SNP molecular markers associated with proanthocyanidin content in apple and their applications

By locating SNP sites related to proanthocyanidin content in the apple genome and combining PCR amplification and enzyme digestion techniques, the problem of low proanthocyanidin content in apple breeding was solved, enabling efficient breeding selection and accurate fruit prediction, and promoting the development of apple breeding technology.

CN119287061BActive Publication Date: 2025-09-23NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411563728.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-05
Publication Date
2025-09-23
Estimated Expiration
2044-11-05

AI Technical Summary

Technical Problem

In existing technologies, apple cultivars have low proanthocyanidin content, and the influence of genetic factors on them has not been effectively utilized. There is a lack of molecular markers related to proanthocyanidin content, making it difficult to increase the proanthocyanidin content in apples through breeding.

Method used

We provided SNP molecular markers related to the proanthocyanidin content trait in apples, including three SNP sites located at specific positions on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1. These SNPs were located to the promoter region of the MdMYB7 gene through genome-wide association analysis and genome annotation information. PCR amplification and enzyme digestion were performed using primer sets to identify or select apple varieties with high proanthocyanidin content from high-altitude areas.

Benefits of technology

It enables accurate prediction of proanthocyanidin content in apple fruits during the seedling stage, improves the accuracy and efficiency of breeding selection, shortens the breeding cycle, and provides technical support for the establishment of an apple molecular marker-assisted breeding technology system. The detection accuracy rate reached 91.30%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119287061B_ABST
    Figure CN119287061B_ABST
Patent Text Reader

Abstract

The present invention discloses SNP molecular markers related to the proanthocyanidin content trait of apple and their applications, belonging to the technical field of apple genetic breeding. The SNP molecular markers related to the proanthocyanidin content trait of apple include three SNP sites, which are located at positions 2,107,657, 2,107,668 and 2,107,716 of chromosome 16 of the Golden Delicious apple reference genome GDDH13v1.1, respectively, and their alleles are A, T, T or G, C, C. The present invention uses GWAS analysis to identify SNP molecular markers that affect the proanthocyanidin content of apple. The log- 10 A (p) value greater than 8 indicates a significant correlation with the apple proanthocyanidin content trait. Based on the SNP sites provided by the present invention, selecting dominant genotypes that are beneficial for increasing apple proanthocyanidin content for apple breeding can effectively shorten the hybrid breeding period and achieve precise and efficient breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of apple genetic breeding, and relates to a SNP molecular marker related to apple proanthocyanidin content traits and an application thereof. Background Art

[0002] Proanthocyanidins are a class of polyphenolic compounds produced by plants through the flavonoid pathway. Structurally, proanthocyanidins are a mixture of polyphenols formed by varying amounts of catechins or epicatechins. Heating in an acidic medium produces anthocyanidins, which have been shown to have anti-cancer and anti-cancer properties, prevent and treat vascular sclerosis, fight aging, and enhance immunity. Apple fruit is rich in nutrients such as carbohydrates, organic acids, and polyphenols, with proanthocyanidins comprising the largest proportion of its polyphenolic compounds. Proanthocyanidins are abundant in the fruits of wild species of the genus Malus and their wild relatives, but are generally lower in modern cultivated apple varieties. While proanthocyanidin content is influenced by factors such as ripening time and environmental factors, genetic factors play a major role. Therefore, exploring the genetic factors associated with proanthocyanidin content is crucial for the breeding of high-quality apple varieties.

