Method for rapidly verifying adenovirus genome
By constructing the adenovirus genome into circular DNA and combining nanopore sequencing technology, the rapid and cost problems of adenovirus genome detection are solved, and efficient, accurate and low-cost genome detection of the adenovirus genome is achieved, ensuring the genome Correctness and product effectiveness.
Patent Information
- Application Number
- CN202411257870.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-09
- Publication Date
- 2025-01-10
Smart Images
Figure CN119287076A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for rapidly verifying adenovirus genome. Background Art
[0002] Recombinant adenoviruses are mainly replication-deficient recombinant adenoviruses or oncolytic adenoviruses. Based on wild-type adenoviruses, people use genetic engineering to construct replication-deficient recombinant adenoviruses that lack the E1 and E3 regions (△E1 and △E3 regions), and introduce exogenous functional genes into the △E1 and △E3 regions of the replication-deficient recombinant adenovirus genome through gene cloning methods to achieve high expression of the target functional genes in cells and exert their functions. Or further, oncolytic adenoviruses are constructed by genetic engineering methods based on wild-type or replication-deficient recombinant adenoviruses so that the E1 protein is expressed only in tumor cells.
[0003] Recombinant adenovirus is a linear double-stranded DNA virus. Compared with other viruses, it can infect a wide range of objects. It can infect most cell lines, primary cells and tissues with extremely high infection efficiency. In addition, the recombinant adenovirus has a very strong capacity for exogenous genes and can accommodate the insertion of up to 8kb of exogenous functional genes and exert their functions. In addition, the recombinant adenovirus will not integrate into the genome of the cell while infecting most cells, which makes it have good safety in treatment. Therefore, replication-deficient recombinant adenovirus is recognized as one of the most promising gene therapy delivery tools, and oncolytic adenovirus has also become an effective drug for tumor treatment.
[0004] There are two commonly used recombinant adenovirus packaging systems: AdEasy and AdMAX. Both packaging systems are two-plasmid systems, i.e., a backbone plasmid and a shuttle plasmid carrying exogenous genes, and both require 293 or 293A cells that can express the E1 gene as packaging cells. The successfully packaged adenovirus needs to be passaged to establish a seed bank, and then further fermented and purified on a large scale. This process is also mostly carried out in 293 or 293A or 293H cells that express the E1 gene, and finally the adenovirus product is obtained.
[0005] However, the following problems exist in the preparation of recombinant adenovirus products: (1) The E1 gene present in 293 or 293A or 293H cells has the same sequence as the E1 of serotype 5 adenovirus. During the packaging, passage, establishment of seed bank, and fermentation of recombinant adenovirus in 293 cells, it may cross-recombinate with the overlapping sequences of 293 cells to produce replication-competent adenoviruses (RCAs). Experiments have shown that the number of RCAs increases with the number of passages of adenovirus vectors in 293 cells. RCAs can replicate and amplify autonomously in host cells, which will interfere with the use of recombinant adenovirus vectors and bring safety risks; (2) Gene mutations, insertions, deletions, etc. may occur in adenovirus during multiple passages. Based on the above, it is very necessary to detect the correctness of the adenovirus genome during the packaging, passage, and fermentation of adenovirus products.
[0006] At present, the correctness of adenovirus genome is mostly detected by PCR amplification of inserted gene sites and inserted gene fragments, and then the first-generation sequencing method is used to compare whether there are gene mutations, insertions, deletions, etc. However, this method can only detect the correctness of inserted gene sites and inserted gene fragments, and RCA and the rest of the adenovirus genome cannot be detected; another method is adenovirus whole genome pacbio sequencing, which uses single-molecule real-time sequencing technology. Its principle is to connect the target DNA fragment to a special DNA polymerase to form a DNA polymerase-DNA complex. Then, the DNA polymerase-DNA complex is fixed on the sequencing chip, and the DNA fragments are sequenced one by one by laser to achieve high-throughput sequencing of DNA sequences. However, the genome of adenovirus is linear double-stranded DNA, and there is an inverted terminal repeat (ITR) sequence with a repeating structure at each end of the genome. This sequence has a special structure and is located at both ends of the linear genome, which makes sequencing difficult, takes a long time (2-3 months), and is expensive. It currently costs thousands of yuan.
[0007] At present, the fourth generation sequencing has developed nanopore single-molecule real-time sequencing technology. The principle is that a molecular connector is covalently bonded to the nanopore. After the nanopore protein is fixed on the resistor membrane, the nucleic acid is pulled through the nanopore by the power motor protein. When the nucleic acid passes through the nanopore, the charge changes, causing the current on the resistor membrane to change. Since the diameter of the nanopore is very small, only a single nucleic acid polymer is allowed to pass through, and the charged properties of the single ATCG base are different, different bases have different interferences on the current when passing through the protein nanopore. By real-time monitoring and decoding of these current signals, the base sequence can be determined, thereby achieving sequencing. This method has higher accuracy, faster speed and lower cost.
