Molecular marker, method, primer pair, kit for identifying size trait of melon petal and application thereof

By developing molecular markers and primer pairs closely linked to the petal size trait of thin-skinned melons, and using PCR amplification and electrophoresis detection, we achieved marker-assisted selection of petal size in seedlings of thin-skinned melons, solving the problem of petal size identification in breeding and improving the accuracy and efficiency of breeding.

CN119287067BActive Publication Date: 2025-12-30NORTHEAST AGRICULTURAL UNIVERSITY +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411692167.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-25
Publication Date
2025-12-30
Estimated Expiration
2044-11-25

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently and accurately identify and screen for the petal size trait in thin-skinned melons during the breeding process, thus affecting breeding efficiency.

Method used

Molecular markers closely linked to the petal size trait of thin-skinned melons were developed. Primer pairs were designed using InDel molecular markers, and molecular marker-assisted selection of petal size at the seedling stage was achieved by PCR amplification and polyacrylamide gel electrophoresis detection.

Benefits of technology

It improved the accuracy and efficiency of breeding for thin-skinned melon petal size, simplified the breeding process, and shortened the breeding time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119287067B_ABST
    Figure CN119287067B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker for identifying a petal size trait of a muskmelon, a method, a primer pair, a kit and application thereof, and belongs to the technical field of molecular marker assisted breeding. In order to obtain a chromosome segment and a molecular marker closely linked to the petal size of the muskmelon, the application provides the molecular marker for identifying the petal size trait of the muskmelon, and the molecular marker is shown in SEQ ID NO. 1 or SEQ ID NO. 2. The identification method can realize the identification of the petal size of the muskmelon by extracting the genomic DNA of a sample of the muskmelon to be detected at a seedling stage, is simple to operate, and is high in accuracy and efficiency, and provides an effective breeding tool and technology for molecular marker assisted selection breeding of the petal size of the muskmelon.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology, specifically involving molecular markers, methods, primer pairs, kits, and applications for identifying the petal size trait of thin-skinned melons. Background Technology

[0002] melon( Cucumis melo *Calamus* (L.) is an annual vine-like herbaceous plant belonging to the genus *Calamus* in the family Cucurbitaceae. It is widely cultivated in my country and worldwide and is an important economic crop globally. The flower is a crucial reproductive organ of the melon, closely related to pollination quality and fruit set rate. The morphological development of the flower organs is a key stage in melon growth, directly affecting its growth and development. Thin-skinned melons (*Calamus*) Cucumis melo ssp. agrestis With a short maturation period and high quality, thick-skinned and thin-skinned melons exhibit distinct domestication patterns during evolution, and the regulatory genes governing phenotypic variation differ between the two subspecies. Therefore, in breeding, corresponding molecular markers should be selected for screening and identification based on different subspecies to ensure higher and more accurate breeding efficiency. Identifying key major loci affecting petal size in thin-skinned melons and applying them to germplasm resource screening and molecular breeding processes is of great significance.

[0003] InDel molecular markers are polymorphic molecular markers formed by the deletion and insertion of bases in chromosome sequences. These markers are widely distributed in the genome, easy to operate, and the results are easy to observe. They also have universal applicability to different germplasm resources of the same species. Therefore, it is of great significance to discover InDel molecular markers that can be used to identify the petal size trait in thin-skinned melons and to apply them to the screening of melon germplasm resources and the molecular breeding process. Summary of the Invention

[0004] The purpose of this invention is to apply molecular markers to the screening of thin-skinned melon germplasm resources with different petal sizes, to obtain chromosomal segments and molecular markers closely linked to the petal size of thin-skinned melons, and thus to more quickly and accurately identify the petal size of thin-skinned melons during the seedling stage.

[0005] This invention provides a molecular marker for identifying the size trait of petals in thin-skinned melons, the molecular marker being shown in SEQ ID NO.1 or SEQ ID NO.2.

[0006] This invention provides a primer pair for amplifying and identifying molecular markers for the size trait of thin-skinned melon petals, the sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0007] This invention provides a kit for identifying the size of petals in thin-skinned melons, the kit comprising the primer pairs described above.

