InDel molecular marker for identifying hybrid mandarin oranges in Yuan and application of InDel molecular marker

Abstract

The invention discloses an InDel molecular marker for identifying hybrid mandarin oranges in Yuan and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is shown as SEQ ID No.1. The invention further discloses a method for identifying the hybrid mandarin oranges in Yuan and Yuan. According to the invention, the InDel marker for identifying the hybrid mandarin of the yuan is successfully obtained, PCR (Polymerase Chain Reaction) amplification is carried out by virtue of a primer pair, the hybrid mandarin of the yuan is a 519bp long strip, and the products of other hybrid mandarin are 226bp or 277bp or both 226bp and 277bp short strips. When the marker is used for identifying the seedlings of the hybrid mandarin pears, the breeding workload can be reduced, and the seedling variety correctness can be ensured.

Description

Technical Field

[0001] The present invention relates to the technical field of citrus molecular markers, and in particular to an InDel molecular marker for identifying Yuanxiaochun hybrid citrus and an application thereof. Background Art

[0002] Yuan Xiaochun is an excellent hybrid citrus variety introduced from Japan. It was hybridized by Kiyomi and Golden Orange in the Ehime Fruit Tree Experimental Field in Japan in 1994, and applied for Japanese variety registration in 2007. Yuan Xiaochun fruit is spherical, slightly smooth, light lemon yellow, and easy to peel. The single fruit weighs about 125 grams, the flesh is soft and juicy, with a special aroma, and no seeds. When fully mature, the soluble solids are more than 15%, the acid is less than 0.8%, the quality is excellent, and the yield is high and stable. In recent years, it has been very popular among consumers and growers.

[0003] Yuan Xiaochun belongs to the category of hybrid citrus in the citrus classification. Its leaves are very similar to those of hybrid citrus varieties such as Shiranui, Harumi, and Haruhime. It is difficult to distinguish them from the morphology at the seedling stage. This gives some merchants an opportunity to pass off other hybrid citrus varieties as Yuan Xiaochun, seriously damaging the rights and interests of growers. If DNA molecular markers can be used to achieve early selection at the seedling stage, it will greatly reduce the losses of growers and reduce the occurrence of "substituting inferior products for good ones" and seedling confusion. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an InDel molecular marker for identifying Yuan Xiaochun hybrid citrus and its application; the present invention can directly judge the genotype of each material from the gel map, so as to quickly identify whether the hybrid citrus variety is Yuan Xiaochun in the seedling stage, overcoming the shortcomings of traditional phenotypic identification that is time-consuming, labor-intensive and has a low accuracy rate.

[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0006] The present invention provides an InDel molecular marker for identifying Yuanxiaochun hybrid citrus, and the nucleotide sequence of the InDel molecular marker is as shown in SEQ ID No.1:

[0007] TAGCTAACAAGTAATTAATCAATATAACAACAGTATGTGGTGTGACTGTCCTTCACAACAGTTTTTTTTTTTTTCTTTTAATCACGAAATATTTGGAAAGGACCTTCGTTATAAAAGGCATCTTTAAATTCGGATCATAATTTAAATTAAAAATCCCTA CTTGAATAAAAAAAATACAAATTCTCCCAATAAAAATAATTTCACTGTAATTCAAACTGATAAATAAACTAAATCAAATTACTCAAAGAAGCTCCATTATCAACGGAGCCAACTCTTTATCGGTCCTTCACAACAGTTGTTAAATAGCTAACAACTCACC.

[0008] The primer pair A21-F / R used to obtain the above-mentioned InDel molecular marker is characterized in that: the primer pair A21-F / R is:

[0009] Forward primer A21-F: ATTGACCATTCAAACGTTGCTCTT, as shown in SEQ ID No. 2;

[0010] Reverse primer A21-R: CAAATTGATGACGTGTCCTTCACA, as shown in SEQ ID No.3.

[0011] The present invention also provides an application of the primer pair A21-F / R in identifying Yuanxiaochun hybrid citrus or preparing a kit for identifying Yuanxiaochun hybrid citrus.

[0012] Based on the results of whole genome resequencing, the present invention develops the above-mentioned InDel marker primer with good polymorphism. Using this pair of primers, the Yuan Xiaochun hybrid citrus can be distinguished from other citrus varieties, providing a basis for the early and accurate identification of the Yuan Xiaochun hybrid citrus variety.

[0013] The invention also provides a kit for identifying Yuanxiaochun hybrid citrus, wherein the kit contains the primer pair A21-F / R.

