g for 10 min at 4 °C, and the supernatant was collected into a new 1.7 mL centrifuge tube. 1 μL of 50 mM rac-GR24 or 1 μL of acetone was added, along with 25 μL of GFP-Trap beads (ChromoTek, Cat#Gta-200). The tube was then incubated at 4 °C for 3 h with inversion. The mixture was washed with IP protein washing buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% (v / v) glycerol, 0.1% Nonidet P-40, 1x Roche cOmplete). TM Wash three times with a Protease Inhibitor Cocktail, add 25 μL of SDS loading solution, and vortex to mix. Denature the sample at 100 °C for 5 min, then perform a Western blot experiment. The FLAG antibody was a mouse monoclonal antibody (Sigma-Aldrich, Catalog No. Cat#F1804) diluted 1:3,000, and the GFP antibody was a mouse monoclonal antibody (Roche, Catalog No. Cat#11814460001) diluted 1:3,000.

[0084] The results showed that rac-GR24 could significantly induce D14 S274E -FLAG interacts with D3-GFP, and the interaction strength is significantly stronger than that of the control group D14-FLAG interacting with D3-GFP. Figure 2 (A) The results show that, although previous studies have found D14 S274E The mutation inhibits the direct interaction between the D14 and CTH motifs, but... Figure 2 From A, we know that D14 S274E It will enhance the interaction between D14 and D3 in rice protoplasts.

[0085] II. Expressing D14 or D14 S274E Obtaining callus and positive plants

[0086] 1. D14 overexpression vector and D14 S274E Construction of overexpression vectors

[0087] With the aforementioned 35S:D14-GFP and 35S:D14 S274E Using GFP plasmid as a template, the D14 gene and D14 were amplified using AHLG-D14-F and AHLG-D14-R. S274E Gene.

[0088] AHLG-D14-F: 5'- ACGATAAGCTTGGGCCC ATGCTGCGATCGACGCATC-3';

[0089] AHLG-D14-R: 5'- ATGGCGGCCGCTCTAGA GTACCGGGCGAGAGCGC-3'.

[0090] Among the primers mentioned above, those without underlined sequences are for amplifying D14 or D14. S274E The primers, with the underlined sequence, are used for homologous recombination with the AHLG vector.

[0091] The D14 overexpression vector is a recombinant expression vector AHLG-Act:D14-GFP obtained by replacing the small fragment between the ApaI and XbaI restriction sites of the AHLG vector with the CDS nucleotide sequence of the OsD14 gene, while keeping the other nucleotide sequences of the AHLG vector unchanged. This recombinant expression vector expresses the fusion protein D14-GFP.

[0092] D14 S274E The overexpression vector is a mutated D14 S274E The recombinant expression vector AHLG-Act:D14 was obtained by replacing the small fragment between the ApaI and XbaI restriction sites of the AHLG vector with the protein's nucleotide sequence while keeping the other nucleotide sequences of the AHLG vector unchanged. S274E -GFP, this recombinant expression vector expresses the fusion protein D14. S274E -GFP. Mutant D14 S274E The protein was obtained by mutating amino acid position 274 of the D14 amino acid sequence by the S mutation site E.

[0093] 2. Contains the recombinant vector Act:D14-GFP or Act:D14 S274E -GFP callus induction

[0094] (1) Induction and subculture of rice callus

[0095] NB solid culture medium composition: KNO3 2830 mg / L, (NH4)2SO4 463 mg / L, KH2PO4 400 mg / L, MgSO4·7H2O 185 mg / L, CaCl2·2H2O 166 mg / L, FeSO4·7H2O 27.8 mg / L, Na2EDTA 37.5 mg / L, MnSO4·4H2O 10 mg / L, H3BO3 3 mg / L, ZnSO4·7H2O 2 mg / L, Na2MoO4·2H2O 0.25 mg / L, CuSO4·5H2O 0.025 mg / L, CoCl2·6H2O 0.025 mg / L, KI 0.75 mg / L, Vitamin B1 10 mg / L, Vitamin B6 1 mg / L, Nicotinic acid 1 mg / L, Myo-inositol 100 mg / L, Casein hydrolysate 300 mg / L, Glutamine 500 mg / L, Glycine 2 mg / L, Proline 1000 mg / L, 2,4-D 2 mg / L, with the remainder being water.

[0096] Using the t20 mutant or d14 mutant as the rice recipient, the seeds of the t20 mutant (or d14 mutant) to be transformed were dehulled, surface-sterilized with 70% (v / v) ethanol for 1 min, followed by vortex washing with 2.5% (w / v) sodium hypochlorite for 45 min, and then rinsed three times with sterile water. The seeds were then sown on NB solid medium and incubated at 28°C in the dark for two weeks. After callus tissue grew at the mature embryo scutellum, the callus tissue was excised and subcultured on fresh NB solid medium, transferred every 7 days. After 3-4 cycles, Agrobacterium infection could be performed.

[0097] (2) Culture of Agrobacterium tumefaciens EHA105

[0098] Composition of 1L LB solid culture medium: Tryptone 10g, Yeast Extract 5g, NaCl 10g, Agar 15g.

[0099] Composition of 1L LB liquid culture medium: Tryptone 10g, Yeast Extract 5g, NaCl 10g.

[0100] Composition of rice conversion solution: The following reagents were added to NB basic medium: Inositol 2g / L, Glutamine 2g / L, Casein hydrolysate 500mg / L, 10% Synperonic PE 10ml / L, and Acetosyringone 100μM.

[0101] When the rice callus tissue is in good condition, the plant transgenic overexpression vector (AHLG-Act:D14-GFP vector or AHLG-Act:D14) is introduced. S274E The GFP vector was transformed into Agrobacterium EHA105 strain by high voltage electroporation and plated on LB solid medium containing 50 mg / L kanamycin and 25 mg / L rifampin for 2-3 days. For each transformation, 4-5 single colonies were picked and inoculated into 7 mL of LB liquid medium containing kanamycin and 25 mg / L rifampin. The cells were then incubated overnight at 28°C and 250 rpm. The cells were centrifuged at 3,000 rpm for 5 min at room temperature and resuspended in rice transformation solution for transformation of rice callus.