[0003] Molecular marker technology (Molecular Marker Technology) is a genetic marker method based on DNA sequence variation, which is widely used in many fields such as genetic breeding, gene positioning, and species kinship identification. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genomic level, including conversion, transversion, insertion or deletion of a single base pair. SNP has the characteristics of high density, genetic stability, and ease of automation and large-scale detection in the genome, and has developed into a more common molecular marker in animal genetic variation research. In recent years, molecular markers related to apple fruit color, polysaccharides, malic acid, fruit shape, etc. have been developed and utilized, but molecular markers for proanthocyanidin content have not been reported. Therefore, studying a molecular marker related to proanthocyanidin content is very important for the creation of new apple germplasm. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention provides SNP molecular markers related to the proanthocyanidin content trait of apple and their applications. The SNP molecular markers related to the proanthocyanidin content trait of apple include three SNP sites, which are located at positions 2,107,657, 2,107,668 and 2,107,716 of chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1, and their alleles are A, T, T or G, C, C. The -log of the SNP molecular markers of the present invention 10A (p) value greater than 8 indicates a significant correlation with the apple proanthocyanidin content trait. When the genotype of the apple genome at the three SNP sites is A, T, T homozygous or A, T, T / G, C, C heterozygous, the apple proanthocyanidin content is high; when the genotype of the apple genome at the three SNP sites is G, C, C homozygous, the apple proanthocyanidin content is low. The SNP sites provided by the present invention can be used to predict the proanthocyanidin content in apple fruit at the seedling stage in apple breeding, providing assistance for the establishment of an apple molecular marker-assisted breeding technology system.

[0005] To achieve the technical objectives of the present invention, on the one hand, the present invention provides SNP molecular markers related to the proanthocyanidin content trait of apple, wherein the SNP molecular markers include three SNP sites, which are located at positions 2,107,657, 2,107,668 and 2,107,716 of chromosome 16 of the Golden Delicious apple reference genome GDDH13v1.1, respectively. The three SNP sites are highly linked, and their alleles are A, T, T or G, C, C.

[0006] Furthermore, among the SNP molecular markers provided by the present invention, the genotypes of apples at the three SNP sites are A, T, and T homozygous, and the proanthocyanidin B2 content is 33989.93~22301683.17 ng / g; the genotypes of apples at the three SNP sites are A, T, T / G, C, and C heterozygous, and the proanthocyanidin B2 content is 58921.96~18842104.41 ng / g; the genotypes of apples at the three SNP sites are G, C, and C homozygous, and the proanthocyanidin B2 content is 86304.96~13252022.20 ng / g.

[0007] Specifically, genome-wide association analysis revealed that a single-nucleotide polymorphism (SNP) associated with proanthocyanidin B1 and B2 content was significantly localized to chromosome 16 of the Golden Delicious apple reference genome, GDDH13 v1.1. Combined with genome annotation information, this SNP was mapped to the promoter of the MdMYB7 gene. This SNP, located in the MdMYB7 promoter region, was significantly associated with proanthocyanidin content.

[0008] On the other hand, the present invention requests protection for the use of the above-mentioned SNP sites in identifying or breeding apple varieties with high anthocyanin content, wherein the genotype of the apple varieties with high anthocyanin content at the three SNP sites is A, T, T homozygous or A, T, T / G, C, C heterozygous.

[0009] On the other hand, the present invention claims protection for a primer set for detecting the above-mentioned SNP site, wherein the upstream primer is GGCCCATAACTATAGCGTTACAACA and the downstream primer is CTATCATTTCTCGTGTGCCCACA.

[0010] On the other hand, the present invention claims protection for a kit comprising the above primer set for detecting the genotype of the SNP site at position 2,107,716 on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1.

[0011] Furthermore, the present invention claims a method for identifying or breeding apple varieties with high anthocyanin content, comprising the following steps:

[0012] S1. Extract genomic DNA from the apple plant to be tested;

[0013] S2. performing PCR amplification using the above primer set to obtain a PCR amplification product;

[0014] S3. Sequencing the PCR amplification product to obtain a sequencing result, or digesting the PCR product with restriction endonuclease XmnI, and then displaying the result by agarose gel electrophoresis;

[0015] S4. Compare the sequencing results or agarose gel electrophoresis results to determine the proanthocyanidin content of the fruit of the tested apple plant.

[0016] Furthermore, the genotype of the high-altitude anthocyanin content apple variety at the three SNP sites is A, T, T homozygous or A, T, T / G, C, C heterozygous. The nucleotide sequence of the amplified product is at least one of SEQ ID NO: 1 and SEQ ID NO: 2.

[0017] Furthermore, the agarose gel electrophoresis results showed a band with a length of 788bp, indicating that the genotype of the apple variety at the three SNP sites was A, T, and T homozygous; the agarose gel electrophoresis results showed bands with lengths of 557bp and 232bp, indicating that the genotype of the apple variety at the three SNP sites was G, C, and C homozygous; the agarose gel electrophoresis results showed three bands with lengths of 788bp, 557bp, and 232bp, indicating that the genotype of the apple variety at the three SNP sites was A, T, T / G, C, and C heterozygous.