[0014] The present invention also provides a method for identifying Yuanxiaochun hybrid citrus, comprising the following steps:

[0015] 1) Extracting genomic DNA from the sample to be tested,

[0016] 2) using the above genomic DNA as a template, using the above primers A21-F / R or the kit described in claim 4 to perform PCR amplification to obtain a PCR product;

[0017] 3) PCR product electrophoresis detection, the detection results are analyzed as follows:

[0018] When a 519 bp band 1 is displayed, the band 1 contains an InDel molecular marker (the nucleotide sequence is shown as SEQ ID No. 1), and the variety to be tested is Yuan Xiaochun hybrid citrus.

[0019] When any one or two small fragment bands less than 300 bp are displayed, the variety to be tested is another citrus variety; wherein the two small fragment bands are band 2 of 277 bp and band 3 of 226 bp.

[0020] Furthermore, in step 2), the system of PCR amplification is as follows:

[0021] Mix 7μl Forward primer A21-F (10mmol / L) 0.3μl Reverse primer A21-R (10mmol / L) 0.3μl Genomic DNA 1.5μl <![CDATA[dd H2O]]> 5.9μl total 15μl

[0022] The PCR amplification procedure included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; and extension at 72°C for another 5 min.

[0023] When the primer set or kit of the present invention is used for the identification, PCR amplification and agarose gel electrophoresis are used to retain the primers with clear gel images and sizes that are completely consistent with the predictions (i.e., a 519 bp band containing an InDel molecular marker, whose nucleotide sequence is as shown in SEQ ID No. 1), the variety to be tested is Yuan Xiaochun mixed citrus; when one or two bands less than 300 bp are visible in the primer amplification, it indicates that the variety to be tested is other citrus varieties, and there is a size difference that can be distinguished by the gel image, which can be determined as a marker with good effect that can be used. The agarose gel electrophoresis of the present invention preferably uses a 2% agarose gel by mass, a voltage of 120V, and electrophoresis for 15-20min.

[0024] The present invention also provides an application of the primer pair A21-F / R or the kit in early identification of Yuanxiaochun hybrid citrus.

[0025] The primer set or kit of the present invention can be used for early identification, using young leaves of young trees, so the genomic DNA is preferably extracted from young leaves. The present invention does not specifically limit the method for extracting the genomic DNA, preferably using the CTAB method or the kit method.

[0026] The present invention also provides an application of the primer pair A21-F / R or the kit in hybrid citrus breeding.

[0027] Beneficial effects of the present invention:

[0028] The present invention successfully obtains an InDel marker for identifying Yuanxiaochun hybrid citrus. The present invention performs PCR amplification through a primer pair. The product of Yuanxiaochun hybrid citrus is a long band of 519 bp, and the products of other hybrid citrus are a short band of 226 bp or 277 bp or both. Using the marker to identify Yuanxiaochun hybrid citrus seedlings can reduce the workload of breeding and ensure the correctness of seedling varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The electrophoresis diagram of PCR products of 48 samples to be tested is shown in Figure 2.

[0030] In the picture, 1 represents 439 orange; 2 represents Hime Koharu; 3 represents seedless orange; 4 represents Asumimi; 5 represents Ehime 68; 6 represents Ehime 46; 7 represents Haruhime; 8 represents Ehime 28; 9 represents Kiyomi; 10 represents Sunshine One tangerine; 11 represents Amakusa; 12 represents Tsu no Kashi; 13 represents Yoka; 14 represents Nishi no Kashi; 15 represents Ganpei; 16 represents Golden Autumn Sugar Mandarin; 17 represents Qiuhui; 18 represents Nichiki; 19 represents W. Murcott; 20 represents Wogan; 21 represents Shiranui; 22 represents Harumimi; 23 represents Ehime 34; 24 represents Haruka tangerine; 25 represents The first one is Ou tangerine; 26 is tangerine; 27 is Mantouhong Zhuju; 28 is Rinan No. 1; 29 is Siji tangerine; 30 is Hongguang; 31 is Kishu; 32 is Xingjin; 33 is Miguang; 34 is Zhuhong tangerine; 35 is Yamashitahong; 36 is Shatang tangerine; 37 is Oita No. 1; 38 is Nangan No. 20; 39 is Shuangjin No. 1; 40 is Dapu No. 5; 41 is Xinyu Mitangerine; 42 is Sanhu Hongtangerine; 43 is Sanhu Huahong; 44 is Ponkan; 45 is Zhuju; 46 is Jiangan; 47 is Yangxiao 26; 48 is Gongchuan. Numbers 1-24 are hybrid tangerine varieties, and numbers 25-48 are wide-skinned tangerine varieties. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0032] Example 1