[0102] (3) Agrobacterium EHA105 infects rice callus tissue

[0103] Collect the callus tissue obtained in step (2) in good condition, add an appropriate amount of transformation solution until the callus tissue is completely submerged, and place at room temperature for 20 minutes, shaking occasionally. Then, remove the transformed callus tissue, absorb excess bacterial solution with sterile filter paper, and incubate at 23°C in the dark for 2-3 days to obtain the recombinant vector AHLG-Act:D14-GFP or AHLG-Act:D14. S274E -GFP callus Act:D14-GFP / d14 rice callus, Act:D14 S274E -GFP / d14 rice callus, Act:D14-GFP / t20 rice callus and Act:D14 S274E -GFP / t20 rice callus.

[0104] 3. Overexpression of D14 or D14 S274E The acquisition of genetically modified rice

[0105] The specific method is as follows: Incorporate the recombinant vector AHLG-Act:D14-GFP or AHLG-Act:D14... S274E -GFP callus Act:D14-GFP / d14 rice callus, Act:D14 S274E -GFP / d14 rice callus, Act:D14-GFP / t20 rice callus and Act:D14 S274E-GFP / t20 rice callus tissues were transferred to NB solid selection medium containing hygromycin and cultured at 28°C in the dark for 7-10 days. Afterward, they were subcultured into new NB solid selection medium containing hygromycin for 3-4 rounds of hygromycin selection. The callus tissues in good condition were propagated to differentiation medium for differentiation and regeneration, and seedlings were grown at 28°C under light for about one month. The resulting seedlings were then transferred to rooting medium for about 4 weeks to promote rooting and seedling growth, and finally transplanted to a greenhouse for about one month before being transplanted to the field.

[0106] 4. Identification of positive plants

[0107] The specific methods are as follows: (1) For “3, overexpression of D14 or D14” S274E In the process of obtaining transgenic rice, leaves were taken from individual rice plants, and genomic DNA was extracted using the CTAB method. Using the extracted DNA as a template, PCR amplification was performed using AHLG-F and D14-570-R identification primers. The PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing. After obtaining the sequencing results, the sequences were compared. Those sequences matching the expected sequences were identified as T0 generation positive plants. Sixteen T0 generation positive plants transgenic with the AHLG-Act:D14-GFP vector were obtained (named Act:D14-GFP / d14 plants), and ten plants transgenic with the AHLG-Act:D14 vector were also obtained. S274E - T0 generation positive single plant of GFP vector (named Act:D14) S274E -GFP / d14 plants), obtained 8 T0 generation positive single plants transformed with AHLG-Act:D14-GFP vector (named Act:D14-GFP / t20 plants), and obtained 9 plants transformed with AHLG-Act:D14-GFP vector. S274E - T0 generation positive single plant of GFP vector (named Act:D14) S274E (2) Randomly select 8 Act:D14-GFP / d14 plants and 8 Act:D14-GFP / d20 plants). S274E -GFP / d14 plants, 8 Act:D14-GFP / t20 plants, 8 Act:D14 S274E- The positive T0 generation plants of the GFP / t20 plant were propagated, and 8 T1 generation lines were planted. 6 single plants were randomly collected from each T1 generation line for screening homozygous positive single plants. (3) The harvested T1 generation seeds were germinated. 40 germinated seeds were placed on 0.5% Agar solid medium containing 50 μg / mL hygromycin (Hyg). The root growth of the plants was observed after 2-3 days. Plants with normal root growth were positive, otherwise they were pseudo-separated single plants. If all seeds of each plant could grow roots normally, it was a homozygous positive line. (4) 6 homozygous positive single plants of Act:D14-GFP / d14, 7 homozygous positive single plants of Act:d14ΔN-GFP / d14, 7 homozygous positive single plants of Act:D14-GFP / t20, and 8 homozygous positive single plants of Act:d14ΔN-GFP / t20 were obtained. The homozygous positive single plants of Act:D14-GFP / d14 (T2 generation), Act:d14ΔN-GFP / d14 (T2 generation), Act:D14-GFP / t20 (T2 generation), and Act:d14ΔN-GFP / t20 (T2 generation) used in subsequent experiments were named Act:D14-GFP / d14#1, Act:D14-GFP / d14#2, and Act:D14, respectively. S274E -GFP / d14#1、Act:D14 S274E -GFP / d14#2, Act:D14-GFP / t20#1, Act:D14-GFP / t20#2, Act:D14 S274E -GFP / t20#1 and Act:D14 S274E -GFP / t20#2.

[0108] Primers for identifying transgenic positive seedlings:

[0109] AHLG-F:5'-TCAGCATTGTTCATCGGTAG-3';

[0110] D14-570-R:5'-CTGCTGTATCCTCCTCCAGCTC-3'.

[0111] PCR reaction mixture: 1 μL DNA template, 2 μL 10 μM Primer F, 2 μL 10 μM Primer R, and 45 μL...

[0112] μL Gold Mix. Reaction program: 98℃ pre-denaturation for 3 min; 35 cycles, 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 15 s; 72℃ extension for 5 min.

[0113] 5. Detect D14 S274E-GFP promotes ubiquitination and degradation of D53-HA in rice.

[0114] 1) Carrier construction

[0115] The D53-HA overexpression vector pCAMBIA2301-D53-HA is a recombinant expression vector 2301-Act:D53-HA obtained by replacing the small fragment between the XbaI and PstI restriction sites of the pCAMBIA2301 vector with the CDS nucleotide sequence of the OsD53 gene, while keeping the other nucleotide sequences of the pCAMBIA2301 vector unchanged. This recombinant expression vector expresses the fusion protein D53-HA. The primers for construction are as follows:

[0116] OsD53-XbaI-2301-F:5'- CCGGGGATCCTCTAGAATGCCCACTCCGGTGGCCGCC -3';

[0117] OsD53-PstI-2301-3HA-R:5'- CCTGGCATGCCTGCAG TCAAGCGTAATCTGGAACGTCGTAAGGGTAGCCGGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTAAGGGTAGCCCGCC ACAA TCTAGAATTATTCTTG -3'.

[0118] The double underlines represent the vector's recombination adapter sequences. However, the underlined part represents the OsD53 gene primer sequence, and the bold black part represents the nucleotide sequence for 3-HA reverse complementation.