[0008] In the field of adenovirus research and production, a method for full sequencing of the adenovirus genome with a short development cycle and low cost is currently in great need for the preparation of adenovirus products. Summary of the invention
[0009] In order to solve the problem of timely and accurate detection of the correctness of the adenovirus genome sequence during the packaging, passage and fermentation of adenovirus products, the present invention provides a method for rapidly verifying the adenovirus genome.
[0010] The method for rapid verification of adenovirus genome provided by the present invention comprises the following steps:
[0011] (1) extracting linear double-stranded DNA of the genome of the adenovirus to be verified;
[0012] (2) The extracted linear double-stranded DNA of the adenovirus genome and the double-stranded DNA fragment with the transcription start site element ori are homologously recombined in vitro and then co-transfected into competent cells. The positive clone bacteria that have successfully transferred the recombined circular double-stranded DNA are selected for cultivation, and then the circular double-stranded recombinant adenovirus vector is extracted;
[0013] (3) The recombinant adenovirus vector obtained in (2) is subjected to nanopore sequencing, and the measured sequence is compared with the expected sequence for verification.
[0014] The in vitro homologous recombination in step (2) of the above method is achieved using a combination of three enzymes, which are: 5' exonuclease, DNA polymerase and DNA ligase. Furthermore, the three enzymes are: 5' T5 exonuclease, Taq DNA polymerase and Taq DNA ligase.
[0015] Wherein, the competent cells described in step (2) of the above method are competent cells of DH10B.
[0016] Among them, the structure of the double-stranded DNA fragment with the transcription start site element ori described in step (2) of the above method is left homology arm-ori-resistance gene-right homology arm, and the left homology arm and the right homology arm are homology arms homologous to the ITR sequences at both ends of the linear double-stranded DNA of the adenovirus genome to be verified.
[0017] Wherein, the length of the homology arm described in the above method is 30 to 200 bp; further, the length of the homology arm is 30 to 120 bp.
[0018] The leftmost base of the left homology arm in the above method is the same as the first base at the 5' end of the linear double-stranded DNA of the adenovirus genome to be verified.
[0019] The rightmost base of the right homology arm in the above method is the same as the first base at the 3' end of the linear double-stranded DNA of the adenovirus genome to be verified.
[0020] In the above method, the lengths of the left homology arm and the right homology arm may be inconsistent.
[0021] Wherein, the ITR sequence described in the above method is the ITR sequence of serotype 5 adenovirus, and its nucleotide sequence is (SEQ ID NO.1):
[0022] 5'-catcatcaataatataccttattttggattgaagccaatatgataatgaggggggtggagtttgtgacgtggcgcggggcgtgggaacggggc gggtgacgtag-3'.
[0023] Wherein, the temperature of in vitro recombination in the above method is 49-51°C; or, the recombination time is 15-60 minutes. Furthermore, the temperature of in vitro recombination is 50°C.
[0024] Wherein, the resistance gene described in the above method is any one of ampicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene and tetracycline resistance gene.
[0025] Wherein, the ori element described in the above method is pMB1 ori, pUC ori, pBR322 ori, ColE1 ori, R6K ori, p15A ori, pSC101 ori ori.
[0026] Wherein, the nanopore sequencing of the recombinant adenovirus vector in step (3) of the above method comprises the following steps:
[0027] a) detecting and adjusting the concentration of the circular double-stranded recombinant adenovirus vector obtained in step (2) to a concentration suitable for the sequencer to work, thereby obtaining a sample to be detected;
[0028] b) mixing the sample to be tested obtained in step a) with the transposase connected with the sequencing adapter, the transposase cuts the circular double-stranded DNA chain, and adds sequencing adapters at both ends of the DNA breakpoint, and then adds the motor protein, and then the sequencing can be performed on the nanopore sequencer;
[0029] c) Analyze and integrate the sequencing data to obtain the sequencing results of the recombinant adenovirus vector.