[0008] This invention provides the application of the above-mentioned molecular marker, primer pair, or kit in identifying the size trait of thin-skinned melon petals.

[0009] This invention provides the application of the above-mentioned molecular marker, primer pair, or kit in the auxiliary identification, auxiliary breeding, and screening of petal size traits in thin-skinned melons.

[0010] Further, the petal length of the large-petal type ranges from 16.6 mm to 20.7 mm, and the petal width ranges from 11.7 mm to 14.9 mm, while the petal length of the small-petal type ranges from 8.6 mm to 12.8 mm, and the petal width ranges from 7.2 mm to 9.7 mm.

[0011] This invention provides a method for identifying the size of petals in thin-skinned melons, the method being as follows:

[0012] Step 1: Extract genomic DNA from the thin-skinned melon to be tested;

[0013] Step 2: Using the DNA obtained in Step 1 as a template, perform PCR amplification using the primer pairs described above, and obtain PCR products to determine the size and characteristics of the petals of the thin-skinned melon.

[0014] Further specifying the PCR reaction system in step 1, the following is provided: 1 μL each of upstream and downstream primers (primer concentration 2 pM), 2 μL of DNA template (concentration 30 ng / μL), 1 μL of 10×PCR Buffer (containing 15 mM Mg2+), 0.15 μL of dNTPs (concentration 10 mM), 0.1 μL of Taq enzyme (5 U / μL), and 6.75 μL of sterile deionized water; the PCR reaction program is as follows: 94℃ pre-denaturation for 7 min, 94℃ denaturation for 30 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles, 72℃ extension for 10 min, and storage at 4℃.

[0015] To further define the type, if the amplification product in step 2 contains a 204 bp fragment, it is determined to be of the large petal type; if the amplification product contains a 185 bp fragment, it is determined to be of the small petal type.

[0016] Further, the petal length of the large-petal type ranges from 16.6 mm to 20.7 mm, and the petal width ranges from 11.7 mm to 14.9 mm, while the petal length of the small-petal type ranges from 8.6 mm to 12.8 mm, and the petal width ranges from 7.2 mm to 9.7 mm.

[0017] Beneficial Effects: In the early stages of this invention, genetic populations were constructed using large-petaled (cultivated thin-skinned melon) and small-petaled (wild thin-skinned melon) varieties as parents. Genome resequencing and BSA-seq (Bulked Segregation Analysis) techniques were used to obtain chromosomal segments closely linked to the petal size trait in thin-skinned melons. Through two years of phenotypic identification and QTL (Quantitative Trait Loci) analysis within the genetic population, a stable major-effect mapping interval was obtained and named Cmqps8.1. An InDel molecular marker was developed within this major-effect chromosomal segment. This marker is located within the Cmqps8.1 mapping interval, a key site for the petal size trait in thin-skinned melons, and is closely linked to the petal size trait. Using marker-assisted selection, genomic DNA can be extracted from the seedlings of thin-skinned melons for marker-assisted selection of petal size, improving the accuracy and efficiency of breeding. This molecular marker can be applied to molecular breeding of thin-skinned melons, providing an efficient molecular breeding tool for the macromolecular identification of petals in thin-skinned melons.

[0018] This invention utilizes parental resequencing data to develop and design primer pairs based on molecular markers closely linked to the petal size trait of thin-skinned melons. Due to the polymorphism of short sequence insertions and deletions of this molecular marker fragment in different melon materials, PCR amplification of melon seedling genomic DNA using the obtained primer pairs, followed by detection of PCR product fragment size using polyacrylamide gel electrophoresis, allows for molecular identification of thin-skinned melon petal size at the seedling stage. This identification method can achieve petal size identification of thin-skinned melons simply by extracting genomic DNA from the seedling sample; it is simple to operate, accurate, and efficient, providing an effective breeding tool and technology for marker-assisted selection breeding of thin-skinned melon petal size. Attached Figure Description

[0019] Figure 1 For example, the major site of the petal size of the thin-skinned melon in Example 1. Cmqps8.1 Two-year positioning results; Figure A shows the results in 2023, and Figure B shows the results in 2024.