[0119] 2) Preparation of callus tissue

[0120] According to "2. Contains recombinant vector Act:D14-GFP or Act:D14 S274E -GFP-induced callus (1) Rice callus induction and subculture method, to prepare the aforementioned plant Act:D14-GFP / d14#2 and D14 S274E Callus tissue from -GFP / d14#2 was selected from those exhibiting vigorous growth, characterized by a pale yellow color, smooth appearance, and compact morphology, specifically Act:D14-GFP / d14#2 and D14. S274EUsing GFP / d14#2 callus as the recipient, the D53-HA overexpression vector pCAMBIA2301-D53-HA was transfected into it. The resulting rice callus was then transferred to a new NB solid selection medium containing antibiotics and cultured at 28°C in the dark for one week. These callus were then subcultured into a new NB solid selection medium containing antibiotics for one week, and this process was repeated three times. Callus in good condition (pale yellow color, smooth appearance, and compact morphology) was then transferred to NB liquid medium and cultured at 28°C for 50 rpm in the dark for 1-2 hours to obtain D53-HA / D14 transfected callus and D53-HA / D14 transfected callus. S274E The callus tissue.

[0121] 3) Detection of D53-HA ubiquitination

[0122] To determine the ubiquitination of D53-HA, the above-mentioned callus tissue transformed with D53-HA / D14 and the D53-HA / D14 transformed callus tissue were analyzed. S274E The callus tissues were pretreated with 50 μM MG132 (Sigma-Aldrich, catalog number 474790) for 1 hour. For the ubiquitinization of D53-HA, the callus tissues were pretreated with or without 2 μM GR24. 4DO Process for 5 minutes, then freeze in liquid nitrogen. Extract total protein in IP protein extraction buffer. Then, add 25 μL of HA agarose beads (Sigma) to 1 mL of supernatant and incubate gently by rotation at 4°C for 2 hours. Wash the beads 3–5 times with IP washing buffer, then elute HA agarose-binding beads or GFP agarose-binding beads with 50 μL of SDS-PAGE buffer. Perform SDS-PAGE and Western blot analysis.

[0123] To determine D53 degradation, transgenic callus was treated with or without 1 μM rac-GR24 for 5 min, 10 min, and 20 min, and then frozen in liquid nitrogen. The protein extraction buffer consisted of 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% (v / v) glycerol, 1.0% (v / v) Nonidet P-40, 10 mM NaF, 2 mM EDTA, 0.1% SDS sodium orthovanadate, and 1x Roche oxidase. TM Total protein was extracted using a protease inhibitor cocktail (1 mM PMSF and 50 μM MG132) and detected by SDS-PAGE and Western blot.

[0124] For SDS-PAGE and Western blot experiments, the specific procedures are as follows: (1) Prepare a 10% concentration 12-well or 15-well SDS-PAGE protein gel or use a 4-15% 10-well protein precast gel purchased from Bio-Rad. The amount of protein sample loaded depends on the experimental requirements. Set the voltage to 80-120V and the loading time to about 1-2 hours. (2) Transfer the protein to a PVDF or NC membrane using a semi-dry transfer method. The voltage is 15-20V and the transfer time is 30-60 minutes. (3) During the transfer, prepare 4% skim milk powder in TBST solution. After the transfer is complete, place the PVDF or NC membrane in 4% skim milk powder and incubate it at room temperature for 60 minutes on a shaker at 70 rpm. (4) Discard the skim milk powder, rinse with TBST, add new 4% skim milk powder, add the antibody to be detected, and incubate for 1-2 hours or overnight at 4°C. (5) After primary antibody incubation, wash the PVDF or NC membrane three times with TBST, each time at 70 rpm on a shaker at room temperature for 5 min. Then add 4% skim milk containing secondary antibody and incubate at 60 rpm on a shaker at room temperature for 60 min. (6) After secondary antibody incubation, wash the membrane three times with TBST, each time at 70 rpm on a shaker at room temperature for 5 min. Add chromogenic solution and develop the protein using photographic film or a protein developing instrument. Mouse monoclonal antibody α-Ubi ​​(Cell Signaling Technology), α-K48-specific doublyin rabbit monoclonal antibody (Cell Signeling Technology), and α-K63-specific doublyin rabbit monoclonal antibody (Cell Signalling Technology) are used at a dilution of 1:1000, and mouse monoclonal antibody α-HA (Abmart) is used at a dilution of 1:3000.

[0125] The results show that D14 S274E -GFP enhances the ubiquitination and degradation of D53 in rice. Figure 2 (B and C) indicate D14 S274E The mutation enhanced rice's perception of strigolactones.

[0126] 6. Count the number of tillers in homozygous positive plants.

[0127] The experimental method is as follows: Wild-type rice Nipponbare NP, d14 mutant, t20 mutant, and the above homozygous plants Act:D14-GFP / d14#1, Act:D14-GFP / d14#2, Act:d14ΔN-GFP / d14#1, Act:d14ΔN-GFP / d14#2, Act:D14-GFP / t20#1, Act:D14-GFP / t20#2, Act:d14ΔN-GFP / t20#1, and Act:d14ΔN-GFP / t20#2 were planted in the field of the experimental base of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Changping District, Beijing. Each line was planted with 24 plants at a plant spacing and row spacing of 17 cm. The growing season was from May to November each year. The field phenotypic survey of rice materials was conducted from September 20th to October 7th each year. The number of tillers counted was the number of effective tillers at maturity (i.e., the number of tillers that produced panicles), and the plant height was the distance from the tallest panicle to the ground. Representative individual plants were selected and transplanted into pots for photographing, using the average number of tillers for each material as the standard.

[0128] The results showed that D14 S274E -GFP overexpression completely salvaged the number of tillers at d14, with some lines even producing fewer tillers than the wild type. Figure 2 (D). Further, D14 S274E Overexpression of GFP significantly reduced the number of tillers in the t20 mutant (a mutant with reduced strigolactone content). Figure 2 (E) indicates D14 S274E The mutation enhanced the ability of rice to sense strigolactone signals.