[0033] Based on the results of whole genome resequencing, compared with the genomes of other varieties, Yuan Xiaochun hybrid orange was found to have a highly polymorphic unique fragment at 23272035bp on chromosome 7. This fragment was named InDel molecular marker, and its nucleotide sequence is shown in SEQ ID No. 1:

[0034] TAGCTAACAAGTAATTAATCAATATAACAACAGTATGTGGTGTGACTGTCCTTCACAACAGTTTTTTTTTTTTTCTTTTAATCACGAAATATTTGGAAAGGACCTTCGTTATAAAAGGCATCTTTAAATTCGGATCATAATTTAAATTAAAAATCCCTA CTTGAATAAAAAAAATACAAATTCTCCCAATAAAAATAATTTCACTGTAATTCAAACTGATAAATAAACTAAATCAAATTACTCAAAGAAGCTCCATTATCAACGGAGCCAACTCTTTATCGGTCCTTCACAACAGTTGTTAAATAGCTAACAACTCACC.

[0035] Example 2

[0036] The above InDel molecular markers are designed with primer pairs:

[0037] Forward primer A21-F: ATTGACCATTCAAACGTTGCTCTT, as shown in SEQ ID No. 2;

[0038] Reverse primer A21-R: CAAATTGATGACGTGTCCTTCACA, as shown in SEQ ID No.3.

[0039] The primers synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. were commissioned to perform PCR amplification using the genome of Yuan Xiaochun Citrus aurantium as a template. The PCR product was detected by electrophoresis. When the detection showed a 519 bp band 1, the band 1 contained an InDel molecular marker (the nucleotide sequence is shown in SEQ ID No. 1), and the nucleotide sequence of the band 1 is shown in SEQ ID No. 4:

[0040] ATTGACCATTCAAACGTTGCTCTTTATATTAATATCCGCCTTCGACTTTTGCAAAAAAAAATTACGGCCGGCGGTCCAACAAGACGATCGCTCCGTTCATACATCTCCAAATCCAAACTCGTTAATGTGACGTCATCGTGTAAATAGCTAACAAGTAATTAATCAATATAACAACAGTATGTGGTGTGACTGTCCTTCACAACAGTTTTTTTTTTTTTTCTTTTAATCACGAAATATTTGGAAAGGACCTTCGTTAAA AGGCATCTTTAAATTCGGATCATAATTTAAATTAAAAATCCCTACTTGAATAAAAAAATACAAATTCTCCCAATAAAAATAATTTCACTGCAATTCAAACTGATAAATAAACTAAATCAAATTACTCAAAGAAGCTCCATTATCAACGGAGCCAACTCTTTATCGGTCCTTCACAACAGTTGTTAAATAGCTAACAACTCACCCGGCTTCAAGTCATTAATCAATTACAACAGCATGTGAAGGACACGTCATCAATTTG.

[0041] Example 3

[0042] A kit for identifying Yuan Xiaochun hybrid citrus contains the primer pair of the above-mentioned Example 2.

[0043] The method for identifying Yuan Xiaochun mixed citrus based on the kit comprises the following steps:

[0044] 1) Extracting genomic DNA from the sample to be tested,

[0045] 2) using the above genomic DNA as a template and using a primer pair to perform PCR amplification to obtain a PCR product; wherein,

[0046] The PCR amplification system is as follows:

[0047] Mix 7μl Forward primer F (10mmol / L) 0.3μl Reverse primer R (10mmol / L) 0.3μl Genomic DNA 1.5μl <![CDATA[dd H2O]]> 5.9μl total 15μl

[0048] The PCR amplification procedure included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; extension at 72°C for another 5 min;

[0049] 3) PCR product electrophoresis detection (using 2% agarose gel, voltage 120V, electrophoresis 15-20min), the detection results are analyzed as follows:

[0050] When a 519 bp band 1 is displayed, the band 1 contains an InDel molecular marker (the nucleotide sequence is shown as SEQ ID No. 1), and the variety to be tested is Yuan Xiaochun hybrid citrus.