[0020] Figure 2 The image shows the results of polyacrylamide gel electrophoresis detection of the amplification products obtained by PCR amplification of large and small petal materials from natural populations using the primer pairs described in Example 2. Detailed Implementation

[0021] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. The processes, conditions, experimental methods and reagents for implementing the present invention, except for those specifically mentioned below, are all common knowledge in the field and conventional products on the market. The present invention does not have any special limitations.

[0022] Methods for extracting genomic DNA:

[0023] The method for extracting genomic DNA was based on that of Murray et al. (1980) (Murray M., Thompson WF, Rapid isolation of high molecular weight plant DNA [J]. Nucl. Acid. Res., 1980, 8: 668-673.), and was modified accordingly.

[0024] The specific steps are as follows:

[0025] (1) After washing and drying the collected tender true leaves with sterile water, take 0.2 g and put it into a 1.5 mL centrifuge tube. Add liquid nitrogen and grind it thoroughly until it becomes a white powder. Add 800 μL of 2% CTAB solution (2% CTAB, 100 mmol / L Tris-HCl pH=8.0, 1.4 mol / L NaCl, 20 mmol / L EDTA pH=8.0, 2% β-mercaptoethanol) preheated at 65℃ and mix thoroughly. Incubate in a water bath at 65℃ for 1 h, shaking gently every 10 min.

[0026] (2) Remove the centrifuge tube and let it cool to room temperature. Centrifuge at 13,000 rpm for 10 min. Aspirate the supernatant from the wall and place it in a new centrifuge tube. To prevent mechanical shearing from damaging the DNA, the tip of the pipette used for transfer should be cut off with scissors beforehand to enlarge the aspiration port.

[0027] (3) Add 750 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the wall, mix thoroughly, let stand for 10 min, and then centrifuge at 13000 rpm for 10 min.

[0028] (4) Take out the centrifuge tube and use the same treatment method as above to aspirate 700 μL of supernatant by sticking the pipette tip against the wall and place it in a new centrifuge tube.

[0029] (5) Add 700 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the wall of the centrifuge tube, gently shake the centrifuge tube to mix the solution thoroughly, let it stand for 10 min, and then centrifuge at 13000 rpm for 10 min.

[0030] (6) Aspirate 650 μL of supernatant from the wall and place it in a new tube. Add 2 μL of RNase (10 mg / mL), mix well, and place in a 37°C water bath for 2 h.

[0031] (7) Add 650 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the wall, mix thoroughly, let stand for 10 min, and then centrifuge at 13000 rpm for 10 min.

[0032] (8) Aspirate 550 μL of supernatant along the wall and place it in a new tube. Add 550 μL of isopropanol pre-cooled at -20℃ (add along the wall), tighten the centrifuge tube cap, invert it several times, and then place it in a -20℃ refrigerator for 60 min.

[0033] (9) Remove the centrifuge tube and centrifuge at 13,000 rpm for 10 min in a centrifuge. Carefully discard the supernatant and keep the precipitate at the bottom of the centrifuge tube.

[0034] (10) Wash the precipitate three times with pre-cooled 70% ethanol, place the centrifuge tube in a clean bench, dry it with sterile air, add 200 μL ddH2O to dissolve it, and store it at -20℃ for later use.

[0035] The maternal and paternal parents in Example 1 are both disclosed in Liu Shi, Gao Peng, Zhu Qianglong, Zhu Zicheng, Liu Hongyu, Wang Xuezheng, Weng Yiqun, Gao Meiling and Luan Feishi*. Resequencing of 297 melon accessions reveals the genomic history of improvement and loci related to fruit traits in melon. 2020, 18, 2545-2558, Plant Biotechnology Journal.

[0036] Example 1. Molecular markers closely linked to the petal size trait of thin-skinned melons and their acquisition method

[0037] This embodiment provides the linkage locus of key genes for the petal size trait of thin-skinned melons, the InDel marker, and the method for obtaining the marker.