[0129] These results indicate that, although previous studies have shown that S274E of D14 is D3, CTH The key amino acid sites in the –D14–GR24 complex are crucial for the direct interaction between D14 and the D3-CTH motif (Shabek, N., Ticchiarelli, F., Mao, H., Hinds, TR, Leyser, O., and Zheng, N. (2018). Structural plasticity of D3-D14 ubiquitin ligase in strigolactone signalling. Nature 563, 652-656.). However, the yeast data in this study indicate that D14… S274E The mutation does not suppress the interaction between D14 and the full-length D3. More interestingly, D14... S274E The mutation enhances the interaction between D14 and full-length D3 in the protoplast, while also enhancing the plant's sensitivity to strigolactones. Given D14...S274E Mutations are important for the direct interaction between D14 and the D3-CTH motif, while D14... S274E The mutant protein enhances the plant's ability to sense strigolactones, therefore it is speculated that D3... CTH The –D14–GR24 complex may regulate the sensing of strigolactones in rice, and the D3-CTH motif may regulate rice tillering by modulating strigolactone signaling.

[0130] Example 2: Identification and biological function analysis of the CTH motif of OsD3 protein in rice.

[0131] In order to analyze D3 CTH The function of the D3-CTH motif in the –D14–GR24 complex in rice was investigated, and transgenic materials overexpressing D3-CTH were constructed in wild type.

[0132] I. Preparation of CTH-GFP overexpressing plants

[0133] overexpression mutant primers

[0134] AHLG-D3 CTH -F: ACGATAAGCTTGGGCCC ATGGCGGAAGAGGAGGAGGTGG;

[0135] AHLG-D3 CTH -R: ATGGCGGCCGCTCTAGA ATCATCAATTTGCCGGCTGTTC.

[0136] The bolded part is the primer sequence for CTH, and the underlined part is the adapter sequence used by the vector for recombination with AHLG.

[0137] The overexpression vector for CTH-GFP is the recombinant overexpression vector AHLG-Act:D3, obtained by replacing the small fragment between the ApaI and XbaI restriction sites of the AHLG vector with nucleotides 2077-2163 of SEQ ID No. 2, while keeping the other nucleotide sequences of the AHLG vector unchanged. CTH -GFP, the recombinant expression vector expresses protein D3 with amino acid sequence positions 693-720 of SEQ ID No. 1. CTH .

[0138] Replace the recombinant expression vectors AHLG-Act:D14-GFP or AHLG-Act:D14 with a vector that overexpresses CTH-GFP. S274E -GFP, and simultaneously replace the t20 mutant or d14 mutant with wild-type Nipponbare rice, the remaining operations are the same as in "II. Expression of D14" in Example 1. S274EParts 2, 3, and 4 of "Obtaining Callus and Positive Plants" describe the positive plants obtained, which were named Act:D3. CTH -GFP / NP#1 and Act:D3 CTH -GFP / NP#2.

[0139] Referring to Example 1, "II. Expressing D14 or D14" S274E "Obtaining callus and positive plants", section 6, "Statistical analysis of tiller number of homozygous positive plants", Act: D3 CTH -GFP / NP#1 and Act:D3 CTH - Tillering number of GFP / NP#2.

[0140] II. Detection of Act:D3 CTH -Relative expression level of D53 protein in GFP / NP

[0141] Rice seedlings were grown in a rice incubator (MLR-351H, SANYO, Japan) under 28°C for 16 hours of light followed by 8 hours of darkness at 25°C, with a light intensity of 150-200 μM m⁻² s⁻¹ and a humidity of 70%. After two weeks of cultivation in Kimura B nutrient solution, 1 cm of tissue from the base of the stems of seedlings from different materials was harvested.

[0142] With Act:D3 CTH -GFP / NP#1 and Act:D3 CTH -GFP / NP#2 replaces Act:D14-GFP / d14#2 and D14 S274E -GFP / d14#2, the remaining operations are the same as in Example 1, "5. Detection of D14". S274E "-GFP on ubiquitination and degradation of D53-HA in rice", investigating the effect of the CTH motif of D3 on the degradation of D53 by rac-GR24 treatment.

[0143] The results showed that overexpression of CTH-GFP in wild-type cells... Figure 3 CTH-GFP positively regulates rice tillering and D53 protein levels (A). Figure 3 (B and C), degradation of D53 treated with rac-GR24 ( Figure 3 The results (D) indicate that overexpression of the CTH motif of D3 negatively regulates rice tillering development and D53 degradation.

[0144] Example 3: Creation of OsD3 protein CTH motif knockout mutant in rice

[0145] 1. Construction of the knockout vector

[0146] The pYLCRISPR / Cas9Pubi-H, pYLgRNA-OsU3, and pYLgRNA-OsU6a vectors in the above embodiments have been described in the literature "Ma, X., Zhang, Q., Zhu, Q., Liu, W., Chen, Y., Qiu, R., Wang, B., Yang, Z., Li, H., Lin, Y., et al. (2015). A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant 8, 1274-1284." This biological material can be obtained from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is only for repeating the experiments of this invention and should not be used for other purposes.

[0147] The CTH motif of rice OsD3 was edited using the CRIPSR / Cas9 system. The specific steps are as follows:

[0148] (1) Target sequence selection

[0149] Target T1: 5'-GAACATCAGATCATTCTCTG-3', located at nucleotides 2158-2177 of the wild-type genomic sequence of the OsD3 gene.

[0150] Target T2: 5'-TTGAGGTGCAACTGAACAGC-3', located at nucleotides 2209-2228 of the wild-type genomic sequence of the OsD3 gene.

[0151] Target T3: 5'-AAATTGATGATTAGTTATGT-3', located at nucleotides 2233-2252 of the wild-type genomic sequence of the OsD3 gene.

[0152] (2) Obtaining gRNA gene expression cassettes targeting gene sites

[0153] The aforementioned three target sequences were constructed into the pYLCRISPR / Cas9 vector using the following method to obtain expression cassettes for targeting TI and T2 or for targeting TI and T3. The specific construction method is as follows:

[0154] ① Target adapter preparation: Dissolve the adapter primer TE to prepare a 100 μM stock solution, take 1 μl of each and add it to 98 μl of H2O to dilute to 1 μM. Anneal at approximately 90℃ for 30 seconds, then cool to room temperature to complete the annealing.