[0018] Specifically, the accuracy rate of predicting the proanthocyanidin content by identifying the SNP molecular marker related to the proanthocyanidin content trait through the above method in the present invention is 86.95%.

[0019] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0020] (1) The SNP site provided by the present invention is significantly correlated with the proanthocyanidin content trait of apple. The present invention found through genome-wide association analysis that the SNP site associated with the proanthocyanidin B1 and B2 content traits was significantly located on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1. Combined with the genome annotation information, it was found that the SNP site was located on the promoter of the MdMYB7 gene. The -log 10 A (p) value greater than 8 indicates a significant correlation with apple proanthocyanidin content. The SNP site located in the promoter region of the MdMYB7 gene is significantly correlated with proanthocyanidin content.

[0021] (2) The present invention provides a method for identifying or breeding apple varieties with high anthocyanin content. Using a primer set that detects a single nucleotide polymorphism (SNP), the method can be used to predict the proanthocyanidin content in apple fruit during the seedling stage of apple breeding, thereby assisting in the establishment of a molecular marker-assisted breeding system for apples. The accuracy of the method in identifying genotypes at SNP molecular markers associated with proanthocyanidin content was 91.30%.

[0022] (3) This invention provides a new technical approach for the selection and breeding of high-quality anthocyanin-rich apple germplasm from a molecular biology perspective, laying the foundation for genetic improvement of apple proanthocyanidin content. The SNP loci of this invention can be applied to the identification and variety selection of high-quality anthocyanin-rich apple germplasm, effectively improving the accuracy and efficiency of selection in breeding, reducing the breeding workload, and shortening the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention.

[0024] Figure 1 These are the Manhattan plots, QQ plots, and the resulting plots of the whole-genome association analysis combined with the Manhattan plot and genome annotation information. Figure 1 A in the figure is the Manhattan plot of SNP sites related to proanthocyanidin B1 content; Figure 1 B in the figure is the QQ plot of SNP sites related to proanthocyanidin B1 content; Figure 1 C in the figure is the Manhattan plot of SNP sites related to proanthocyanidin B2 content; Figure 1 D in the figure is the QQ plot of SNP sites related to proanthocyanidin B2 content; Figure 1 E in the figure is the result graph obtained by combining the Manhattan graph with the genome annotation information.

[0025] Figure 2It is a scatter box plot of the contents of proanthocyanidin B1 and proanthocyanidin B2 under different genotypes. Figure 2 A in the figure is a scatter plot of the proanthocyanidin B1 content in different genotypes; Figure 2 B in the figure is a scatter plot of the proanthocyanidin B2 content under different genotypes.

[0026] Figure 3 The agarose gel electrophoresis results of PCR amplification products of 23 apple samples are shown. DETAILED DESCRIPTION

[0027] The technical solutions of the present invention are described below with reference to the following examples. However, the present invention is not limited to the following examples. The experimental methods and detection methods described in each example are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0028] Example 1

[0029] This example provides screening for SNP sites associated with proanthocyanidin content.

[0030] A total of 120 apple accessions were collected (Table 1). The proanthocyanidin (PCB1) and PCB2 content of mature fruit from each accession were determined using high-performance liquid chromatography (HPLC) (Table 1). Genome-wide association studies (GWAS) were also performed to identify single-nucleotide polymorphisms (SNPs) associated with proanthocyanidin content in fruit. DNA was extracted from leaves of each accession using the CTAB method. Sequencing libraries were constructed using at least 5 μg of genomic DNA per sample according to the NEBNext Ultra DNA Library Prep Kit (purchased from New England Biotechnology (Beijing) Co., Ltd.) instructions. Sequencing was performed using an Illumina HiSeq 4000 sequencer. Sequencing results were aligned with the Golden Delicious apple reference genome, GDDH13 v1.1. SNP variants were detected using Hapl otypeCaller (GATK (version 3.8)) developed by McKenna et al. (2010). Association analyses were performed using the GEMMA software package, and GWAS analyses were performed using mixed linear models (MLM). SNPs were identified and annotated using the ANNOVAR software package developed by Wang et al. (2010). Manhattan plots, QQ plots, and gene annotation plots were drawn using the CMplt package (Yin L, 2018). Figure 1), using the Bonferroni correction as the threshold for SNP-trait association (Jian et al.; Xu et al., 2015). Three SNP loci associated with proanthocyanidin B1 and B2 content traits were identified through genome-wide association analysis. These loci are located at positions 2,107,657, 2,107,668, and 2,107,716 on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1, respectively. The alleles at these SNP loci are A, T, T, or G, C, C, respectively. The genotypes of apples from different germplasm resources at the SNP molecular markers are shown in Table 1. Table 1: Proanthocyanidin B1 and B2 content and genotypes at the SNP molecular markers in apples from different germplasm resources