[0038] (1) Selection of test materials:

[0039] The test materials included maternal parents, paternal parents, F1 generation, and F2 generation populations;

[0040] The male parent material is m1-15, a cultivar of thin-skinned melon with petal length of 18.4±0.7 mm and petal width of 13.1±0.4 mm;

[0041] The parent material is: 1190wd, a wild thin-skinned melon with petal length of 10.8±0.6 mm and petal width of 7.9±0.4 mm;

[0042] The F1 generation refers to the F1 generation obtained by hybridization using the two materials mentioned above as parents.

[0043] The F2 generation population consists of 607 plants and 451 plants obtained by self-pollination of the F1 generation.

[0044] (2) Phenotypic identification of petal size of test materials: Three flowers from each plant were collected on the day of flowering, and the length and width of the petals were measured using vernier calipers;

[0045] The results of this step show that the petal length of the F1 generation is 15.7±0.6 mm and the petal width is 11.1±0.4 mm, which is between the two parents. The petal length and petal width in the F2 generation show a normal distribution, indicating that the size of melon petals is a quantitative trait inherited.

[0046] (3) Using BSA-seq and genetic linkage analysis, chromosome segments closely linked to the petal size trait of thin-skinned melons were obtained:

[0047] In the F2 generation, 30 plants each with large petals (21.4-23.4 mm) and small petals (9.2-12.4 mm) were selected. DNA was extracted from each plant, and after adjusting the DNA concentration to be consistent, equal amounts were mixed to construct a gene pool for thin-skinned melon petal size. BSA-seq analysis was performed. Based on the analysis results and the resequencing data of the two parents' genomes, InDel molecular markers were developed within the chromosomal segments identified in the BSA-seq analysis results. Genetic linkage analysis was performed on the F2 populations in 2023 and 2024. Ultimately, the key major-effect locus for the thin-skinned melon petal size trait was located within approximately 1.42 Mb on chromosome 8 of the melon genome, and named [the locus is missing from the original text]. Cmqps8.1 , Figure 1 Major loci of the size of thin-skinned melon petals Cmqps8.1 Preliminary location results.

[0048] (4) Development of candidate InDel tags:

[0049] Based on resequencing data from both parents, InDel molecular markers were developed. Genotyping was performed on individual plants in a natural population, and the concordance between genotype and phenotype was determined by combining phenotypic data. The results showed that a change at an InDel site within this region was closely linked to petal size.

[0050] This led to the discovery of a correlation between the size of the petals of the thin-skinned melon and... Chr08_9521560 Molecular markers Chr08_ 9521560 The molecular markers are a 204 bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.1 and a 185 bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.2; SEQ ID NO.1 is closely linked to the large petal-like shape, and SEQ ID NO.2 is closely linked to the small petal-like shape.

[0051] The petal length of the large-petal type ranges from 16.6 mm to 20.7 mm, and the petal width ranges from 11.7 mm to 14.9 mm. The petal length of the small-petal type ranges from 8.6 mm to 12.8 mm, and the petal width ranges from 7.2 mm to 9.7 mm.

[0052] SEQ ID NO.1:

[0053] CACGATAAGTTATGGGAGAAAA ACGTCAAAGTTTTGTTGGGTGTTATTAAGTGCCAATAGGAAACTTCAAAGTCTTGAGTTATATTTGAATTAAAGGGAATGGAAAGAAATTCTTGTAGGGTC[CATGGAAATCCTCATATGGA]ATGGAAATCCTCATATGGAATGGAAATTTCCGCAATAGAA TTGTCGGTTCGAAATAATCAT;

[0054] SEQ ID NO.2:

[0055] CACGATAAGTTATGGGAGAAAA ACGTCAAAGTTTTGTTGGGTGTTATTAAGTGCCAATAGGAAACTTCAAAGTCTTGAGTTATATTTGAATTAAAGGGAATGGAAAGAAATTCTTGTAGGGTC[C]ATGGAAATCCTCATATGGAATGGAAATTTCCGCAATAGAA TTGTCGGTTCGAAATAATCAT.