[0155] Table 1 Target linker primer sequences

[0156]

[0157] ② Prepare 10 μl of 1x BsaI enzyme digestion and ligation reaction solution: Mix the T1 target adapter, T2 target adapter, and T3 target adapter with BsaI-HF (NEB, trade name BsaI-HF). After mixing v2 (catalog number #R3733), pYLsgRNA vector, and T4 ligase, the following gRNA gene expression cassettes were obtained: gRNA-U3-D3-T1, which is driven by the OsU3 promoter and targets T1; gRNA-U6a-D3-T2, which is driven by the OsU6a promoter and targets T2; and gRNA-U6a-D3-T3, which is driven by the OsU6a promoter and targets T2.

[0158] (3) Perform two rounds of PCR amplification on gRNA-U3-D3-T1, gRNA-U6a-D3-T2 and gRNA-U6a-D3-T3 respectively to obtain sgRNA expression cassette PCR fragments that can be constructed into the pYLCRISPR / Cas9 final vector.

[0159] The first round of PCR was conducted. The first-round PCR product obtained using gRNA-U3-D3-T1 as a template was named gU3-D3-T1. The first-round PCR product obtained using gRNA-U6a-D3-T2 as a template was named gU6a-D3-T2. The first-round PCR product obtained using gRNA-U6a-D3-T3 as a template was named gU6a-D3-T3.

[0160] First-round amplification primers:

[0161] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0162] gR-R: 5'-CGGAGGAAAATTCCATCCAC-3'.

[0163] The first-round PCR products were diluted 10-fold with H2O. The second-round PCR product obtained by amplification using gU3-D3-T1 as a template and Uctcg-B1' and gRctga-B2 as primers was named U3-D3-T1. The second-round primers obtained by amplification using gU6a-D3-T2 as a template and Uctga-B2' and gRcggt-BL were named U6a-D3-T2. The second-round primers obtained by amplification using gU6a-D3-T3 as a template and Uctga-B2' and gRcggt-BL were named U6a-D3-T3.

[0164] Uctcg-B1': 5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3' (U3 upstream primer);

[0165] gRctga-B2: 5'-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3' (RNA downstream primer);

[0166] Uctga-B2': 5'-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3' (U6a upstream primer);

[0167] gRcggt-BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3' (complementary to the right side (BL') of the vector).

[0168] (4) The sgRNA expression cassette was assembled into the pYLCRISPR / Cas9 vector using a cut-and-ligate method. The system is as follows:

[0169] Table 210 μL 1x BsaI enzyme digestion and ligation reaction solution

[0170] reagents Amount added (μl) Final concentration 10×CutSmart Buffer 1.5 1× 10mM ATP 1.5 1mM pYLCRISPR / Cas9Pubi-H 60-80ng 4-6 ng / μl Mixing the sgRNA expression cassette PCR fragments from the previous round 10-15ng per expression box / Bsa I-HF 10U 0.1-0.2 U / μl T4 DNA ligase 35U 2-3U / μl <![CDATA[H20]]> Final 15μl

[0171] Note: In the table above, "mixed sgRNA expression cassette PCR fragments" refers to a mixture of U3-D3-T1 and U6a-D3-T2 or a mixture of U3-D3-T1 and U6a-D3-T3.

[0172] PCR instrument program settings: 37℃ for 5 min; 10℃ for 5 min, 20℃ for 5 min, 10-15 cycles, and finally 37℃ for 5 min.

[0173] (5) Positive clones can also be obtained by chemical heat shock transformation. Plasmids are extracted, digested with Mlu I or Asc I, and detected by electrophoresis of the sgRNA expression cassette linker fragment. The clones are then sent to the company for sequencing. The CRISPR plasmid containing both T1 and T2 targets is named pYLCRISPR / Cas9Pubi-H-D3-CTH-N1 plasmid, and the CRISPR plasmid containing both T1 and T3 targets is named pYLCRISPR / Cas9Pubi-H-D3-CTH-N2 plasmid.

[0174] 2. Obtaining transgenic rice with the D3 CTH motif knocked out

[0175] Wild-type Nipponbare rice was used to replace Example 1, which contained the recombinant vector Act:D14-GFP or Act:D14. S274EThe t20 mutant or d14 mutant in "Call Induction of -GFP" was replaced with the pYLCRISPR / Cas9Pubi-H-D3-CTH-N1 or pYLCRISPR / Cas9Pubi-H-D3-CTH-N2 plasmid in Example 1, which contained the recombinant vector Act:D14-GFP or Act:D14. S274E The recombinant vector in "Call Induction with GFP" is used, and the remaining operations are the same as in Example 1 "Containing Recombinant Vector Act:D14-GFP or Act:D14". S274E "-GFP callus induction" was used to obtain callus tissue, which was then subjected to "overexpression of D14 or D14" as described in Example 1. S274E The method described in "Obtaining Transgenic Rice" is used to cultivate transgenic plants.

[0176] 3. Identification of positive plants

[0177] The specific method is as follows: Select normally growing plants with hygromycin resistance from step 2 for mutation site identification. Extract total plant DNA and perform PCR identification as described above. Purify the amplified PCR products and send them to a company for sequencing. Compare the sequencing results with the wild-type Nipponbare rice sequence. If the regenerated plant has only one PCR amplification product, and its nucleotide sequence is identical to that of the wild-type Nipponbare rice PCR amplification product, the regenerated plant is wild-type. If the regenerated plant has two PCR amplification products, one identical to the wild-type Nipponbare rice PCR amplification product, and the other showing a mutation (including deletion, insertion, or substitution of one or more nucleotides), the regenerated plant is heterozygous. If the regenerated plant has two PCR amplification products, both showing mutations (including deletion, insertion, or substitution of one or more nucleotides) compared to the wild-type Nipponbare rice PCR amplification product, the regenerated plant is a biallelic mutant. If the PCR amplification product of the regenerated plant is a single nucleotide and has undergone a mutation (including deletion, insertion, or substitution of one or more nucleotides) compared to the PCR amplification product of the wild-type plant *Nipponbare*, the regenerated plant is a homozygous mutant. If the PCR amplification product of the regenerated plant is three or more nucleotides, the regenerated plant is a chimeric plant. Heterozygous, biallelic, homozygous, and chimeric plants are collectively referred to as edited plants.

[0178] The results showed that among the 45 gene-editing candidate plants, two homozygous plants were obtained and named d3CTH-1 and d3CTH-2, respectively. The mutation types are described in [link to relevant documentation]. Figure 4 In the middle A, d3CTH-1 were all homozygous plants obtained by transformation of the pYLCRISPR / Cas9Pubi-H-D3-CTH-N2 plasmid.