[0031]

[0032]

[0033]

[0034] As shown in Table 1, the content of proanthocyanidin B2 in mature apple fruit is relatively rich, and the content of proanthocyanidin B2 is significantly higher than that of proanthocyanidin B1. The lowest content of proanthocyanidin B2 is 33989.93 ng /

[0035] g, with the highest being 22301683.17 ng / g. The variation range of proanthocyanidin content in apple fruits among different germplasms was large.

[0036] The coefficient of variation was 115.99%. For apples homozygous for the three SNPs (A, T, T) genotypes, the proanthocyanidin B2 content ranged from 33,989.93 to 22,301,683.17 ng / g; for apples heterozygous for the three SNPs (A, T, T / G, C, C) genotypes, the proanthocyanidin B2 content ranged from 58,921.96 to 18,842,104.41 ng / g; and for apples homozygous for the three SNPs (G, C, C) genotypes, the proanthocyanidin B2 content ranged from 86,304.96 to 13,252,022.20 ng / g. Furthermore, the proanthocyanidin B2 content was higher in wild apple fruits and lower in cultivated apple fruits, consistent with trends in apple domestication and improvement. The proanthocyanidin content in fruits from natural populations generally conformed to a normal distribution. These results indicate that the content of proanthocyanidins in fruit is a typical quantitative trait controlled by polygenes with minor effects.

[0037] Depend on Figure 1It can be seen that the SNP site related to the content of proanthocyanidins B1 and B2 was significantly located on chromosome 16 of the Golden Crown apple reference genome GDDH13 v1.1 through genome-wide association analysis. Combined with the genome annotation information, it was found that the SNP site was located on the promoter of the MdMYB7 gene. The -log 10 (p) value greater than 8 indicates significant correlation with apple proanthocyanidin content. Figure 2 It can be seen that the SNP site located in the promoter region of the MdMYB7 gene is significantly correlated with the proanthocyanidin content.

[0038] Example 2

[0039] This example provides a method for identifying the genotype at the SNP molecular marker associated with the proanthocyanidin content.

[0040] The SNP marker associated with proanthocyanidin content contains three highly linked SNPs. Enzyme digestion of one of these SNPs confirms the genotype at the SNP marker. PCR amplification was performed on 23 apple accessions at bp 2,107,716 (the third SNP) on chromosome 16 of the Golden Delicious apple reference genome, GDDH13 v1.1 (Table 2). Genomic DNA from the test apples was used as a template and a primer pair upstream and downstream of the SNP was used as amplification primers (Primer F: GGCCCATAACTATAGCGTTACAACA; Primer R: CTATCATTTCTCGTGT GCCCACA). The amplified product was at least one of SEQ ID NO: 1 and SEQ ID NO: 2. The amplification protocol was as follows: 95°C for 5 min; 95°C for 15 s; 55°C for 15 s; 72°C for 30 s, 35 cycles; and 72°C for 5 min. The PCR amplification product was cut with restriction endonuclease (XmnI) and the results were displayed by 2% agarose gel electrophoresis ( Figure 3 ), if the PCR fragment amplified in the genome to be tested cannot be digested by enzyme, a band with a length of 788 bp is displayed on the agarose gel, indicating that the genotype of the genome to be tested at the third SNP site is TT, and it is speculated that it has a higher proanthocyanidin content; if the PCR fragment amplified in the genome to be tested is digested into two bands, bands with lengths of 557 bp and 232 bp are displayed on the agarose gel, indicating that the genotype of the genome to be tested at the third SNP site is CC, and it is speculated that it has a lower proanthocyanidin content; if the PCR fragment amplified in the genome to be tested is digested by enzyme, three bands with lengths of 788 bp, 557 bp and 232 bp are displayed on the agarose gel, indicating that the genotype of the genome to be tested at the third SNP site is T / C heterozygous, and it is speculated that it has a higher proanthocyanidin content.