[0056] Example 2. Acquisition of primer pairs for identifying the size trait of thin-skinned melon petals

[0057] Based on the results of parental resequencing data, a trait closely linked to the petal size of thin-skinned melons was developed. Chr08_ 9521560Molecular markers were used to design primer pairs for amplifying these markers. Specifically, within the localization region described in Example 1, primers were designed based on the InDel differences between the two parent sequencing data, resulting in an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4.

[0058] The upstream primer sequence is Chr08_9521560-F (SEQ ID NO.3): 5'-CACGATAAGTTATGGGAGAAAA-3';

[0059] The downstream primer sequence is Chr08_9521560-R (SEQ ID NO. 4): 5'-ATGATTATTTCGAACCGACAA-3'.

[0060] Example 3. A method for identifying the size of petals in thin-skinned melons.

[0061] A method for identifying the size of petals in thin-skinned melons includes the following steps:

[0062] (1) Extract genomic DNA from the leaves or other tissues of the thin-skinned melon sample to be tested.

[0063] The identification method of the present invention can use thin-skinned melon seedlings at different stages as materials. In order not to affect the optimal period of subsequent growth, this embodiment uses leaves of melon seedlings (two leaves and one heart stage) as materials to extract DNA.

[0064] (2) Obtained using Example 2 Chr08_9521560 Primer pairs were used to amplify genomic DNA from different samples using PCR to obtain amplification products. The amplification products were then detected by polyacrylamide gel electrophoresis. If the amplification product contained a 204 bp fragment, it was identified as the large petal type; if the amplification product contained a 185 bp fragment, it was identified as the small petal type.

[0065] The petal length of the large-petal type ranges from 16.6 mm to 20.7 mm, and the petal width ranges from 11.7 mm to 14.9 mm. The petal length of the small-petal type ranges from 8.6 mm to 12.8 mm, and the petal width ranges from 7.2 mm to 9.7 mm.

[0066] The above PCR reaction system consisted of: 1 μL each of forward and reverse primers (primer concentration 2 pM), 2 μL of DNA template (concentration 30 ng / μL), and 1 μL of 10×PCR Buffer (containing Mg). 2+15 mM), 0.15 μL dNTP (concentration of 10 mM), 0.1 μL Taq enzyme (5 U / μL), 6.75 μL sterile deionized water.

[0067] The above PCR reaction procedure is as follows: 94℃ pre-denaturation for 7 min, 94℃ denaturation for 30 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles, 72℃ extension for 10 min, and storage at 4℃.

[0068] PCR product detection method: Take 2 µL of PCR product, add 2 µL of Loading Buffer, mix well, and then spot onto a polyacrylamide gel. Electrophoresis is performed at 220V / 400 mA for 50-60 min.

[0069] The identification method of this invention can be used to determine the size of petals in the seedling stage of thin-skinned melons, with sampling time around the two-leaf-one-heart stage; while conventional breeding requires measurement during the flowering period. The identification method described in this invention can effectively shorten the breeding time and accelerate the breeding speed.

[0070] Example 4. Screening for petal size in natural melon populations using primer pairs obtained in Example 2.

[0071] To determine the accuracy of the molecular markers obtained in Example 1, the primer pairs obtained in Example 2, and the identification method obtained in Example 3 in identifying the size of petals in thin-skinned melons, samples from natural populations of thin-skinned melons were selected. The petal size of each sample was identified according to the identification method described in Example 3. Field phenotypic data of petal size, including petal length and petal width, were measured during the flowering period of the melons.

[0072] In this embodiment, genomic DNA was extracted from individual plants in the paternal, maternal, F1, and natural populations from Example 1. The primer pairs obtained in Example 2 were used to perform PCR amplification on the genomic DNA of these samples, and the PCR products were detected by polyacrylamide gel electrophoresis. The results are shown in [Figure 1]. Figure 2 .