[0179] Compared with wild-type rice, the homozygous mutant d3CTH-1 rice has the following mutations in the D14 gene: an A base is inserted between nucleotides 2161-2162 of the wild-type OsD3 gene sequence, and a G base is inserted between nucleotides 2249-2250 of the wild-type OsD3 gene sequence.

[0180] Compared with wild-type rice, the homozygous mutant d3CTH-1 rice showed the following mutations in the D14 gene: the OsD3 gene had a deletion at nucleotide 2161, nucleotides 2163-2169, and nucleotides 2247-2252 in the wild-type genome sequence.

[0181] 4. Count the number of tillers in positive plants.

[0182] The experimental method is as follows: wild-type rice Nipponbare, d14 mutant, t20 mutant, etc. in "counting the number of tillers of homozygous positive plants" in Example 1 were replaced with wild-type rice Nipponbare, d14 mutant, t20 mutant, etc., using the above-mentioned homozygous plants d14ΔN-1 and d14ΔN-2. Other operations were the same as in "counting the number of tillers of homozygous positive plants" in Example 1.

[0183] The results showed that, compared with the wild type, both the d3CTH-1 and d3CTH-2 lines had increased tiller numbers. Figure 4 (B)

[0184] 5. Detect the D53 protein level in positive plants

[0185] The experimental method is as follows: (1) Prepare a 10% concentration 12-well or 15-well SDS-PAGE protein gel. The amount of protein sample loaded depends on the experimental requirements. Set the voltage to 80-120V and the loading time to about 1-2 hours. (2) Transfer the protein to a PVDF or NC membrane using a semi-dry transfer method. The voltage is 15-20V and the transfer time is 30-60 minutes. (3) During the transfer, prepare 4% skim milk powder in TBST solution. After the transfer is completed, place the PVDF or NC membrane in 4% skim milk powder and incubate it at room temperature for 60 minutes on a shaker at 70 rpm. (4) Discard the skim milk powder, rinse with TBST, add fresh 4% skim milk powder, add the antibody to be detected, and incubate for 1-2 hours or overnight at 4°C. (5) After incubation with primary antibody, wash the PVDF or NC membrane three times with TBST, each time at 70 rpm on a shaker at room temperature for 5 min. Then add 4% skim milk containing secondary antibody and incubate at 60 rpm on a shaker at room temperature for 60 min. (6) After incubation with secondary antibody, wash the membrane three times with TBST, each time at 70 rpm on a shaker at room temperature for 5 min. Add chromogenic solution and develop the protein using photographic film or a protein developing instrument. The internal control protein is Actin, purchased from Abmart, catalog number Cat#M20009L.

[0186] The results showed that, compared with wild type, the D53 protein content of d3ΔCTH-1 and d3ΔCTH-2 was increased ( Figure 4 (C)

[0187] 6. Detect the transcription level of OsTB1, a rice tillering repressor gene, at the base of the stem of transgenic rice seedlings.

[0188] The experimental method is as follows: d3ΔCTH-1 and d3ΔCTH-2 rice seedlings were grown in a rice incubator (MLR-351H, SANYO, Japan), under 28℃ light for 16 hours and 25℃ darkness for 8 hours, with a light intensity of 150-200 μMm. -2 s -1 The humidity was 70%. After culturing in Kimura medium for 2 weeks, stem base tissue (1 cm) of seedlings from different materials was collected, and total RNA was extracted. The transcriptional level of the rice tillering repressor gene OsTB1 in transgenic rice was detected using real-time quantitative PCR. The specific method is as follows:

[0189] Extraction using TURBO DNA-free TMThe kit removes residual DNA from total RNA. Detailed steps are provided in the instructions. Each reaction volume is 20 μL, with 12.5 μg of total RNA. Incubate at 37°C for 30 min, add 2 μL of DNase inactivation reagent, mix thoroughly at room temperature for 5 min, centrifuge at 12,000g for 5 min at room temperature, and use 4 μL of the supernatant for reverse transcription experiments. The III First-Strand Synthesis System reverse transcription kit synthesizes the first strand of cDNA. For detailed steps, please refer to the instructions. Finally, add 180 μL of nuclease-free double-distilled water to dissolve the reverse transcription product and mix thoroughly before use.

[0190] The transcriptional level of the SL-biosynthesis gene D10 in the roots of transgenic rice seedlings was detected using quantitative real-time PCR. Each reaction volume for quantitative real-time PCR was 10 μL, including 5 μL SsoFast EvaGreen supermix, 0.5 μL upstream primer (5 μM), 0.5 μL downstream primer (5 μM), 2.0 μL purified cDNA, and 2 μL ddH2O. The instrument used for quantitative real-time PCR was a BIO-RAD CFX96 real-time PCR instrument. The PCR program parameters were set as follows: 98℃, 30s; (98℃, 5s → 60℃, 5s → data acquisition), 40 cycles; 60-95℃, 0.5℃ / 5s, data acquisition / 5s. After the program completed, the data was processed using BIO-RAD CFX Manager software.

[0191] Primers for quantitative real-time PCR detection of OsTB1 gene expression:

[0192] OsTB1-F:5'-CGACAGCGGCAGCTACTAC-3';

[0193] OsTB1-R:5'-GCGAATTGGCGTAGACGA-3';

[0194] qUbiquitin-F:5'-AACCAGCTGAGGCCCAAGA-3';

[0195] qUbiquitin-R:5'-ACGATTGATTTAACCAGTCCATGA-3'.

[0196] The results showed that, compared with the wild type, the expression of the tillering inhibitor gene OsTB1 was reduced in both d3CTH-1 and d3CTH-2 lines. Figure 4 (D).

[0197] 7. Two-yeast hybridization experiment

[0198] The experimental method is the same as the "yeast two-hybrid experiment" method in Example 1 above.

[0199] The results showed that the interaction between the mutant d3ΔCTH-1 and d3ΔCTH-2 proteins and D14ΔN was almost undetectable in yeast. Figure 4 The presence of E indicates that CTH plays an important role in the interaction between D14 and D3.