[0051] When any one small fragment band or two small fragment bands are displayed, the variety to be tested is another citrus variety; wherein the two small fragment bands are respectively a band 2 of 298 bp and a band 3 of 350 bp;

[0052] The nucleotide sequence of band 2 of 226 bp is shown in SEQ ID No.5:

[0053] ATTGACCATTCAAACGTTGCTCTTTATATTAATATCCGCCTTCGACTTTTGCAAAAGAAATTACGGCCGGCGGTCCAACATGACGATCGCTCCGTTCATACATCTCCAAATCCAAACTCGTTAATGTGACGTCATCGTGTAAACAGTTGTTAAATACCTAACAACTCACGCGGCTTCAAGTCATTAATCAATTACAACAGCATGTGAAGGACACGTCATCAATTTG;

[0054] The nucleotide sequence of band 3 of 277 bp is shown in SEQ ID No.6:

[0055] ATTGACCATTCAAACGTTGCTCTTTATATTAATATCCGCCTTCGACTTTTGCAAAAGAAATTACGGCCGGCGGTCCAACATGACGATCGCTCCGTTCATACATCTCCAAATCCAAACTCGTTAATGTGACGTCATCGTG TAAATAGCTAACAAGTAATTAATCAATAACAACAGTATGTGACTGTCCTTCACAACAGTTGTTAAATACCCAACAACTCACGCGGCTTCAAGTCATTAATCAATTACAACAGCATGTGAAGGACACGTCATCAATTTG.

[0056] Example 4

[0057] The kit of Example 3 is used to detect Yuanxiaochun hybrid citrus and other hybrid citrus varieties and wide-skinned citrus, and the specific steps are as follows:

[0058] 1) Extracting genomic DNA from leaves of Yuanxiaochun hybrid citrus, other hybrid citrus varieties and wide-skinned citrus,

[0059] 2) using the above genomic DNA as a template and using a primer pair to perform PCR amplification to obtain a PCR product; wherein,

[0060] The PCR amplification system is as follows:

[0061] Mix 7μl Forward primer F (10mmol / L) 0.3μl Reverse primer R (10mmol / L) 0.3μl Genomic DNA 1.5μl <![CDATA[dd H2O]]> 5.9μl total 15μl

[0062] The PCR amplification procedure included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; extension at 72°C for another 5 min;

[0063] 3) PCR product electrophoresis detection (using 2% agarose gel, voltage 120V, electrophoresis 15-20min), the detection results are analyzed as follows:

[0064] The results are as follows Figure 1 As shown: the bands of PCR products in other lanes are all 226bp bands and / or 277bp bands, which correspond to other citrus varieties (including hybrid citrus varieties and wide-skinned citrus). Only lane 2 amplified a 519bp fragment band, which is Yuan Xiaochun hybrid citrus, and can be determined as a marker with good effect that can be used.

[0065] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An InDel molecular marker for identifying Yuanxiaochun hybrid citrus, characterized in that: The nucleotide sequence of the InDel molecular marker is shown as SEQ ID No.

1.

2. The primer pair A21-F / R for obtaining the InDel molecular marker according to claim 1, characterized in that: The primer pair A21-F / R is: Forward primer A21-F: ATTGACCATTCAAACGTTGCTCTT; Reverse primer A21-R: CAAATTGATGACGTGTCCTTCACA.

3. Use of the primer pair A21-F / R according to claim 2 in identifying Yuanxiaochun hybrid citrus or preparing a kit for identifying Yuanxiaochun hybrid citrus.

4. A kit for identifying Yuanxiaochun mixed citrus, characterized in that: The kit contains the primer pair A21-F / R described in claim 2.

5. A method for identifying Yuanxiaochun mixed citrus, characterized in that: The following steps are involved: 1) Extracting genomic DNA from the sample to be tested, 2) using the above genomic DNA as a template, and using the primer pair A21-F / R described in claim 2 or the kit described in claim 4 to perform PCR amplification to obtain a PCR product; 3) PCR product electrophoresis detection, the detection results are analyzed as follows: When a 519 bp band is displayed, the band contains an InDel molecular marker, and the variety to be tested is Yuan Xiaochun hybrid citrus; When any one or two small fragment bands less than 300 bp are displayed, the variety to be tested is other citrus varieties.

6. The method according to claim 5, characterized in that: In the step 2), the system of PCR amplification is as follows: The PCR amplification procedure included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; and extension at 72°C for another 5 min.

7. Use of the primer pair A21-F / R according to claim 2 or the kit according to claim 4 in early identification of Yuanxiaochun hybrid citrus.

8. Use of the primer pair A21-F / R according to claim 2 or the kit according to claim 4 in hybrid citrus breeding.

Images