[0073] Natural group materials are seen Figure 2 The natural population material from lanes 24 to 42 is published in the following article:

[0074] Liu Shi, Gao Peng, Zhu Qianglong, Zhu Zicheng, Liu Hongyu, Wang Xuezheng, Weng Yiqun, Gao Meiling and Luan Feishi*. Resequencing of 297 melon accessions reveals the genomic history of improvement and loci related to fruit traits in melon. 2020, 18, 2545-2558, Plant Biotechnology Journal.

[0075] like Figure 2As shown, the leftmost lane in the image represents the molecular weight marker (fragment sizes from top to bottom are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp). Lanes 33-42 represent the amplification product detection results of large-petaled, thin-skinned melon materials (thin-skinned cultivated melons) from the natural population, while lanes 24-32 represent the amplification product detection results of small-petaled melon materials (thin-skinned wild melons) from the natural population. P1 represents the amplification product detection results of the maternal parent in Example 1, P2 represents the amplification product detection results of the paternal parent in Example 1, and F1 represents the amplification product detection results of the F1 generation obtained by crossing P1 and P2. The PCR product detection results of the maternal parent (P1) show a fragment of 185 bp, while the enzyme digestion results of the paternal parent (P2) show a fragment of 204 bp. This indicates that the maternal parent has small petals, and the paternal parent has large petals, a conclusion consistent with the petal size measurements of the paternal and maternal parents in Example 1. PCR product detection results for the natural populations in lanes 24-32 showed a 185 bp fragment, while those in lanes 33-42 showed a 204 bp fragment. This indicates that the natural populations in lanes 24-32 exhibit small petal traits, while those in lanes 33-42 exhibit large petal traits. Actual measurements of petal size in the natural populations revealed that the petal length variation ranged from 8.6 to 12.8 mm and the petal width variation ranged from 7.2 to 9.7 mm for the natural populations in lanes 24-32, while the petal length variation ranged from 16.6 to 20.7 mm and the petal width variation ranged from 11.7 to 14.9 mm for the natural populations in lanes 33-42. Therefore, the petal size trait in thin-skinned melons determined based on PCR product electrophoresis results (marker genotyping results) highly matches the actual petal size of each melon variety. The genotype and phenotype are completely consistent, and the molecular marker identification results are 100% consistent with the actual petal size trait. This demonstrates that the molecular markers provided in Example 1, the primer pairs provided in Example 2, and the method for identifying the size trait of thin-skinned melon petals provided in Example 3 are feasible and accurate, and can be applied to the identification of seedling-stage molecular markers for the size of thin-skinned melon petals.

[0076] Example 5. A kit for identifying the size trait of petals in thin-skinned melons.

[0077] A kit for identifying the size trait of petals in thin-skinned melons includes the following reagents:

[0078] As described in Example 2 Chr08_9521560 -F and Chr08_9521560 -R (all concentrations are 2 pM), 10×PCR Buffer (containing Mg) 2+ 15 mM), dNTPs (concentration of 10 mM), Taq enzyme (5 U / μL), sterile deionized water.

[0079] Example 6. Method of using a kit for identifying the size trait of petals in thin-skinned melons.

[0080] (1) Extract genomic DNA from the thin-skinned melons to be tested and adjust the concentration of genomic DNA to 30 ng / μL.

[0081] (2) Add samples and reagents according to the following PCR system:

[0082] 2 μL of DNA template;

[0083] Chr08_9521560-F 1 μL (concentration of 2 pM);

[0084] Chr08_9521560-R 1 μL (concentration of 2 pM);

[0085] 10×PCR Buffer (containing Mg) 2+ 15 mM) 1 μL;

[0086] dNTP (concentration of 10 mM) 0.15 μL;

[0087] Taq enzyme (5 U / μL) 0.1 μL;

[0088] 6.75 μL of sterile deionized water.

[0089] (3) Perform PCR amplification. The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 7 min, 94℃ denaturation for 30 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles, 72℃ extension for 10 min, and storage at 4℃.