[0200] In summary, the direct interaction between the CTH motif of D3 and D14 is important. The negative regulatory effect of the CTH motif may be due to the dominant negative effect of competitive interference on the formation of the D3-D14-D53 complex and / or the translocated CTH may put D14 in a "sluggish" state, thereby weakening SL sensing and inhibiting D53 ubiquitination and degradation.

[0201] The sequences involved in the foregoing embodiments:

[0202] The OsD3 gene encodes a rice tillering-related protein (SEQ ID No. 1).

[0203] MAEEEEVEEGRSSSSAILDLPEPLLLHILSFLTDVRSRHRAALACGRMRAAERATRSELSLRGDPRSPGFLFLSHAFRFPALEHLDLSLVSPWGHPLLSSVPPCGGGGGGAPSASSSSGMNVYHPEAISEQNAFIAARLAGCFPAVTSLAVYCRDPTTLANLTPHWQASLRRVKLVRWHQRPPTLPDGADLEPLLETCAALRELDLSEFYCWTEDVVRALTTHPSATAALTHLDLGLAAATDGFKSSELGPIAASCPNLRKLVAPCLFNPRFSDCVGDDALLSLATSCPRLTVLRLSEPFEAAANIQREEAAITVAGLVAFFAALPALEDFTMDLQHNVLEAAPAMEALARRCPRIKFLTLGSFQGLCKASWLHLDGVAVCGGLESLYMKNCQDLTDASLAAIGRGCRRLAKFGIHGCDLVTSAGIRRLAFTLRPTLKEVTVLHCRLLHTAECLTALSPIRDRIESLEINCVWNTTEQPCSVANGTTTECDPEDDELGEVYESAAKKCRYMEFDDLGSWEMLRSLSLWFSAGQLLSPLISAGLDSCPVLEEISIKVEGDCRTCPRPAPRTIFGLSDLAGFPVLAKMKLDLSEAVGYALTAPTGQMDLSLWERFYLHGIESLQTLYELDYWPPQDKDVHHRSLTLPAVGLIQRCVGLRKLFIHGTTHEHFMTFFLSIPNLRDMQLREDYYPAPENDLMFTEMRAESWLRFEVQLNSRQIDD*。

[0204] CDS nucleotide sequence of OsD3 gene (SEQ ID No.2)

[0205]

[0206] OsD14 gene CDS nucleotide sequence

[0207] 5'-ATGCTGCGATCGACGCATCCGCCGCCCAGTAGCCCGAGCAGCAGCAGCAGCGGCGGCGGCGGGGGCGGGGGGTCGTCGGCGTCGTCGAGCTCGGAGAAGACGATGGTGGGCGGCGGGGGAGGAGGGGGAGGAGGGAGCGGGTCGGCGGCGCCGAGCGGGGCGAAGCTGCTGCAGATCCTGAACGTGCGGGTGGTGGGGAGCGGCGAGCGGGTGGTGGTGCTGTCGCATGGCTTCGGGACGGACCAGTCGGCGTGGAGCCGCGTGCTGCCGTACCTCACCCGCGACCACCGCGTCGTGCTCTACGACCTCGTCTGCGCCGGCAGCGTCAACCCGGACCACTTCGACTTCCGCCGCTACGACAACCTCGACGCCTACGTCGACGACCTGCTCGCCATCCTCGACGCGCTCCGCATCCCGCGCTGCGCCTTCGTCGGCCACTCCGTCTCCGCCATGATCGGCATCCTCGCCTCCATCCGACGACCTGACCTCTTCGCCAAGCTTGTCCTCATCGGCGCCTCTCCCCGGTTCTTGAACGACAGCGACTACCACGGCGGGTTCGAGCTGGAGGAGATACAGCAGGTGTTCGACGCGATGGGGGCGAACTACTCGGCGTGGGCGACGGGGTACGCGCCTCTGGCGGTGGGCGCCGACGTGCCGGCGGCGGTGCAGGAGTTCAGCCGCACCCTCTTCAACATGCGCCCGGACATCTCCCTCCACGTCTGCCAGACCGTCTTCAAGACCGACCTCCGCGGCGTGCTCGGCATGGTCCGCGCCCCCTGCGTCGTCGTCCAGACCACCCGCGACGTCTCCGTCCCGGCCTCCGTCGCCGCCTACCTCAAGGCCCACCTCGGCGGCCGCACCACCGTCGAGTTCCTCCAGACCGAGGGTCACCTCCCCCACCTCAGCGCCCCCAGCCTCCTCGCCCAGGTGCTCCGCCGCGCTCTCGCCCGGTACTAA-3'。

[0208] OsD53 gene CDS nucleotide sequence

[0209]

[0210] Wild-type genome sequence of the OsD3 gene

[0211]