[0041] Table 2: Genotypes of 23 apple germplasm resources

[0042] serial number Apple varieties genotype A47 Hanfu TT 59 Challenger TT 268 Hong Rou 2 TT 287 Pound Sweet TT 345 Early red one TT 9 Idared T / C 176 R8 T / C A44 Gloster69 T / C 366 Modi T / C A74 Bian Guo Hai Tang T / C 251 Simcoe T / C 106 Hongxun No. 1 CC 182 H3 CC 114 Huang Taiping CC 142 Hartwigii CC 92 Begonia variegata CC 112 Brevipes CC 116 Arnoldiana CC 93 Robinson CC 331 Kobendza CC C7 Orthocarpa CC 99 Begonia octylsphenes CC B14 Florentina CC

[0043] Comparing the genotypes detected in Table 2 with the genotypes of actual apple samples (Table 1), it is known that the method of the present invention for detecting the genotypes at the SNP molecular markers associated with the proanthocyanidin content trait has a detection accuracy of 91.30%.

[0044] The embodiments described above are some of the embodiments of the present invention, rather than all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but rather merely represents selected embodiments of the present invention. All other embodiments obtained without creative effort and through deduction and substitution by a person of ordinary skill in the art based on the concept of the present invention are within the scope of protection of the present invention.

Claims

1. Application of a primer set for detecting SNP molecular markers in identifying or breeding high-altitude anthocyanin content apple varieties, characterized in that: The three SNP sites of the SNP molecular marker are located at positions 2,107,657, 2,107,668 and 2,107,716 on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1; The three SNP sites are highly linked; The upstream primer of the primer set is GGCCCATAACTATAGCGTTACAACA; The downstream primer of the primer set is CTATCATTTCTCGTGTGCCCACA; The genotype of the high-altitude anthocyanin content apple variety at the three SNP sites is A, T, T homozygous or A, T, T / G, C, C heterozygous.

2. A method for identifying or breeding high-quality anthocyanin apple varieties, characterized in that: Using the primer set for detecting SNP molecular markers according to claim 1, PCR amplification is performed to obtain an amplified product, and the amplified product is analyzed to determine whether the sample is the high-altitude anthocyanin content apple variety; The three SNP sites of the SNP molecular marker are located at positions 2,107,657, 2,107,668 and 2,107,716 on chromosome 16 of the Golden Delicious apple reference genome GDDH13 v1.1; The three SNP sites are highly linked; The genotype of the plateau anthocyanin content apple variety at the three SNP sites is A, T, T homozygous or A, T, T / G, C, C heterozygous.

3. The method according to claim 2, characterized in that The nucleotide sequence of the amplified product is at least one of SEQ ID NO: 1 and SEQ ID NO:

2.

4. The method according to claim 2, characterized in that The analysis is gene sequencing.

5. The method according to claim 2, characterized in that The analysis is performed by agarose gel electrophoresis, and the amplified product is digested with restriction endonuclease XmnI before the agarose gel electrophoresis. The agarose gel electrophoresis results showed a band of 788 bp in length, indicating that the genotype of the apple variety at the three SNP sites was homozygous for A, T, and T; The agarose gel electrophoresis results showed bands of 557 bp and 232 bp in length, indicating that the genotypes of the apple variety at the three SNP sites were homozygous for G, C, and C; The agarose gel electrophoresis results showed three bands with lengths of 788 bp, 557 bp and 232 bp, indicating that the genotypes of the apple variety at the three SNP sites were A, T, T / G, C, and C heterozygous.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker related to titratable acid content of apple and application of SNP molecular marker

    CN118326066A

  • DCAPS molecular marker for identifying fructose content of apple and application of dCAPS molecular marker

    CN118406787A