[0030] The beneficial effects of the present invention are as follows: the present invention constructs the adenovirus genome into a circular plasmid and combines it with nanopore sequencing technology, ultimately achieving efficient, accurate and low-cost whole-genome detection of adenovirus. The method of the present invention cleverly utilizes the principle of homologous recombination, and can instantly construct the linearized adenovirus genome obtained in the adenovirus construction and production process into a circular plasmid, and the obtained circular plasmid can be conveniently and quickly subjected to nanopore full sequencing. The entire process, from extracting the viral genome to obtaining the genome sequencing results, takes only about 1 week at the fastest. The cost is also very low, and the sequencing cost from extracting the viral genome, constructing the adenovirus circular vector, and obtaining the genome sequencing results can be as low as about 400 yuan. The method does not require complex experimental instruments to extract the genome and construct the adenovirus circular vector, and the method is simple and has a high success rate. Sequencing by this method can effectively ensure the correctness of the genome and the effectiveness of the product during the preparation of the adenovirus product. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 : Schematic diagram of the construction
[0032] Figure 2 :PacI digestion map of p15A-cm-2101
[0033] Figure 3 :PacI digestion map of p15A-cm-2103
[0034] Figure 4 :PacI digestion map of p15A-cm-2105
[0035] Figure 5 :Comparison of theoretical and sequenced sequences of p15A-cm-2101
[0036] Figure 6 :Comparison of theoretical and sequenced sequences of p15A-cm-2103
[0037] Figure 7 :Comparison of theoretical and sequenced sequences of p15A-cm-2105 DETAILED DESCRIPTION
[0038] Since there is a need to detect the correctness of adenovirus genome sequences in a timely and accurate manner during the packaging, propagation and fermentation of adenovirus products in the art, and there is currently a lack of reports on corresponding methods, the present invention provides a method for rapidly verifying adenovirus genomes.
[0039] The method of the present invention comprises the following steps: (1) extracting linear double-stranded DNA of the genome of the adenovirus to be verified; (2) subjecting the extracted linear double-stranded DNA of the adenovirus genome and a double-stranded DNA fragment with a transcription start site element ori to in vitro homologous recombination and then transferring them into competent cells together, screening out positive clones of bacteria that have successfully transferred the recombined circular double-stranded DNA for culturing, and then extracting a circular double-stranded recombinant adenovirus vector; (3) subjecting the recombinant adenovirus vector obtained in (2) to nanopore sequencing, and comparing the measured sequence with the expected sequence for verification.
[0040] In vitro homologous recombination is achieved using a combination of three enzymes: 5' exonuclease, DNA polymerase and DNA ligase. Further, the three enzymes are: 5'T5 exonuclease, Taq DNA polymerase and Taq DNA ligase. First, under the action of the 5'-3' exonuclease activity of T5 exonuclease, the homologous parts of the 3' sticky ends of the DNA fragments with homologous parts at both ends are exposed and paired and recombined with each other. Then, the DNA polymerase will extend to fill the gap on the fragment. Finally, under the action of DNA ligase, the single-stranded gap in the DNA fragment is repaired and the clone assembly is completed. Regardless of the length of the DNA fragment, under the mediation of the three enzymes, multiple fragments can be connected into a complete double-stranded DNA molecule in a single reaction.
[0041] Furthermore, after obtaining the circular double-stranded recombinant adenovirus vector, the existing nanopore sequencing technology can be used for rapid sequencing. For example, the following steps can be specifically followed:
[0042] a) detecting and adjusting the concentration of the circular double-stranded recombinant adenovirus vector obtained in step (2) to a concentration suitable for the sequencer to work, thereby obtaining a sample to be detected;
[0043] b) mixing the sample to be tested obtained in step a) with the transposase connected with the sequencing adapter, the transposase cuts the circular double-stranded DNA chain, and adds sequencing adapters at both ends of the DNA breakpoint, and then adds the motor protein, and then the sequencing can be performed on the nanopore sequencer;
[0044] c) Analyze and integrate the sequencing data to obtain the sequencing results of the recombinant adenovirus vector.
[0045] The present invention is further specifically described below by way of examples.
[0046] Example 1 Recombining the linear oncolytic adenovirus genome into a circular recombinant oncolytic adenovirus vector
[0047] Oncolytic adenovirus is a type of adenovirus with oncolytic activity that has been modified and transformed into the adenovirus genome. During the construction of oncolytic adenovirus, it is necessary to sequence it to confirm whether the construction is successful and whether the gene sequence of the obtained adenovirus is consistent with the designed theoretical sequence. The implementation scheme of the present invention will be described in detail below in conjunction with the examples. This example uses a total of three oncolytic adenoviruses OAd2101 (oncolytic adenovirus expressing SIRPα-Fc fusion protein and RGD modified), OAd2103 (oncolytic adenovirus expressing Siglec10-Fc fusion protein and RGD modified), and OAd2105 (oncolytic adenovirus expressing TIGIT-Fc fusion protein and RGD modified) as examples.