[0212] GAGCGATTTTATTTGCATGGTATCGAATCACTGCAGACTTTGTATGAATTGGACTACTGGCCGCCCCAAGACAAGGATGT

[0213] GCACCACCGGAGCCTGACATTGCCAGCCGTGGGATTGATCCAACGCTGCGTTGGACTCAGGAAGCTTTTCATCCATGGCA

[0214] CCACACATGAGCACTTCCATGACCTTCTTCCTTTCAATTCCAAACTTGCGGGACATGCAGTTGCGGGAGGACTATTATCCA

[0215] GCCCCAGAGAATGATCTGATGTTCACAGAGATGCGGGCTGAATCTTGGCTTAGGTTTGAGGTGCAACTGAACAGCCGGCA

[0216] AATTGATGATTAGTTATGTGGGCACAAAATGGTTTGAAGCTGAATACAGAGATTTATCTGGATGGTGCCATTGCTCCACT

[0217] GTGCAATGGCAGGGATTCCTGGTGAGTTGGTTATGATTATGGGTGGAGTCGTGTGTATTGCTGCAGTGCCATTGAGGAG

[0218] AGTAGTATACTGGCAGCACTTGGATCTGTCAGCAAAGTAACCTTCTCCAGTTGCTTTTTTACCCCTTTTTTGATGTAATA

[0219] AGAGAGTTGGGTCGGAAATGAGATATTTGCAGGAGATAAGATTATAAATTAGGCTTCATGGAAATTTTCCAAGAAAAAA

[0220] AAACATTTTGTTTTTAAGATGGTCTGAGTTGTGAACACCGCAAGAGTAATTGGCAAATTGGCATGGTTCTAGCGGTTTG

[0221] TAACATTTGAACTCTGTAAACAAAAGAAAAACGCCACTCGCTTTTCTTATGCCCTTTGCTTCATGGGTGAAAGTGGCTCA

[0222] TCTAATATTGGTCAGTGTTTTACTGTTTTCAATGGATGGGCAACGGAGTTCAGTACTACTGCGATAGGAAACTATTTTGA

[0223] TGTGTACATAACAGCTCTATTAATCCAAAATTATGTGCCTTTGCTCTTTGAGTTTATTTCTGTCCCTTTCCTTTTCCATT

[0224] TCATGCACAGGCTTGGTGACAAATGGGATGGCGTGTGCAGATGTGCAAGCCAGTTTTGCATGTCATTATCGGGCATGTTG

[0225] AGTTGCAACACCGGCTACAACAAGGTTTACTTTAATACACAGCAGTAAGGATTTAATCTGATAGAATGTTGAAAGGTTTT

[0226] CTCTTTTTTATGCAGGATTGAAAGCTGCTTTAGTTTCCAAGGAACAACCAATCAGTTCCATCAGAACTGACTACCACCAT

[0227] TTGCTGATTCGTTCTCTGCAGTGATCCCCAATGGAGACCTGGCCTTTGCTTCATCTCATCCTCAAACTGTAGCATGACAA

[0228] GAAAGACGTGCGGAACAAGATCAGCATCAGAACATGACAAAAAGATTTTCGCACTAGAAGCCGGTTTATCCAATTCCTCT

[0229] GCTTGCCTCTTCCATTCAGCTAGTTAAGATAATGCGAGATCACTGGTTTTGTCAAAGCAAATCCAGACGATTCTTGGTGC

[0230] CATGGAAAAAGAAGTCGTCCATGAGTGAGAGAGCTCTCTTGTCCTAATCCATCAGCAAGGGCAATAATGCTTTTTTGATT

[0231] AAGCAGCTGGAGGCCTCACAAAATAATGCTTAAGCAAGTACTACTACAGGATTAAAAGCTGGCCTCTAGAAGGAGTAGAT

[0232] TAGGTAGAGGAGAAGCTTCTCCTTTCCTCTTTTGCCACGTTGAGGCTTATTGCTCACATGATTGTCAATCAACCACGTCA

[0233] CACAAGCACATACACACACTTATTATTTGCTCATAGTTTTAGTTATTTATCAACATTTGGCAGATATGTGTTGGAAATTC

[0234] AGATGCTCCTTGATGCCATTTTATCTTGCTGGTACATCTGCATAACTCGCTCATTACTATCTGTTGCAATATTATTATAC

[0235] ATTTGGATATTTAATGTGCTGATCGCTTCTTGCTACCTATCTAATTTCAGAATGTCTTGAAAGCAAAGCTGGTGACAGGA

[0236] GAGATGTCATATGAGCAGGCAGTCAGTTGCAGCCTTGTGGTTGCACCTCCCTTTCCTGCTGTCCTCTTTTTTTTGTTTTC

[0237] CCTGGTTTCTCTTCATCAGAATTAAAGCAGATATTTTTGTGGCGGCCGTGGATTTCCATTCATCTGATGATCAGCTAGTA

[0238] ATATTCTGCAAGTGCCTTCCGATAGAATTGAGCGATGATTCTGAGGTCAGATACTCATCAGATGCTCGAAGGATAAGTGG

[0239] GTTTCAGACGATGCTGCAAAAGATATTAGCCGGCGAGTGAGGTGAGGCTACTAGCCTACTAGGCTTATCGCCTTGTATAA

[0240] AACTAAAGGAGTCAGTACAGAGACATCAGGTAAAGTCAGCATATGCAGCTATCCATCTATGCATGCATGCACCAACTGCA

[0241] AAGTAAAGGTAAAAGTGAAAGCTTTGTCTCTCCAGGTGTATGGAAGAAAATTATCCTTGTGATGGTTATGCAACTCACTCT

[0242] TTTGTTTGCACCCAGATATGTCATATTGGCTTTTCACCATGGTGTCAAGGTTGATGTGAATGTGAATGTGATTCTACTA

[0243] ATTTGAGGTCATGTAGAGTAATTAAGTAAGCAAATGGAGCCCGTCATGTCGTCATGCACTGACAAGGATATAGTCCTATG

[0244] GACCTCTATTTTGATTAATTGGTGGAGAAAATTCAGAGGAAAAATATGTGTGTGCTGGAATATGTTGGTATTTTTTTTTT

[0245] ACAA-3'.

[0246] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Application of regulating the expression of the CTH motif in OsD3 protein in increasing the number of rice tillers; The CTH motif is any one of the following: A1) The amino acid sequence is the polypeptide from positions 693 to 720 of SEQ ID No. 1; A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of any of the amino acids shown in A1); The regulation is to upregulate or enhance or increase the expression of the gene encoding the CTH motif, or the content or activity of the CTH motif.

2. Application of substances that regulate the expression of the CTH motif of OsD3 protein in the preparation of products that increase the number of rice tillers; The CTH motif is any one of the following: A1) The amino acid sequence is the polypeptide from positions 693 to 720 of SEQ ID No. 1; A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of any of the amino acids shown in A1); The substance is a biological material, and the biological material is any one of the following: B9) Nucleic acid molecules encoding the CTH motif; B10), an expression cassette containing the nucleic acid molecule described in B9); B11), a recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10; B12) recombinant microorganisms containing the nucleic acid molecules described in B9), or recombinant microorganisms containing the expression cassette described in B10; B13), a transgenic plant cell line containing the nucleic acid molecule described in B9), or a transgenic plant cell line containing the expression cassette described in B10; B14) transgenic plant tissue containing the nucleic acid molecules described in B9), or transgenic plant tissue containing the expression cassette described in B10; B15), transgenic plant organs containing the nucleic acid molecules described in B9), or transgenic plant organs containing the expression cassette described in B10).

3. A method for increasing the number of tillers in rice, comprising the following steps: upregulating or enhancing or increasing the expression of the gene encoding the CTH motif as described in claim 1 or the activity and / or content of the CTH motif in the target plant, thereby increasing the number of tillers in the target plant.