[0090] (4) The PCR products were detected by polyacrylamide gel electrophoresis. The petal size trait of thin-skinned melons was determined by the detection results. Specifically, if the amplification product contained a 204 bp fragment, it was determined to be a large petal trait; if the amplification product contained a 185 bp fragment, it was determined to be a small petal trait. The results showed that the petal length range of the large petal trait was 16.6 mm-20.7 mm, and the petal width range was 11.7 mm-14.9 mm. The petal length range of the small petal trait was 8.6 mm-12.8 mm, and the petal width range was 7.2 mm-9.7 mm.

[0091] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be defined by the claims.

Claims

1. A molecular marker for identifying the petal size trait of thin-fleshed melon, characterized in that, The molecular marker is shown in SEQ ID NO. 1 or SEQ ID NO. 2; SEQ ID NO. 1 is closely linked to large petal, and SEQ ID NO. 2 is closely linked to small petal.

2. A primer pair for amplifying a molecular marker for identifying the petal size trait of C. moschata, characterized in that, The sequence of the primer pair is shown in SEQ ID NO. 3 and SEQ ID NO.

4.

3. A kit for identifying the petal size trait in thin-skinned melon, characterized in that, The kit comprises the primer pair of claim 2.

4. Use of a primer pair according to claim 2 or a kit according to claim 3 for identifying the petal size trait in C. pepo, characterized in that, The application is to extract genomic DNA of the melon to be detected as a template, and to perform PCR amplification by using the primer pair of claim 2, if the amplification product comprises a 204 bp fragment, it is determined as a large petal type; if the amplification product comprises a 185 bp fragment, it is determined as a small petal type.

5. Use of the primer pair of claim 2 or the kit of claim 3 in the assisted identification, assisted breeding and selection of the flower petal size trait of C. melo var. inermis, characterized in that, The application is to extract genomic DNA of the melon to be detected as a template, and to perform PCR amplification by using the primer pair of claim 2, if the amplification product comprises a 204 bp fragment, it is determined as a large petal type; if the amplification product comprises a 185 bp fragment, it is determined as a small petal type.

6. Use according to claim 4 or 5, characterized in that, The petal length of the large petal trait ranges from 16.6 mm to 20.7 mm, and the petal width ranges from 11.7 mm to 14.9 mm; the petal length of the small petal trait ranges from 8.6 mm to 12.8 mm, and the petal width ranges from 7.2 mm to 9.7 mm.

7. A method of identifying the petal size trait in C. melo, characterized by, The method is as follows: Step 1: extracting genomic DNA of the melon to be detected; Step 2: using the DNA obtained in step 1 as a template, performing PCR amplification by using the primer pair of claim 2 to obtain a PCR product to determine the petal size trait of the melon; if the amplification product comprises a 204 bp fragment, it is determined as a large petal type; if the amplification product comprises a 185 bp fragment, it is determined as a small petal type.

8. The method of claim 7, wherein, The PCR reaction system in step 1 is as follows: 1 μL of each of the upper and lower primers, the primer concentration is 2 pM, 2 μL of DNA template, the DNA template concentration is 30 ng / μL, 1 μL of 10×PCR Buffer, 0.15 μL of dNTP, the dNTP concentration is 10 mM, 0.1 μL of Taq enzyme, the Taq enzyme concentration is 5 U / μL, and 6.75 μL of sterile deionized water; the PCR reaction program is as follows: 94℃ pre-denaturation for 7 min; 94℃ denaturation for 30 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 10 min, and 4℃ preservation.

9. The method of claim 7, wherein, The petal length of the large petal trait ranges from 16.6 mm to 20.7 mm, and the petal width ranges from 11.7 mm to 14.9 mm; the petal length of the small petal trait ranges from 8.6 mm to 12.8 mm, and the petal width ranges from 7.2 mm to 9.7 mm.

Citation Information

Patent Citations

  • Identification of InDel molecular marker of insertion of melon female flower and primer and application thereof

    CN109402291A

  • InDel marker primer for identifying melon variety and application of InDel marker primer

    CN118374624A