[0048] 1. Use a viral genome extraction kit to extract the double-stranded viral genome DNA of OAd2101, OAd2103, and OAd2105 according to the instructions.
[0049] 2. PCR amplification to obtain the p15A-ori-cm fragment
[0050] The p15A-ori-cm fragment consists of the left homology arm-ori-resistance gene-right homology arm, where ori is p15Aori, the resistance gene is the chloramphenicol resistance gene, the leftmost base of the left homology arm is the same as the first base at the 5' end of the linear double-stranded DNA of the OAd2101 / OAd2103 / OAd2105 genome, and the length is 80bp, and the rightmost base of the right homology arm is the same as the first base at the 3' end of the linear double-stranded DNA of the OAd2101 / OAd2103 / OAd2105 genome, and the length is 80bp. The structure of the p15A-ori-cm fragment can be found in Figure 1 .
[0051] Nucleotide sequence of p15A-ori-cm fragment (SEQ ID NO.2)
[0052] cgccccgcgccacgtcacaaactccaccccctcattatcatattggcttcaatccaaaataaggtatattattgatgatgTTAATTAAACAACTTATATC
[0053] GTATGGGGCTGACTTCAGGTGCTACATTTGAAGAGATAAATTGCACTGAAATCTAGAAATATTTTATCT
[0054] GATTAATAAGATGATCTTCTTGAGATCGTTTTGGTCTGCGCGTAATCTCTTGCTCTGAAAACGAAAAAA
[0055] CCGCCTTGCAGGGCGGTTTTTCGAAGGTTCTCTGAGCTACCAACTCTTTGAACCGAGGTAACTGGCTT
[0056] GGAGGAGCGCAGTCACCAAAACTTGTCCTTTCAGTTTAGCCTTAACCGGCGCATGACTTCAAGACTA
[0057] ACTCCTCTAAATCAATTACCAGTGGCTGCTGCCAGTGGTGCTTTTGCATGTCTTTCCGGGTTGGACTCA
[0058] AGACGATAGTTACCGGATAAGGCGCAGCGGTCGGACTGAACGGGGGGTTCGTGCATACAGTCCAGCT
[0059] TGGAGCGAACTGCCTACCCGGAACTGAGTGTCAGGCGTGGAATGAGACAAACGCGGCCATAACAGC
[0060] GGAATGACACCGGTAAACCGAAAGGCAGGAACAGGAGAGCGCACGAGGGAGCCGCCAGGGGGAAA
[0061] CGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCACTGATTTGAGCGTCAGATTTCGTGATGCTT
[0062] GTCAGGGGGGCGGAGCCTATGGAAAAACGGCTTTGCCGCGGCCCTCTCACTTCCCTGTTAAGTATCTT
[0063] CCTGGCATCTTCCAGGAAATCTCCGCCCCGTTCGTAAGCCATTTCCGCTCGCCGCAGTCGAACGACCG
[0064] AGCGTAGCGAGTCAGTGAGCGAGGAAGCGGAATATATCCTGTATCACATATTCTGCTGACGCACCGGT
[0065] GCAGCCTTTTTTCTCCTGCCACATGAAGCACTTCACTGACACCCTCATCAGTGCCAACATAGTAAGCC
[0066] AGTATACACTCCGCTAGCGCTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAAT
[0067] AACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGGAGAAAAAAATCACTGGATATACC
[0068] ACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACC
[0069] TATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTT
[0070] TTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAA
[0071] GACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAAC
[0072] GTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGT
[0073] GGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGC
[0074] CAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGT
[0075] TTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATC
[0076] ATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGG
[0077] CAGGGCGGGGCGTAACCATGGATCCATGGTTAGCCCTCCCACACATAACCTTAATTAAcatcatcaataatatacc
[0078] ttattttggattgaagccaatatgataatgaggggggtggagtttgtgacgtggcgcggggcg
[0079] The fragment was obtained by PCR amplification using primers 1 and 2 with a plasmid containing the p15A-ori-cm nucleic acid fragment as a template. Primers 1 and 2 contained homology arm sequences homologous to ITR as follows:
[0080] Primer 1 (SEQ ID NO.3):
[0081] cgccccgcgccacgtcacaaactccaccccctcattatcatattggcttcaatccaaaataaggtatattattgatgatgTTAATTAAACA
[0082] ACTTATATCGTATGGGGC
[0083] Primer 2 (SEQ ID NO.4):
[0084] cgccccgcgccacgtcacaaactccaccccctcattatcatattggcttcaatccaaaataaggtatattattgatgatgTTAATTAAGGT
[0085] TATGTGTGGGAGGGCTAA
[0086] 3. The extracted linear double-stranded DNA of adenovirus genome was homologously recombined with the p15A-ori-cm nucleic acid fragment in vitro. The homologous recombination was achieved using a combination of three enzymes: 5'T5 exonuclease (New England Biolabs), Taq DNA polymerase (New England Biolabs) and Taq DNA ligase (New England Biolabs). The specific reaction conditions for in vitro homologous recombination were 50°C for 1 hour.
[0087] The recombinant product was then transformed into DH10B competent cells, revived and cultured overnight to obtain positive clone bacteria DH10B containing the oncolytic adenovirus genome and the p15A-ori-cm circular recombinant vector (see the p15A-cm-2101 recombinant schematic diagram for details). Figure 1 , the recombination method of p15A-cm-2103 and p15A-cm-2105 is the same), and they are cultured overnight.
[0088] 4. Pick 5 cloned colonies DH10B (p15A-cm-2101), DH10B (p15A-cm-2103), and DH10B (p15A-cm-2105) on the resistance plate, culture them overnight, and extract the recombinant oncolytic adenovirus vectors p15A-cm-2101, p15A-cm-2103, and p15A-cm-2105. Then use the endonuclease PacI for enzyme digestion for verification.
[0089] The experimental results are shown in Figure 2-4 , the selected p15A-cm-2101( Figure 2 )、p15A-cm-2103( Figure 3 )、p15A-cm-2105( Figure 4 ) were consistent with the experimental results.
[0090] Example 2: Sequencing of p15A-cm-2101 / 2103 / 2105
[0091] The circular oncolytic adenovirus genome vector obtained in Example 1 was further subjected to nanopore sequencing as follows:
[0092] (1) Nanopore sequencing
[0093] ①Select a rapid barcode sequencing kit (nanopore);
[0094] ②Sample quality control and dilution: Use Nanodrop2000 to measure the double-stranded DNA concentration and dilute the sample to 50 ng / μL;
[0095] ③ Library construction and sequencing: Each sample is added with a rapid barcode sequencing kit reagent. The main transposase can cut the long DNA chain, and add sequencing adapters at both ends of the DNA breakpoints. Then, the motor protein is added, and sequencing can be performed on a nanopore sequencer (GridION X5 instrument from Oxford Nanopore).
[0096] ④Base recognition and data splitting: During the sequencing process, electrical signals are converted into base signals, and the data are split according to the samples;
[0097] ⑤ Assembly of full-length plasmid sequences: The software analyzes and assembles the data.
[0098] (2) Experimental results
[0099] ① Randomly select one clone from the five positive clones of the recombinant oncolytic adenovirus vector (p15A-cm-2101) that was correctly digested in Example 1, perform full sequencing (3 working days), and compare the sequencing results with the theoretical sequence. Figure 5 , compared with the theoretical result, the actual sequencing result of p15A-cm-2101 has a homology of up to 100% (the red solid line is the sequencing sequence, and the black double line is the theoretical sequence).
[0100] ② Similarly, one clone was randomly selected from the five positive clones of the recombinant oncolytic adenovirus vector (p15A-cm-2103) that was correctly digested in Example 1, and the whole sequence was performed (3 working days), and the sequencing result was compared with the theoretical sequence. Figure 6 , the actual sequencing results of p15A-cm-2103 were compared with the theoretical results, and the homology was as high as 100%.
[0101] ③ Similarly, two clones were randomly selected from the five positive clones of the recombinant oncolytic adenovirus vector (p15A-cm-2105) that were correctly digested in Example 1, and full sequencing was performed (3 working days), and the sequencing results were compared with the theoretical sequence. The results of the first clone of p15A-cm-2105 are shown in Figure 2. Figure 7 A, the actual sequencing results are compared with the theoretical results, and the homology is 100%. The results of the second clone of p15A-cm-2105 are as follows Figure 7 B. The theoretical sequence of the recombinant adenovirus vector p15A-cm-2105 is 36548 bp in length. The actual sequencing result of the second clone is 36546 bp, with 2 base deletions, and the homology with the theoretical sequence reaches more than 99.99%. Further, the two base deletions of the second clone were retested by first-generation sequencing, and the retest results were consistent with the theoretical sequence.
Claims
1. A method for rapid verification of adenovirus genome, characterized in that The following steps are involved: (1) extracting linear double-stranded DNA of the genome of the adenovirus to be verified; (2) The extracted linear double-stranded DNA of the adenovirus genome and the double-stranded DNA fragment with the replication origin element ori are homologously recombined in vitro and then co-transfected into competent cells. The positive clone bacteria that have successfully transferred the recombined circular double-stranded DNA are selected for cultivation, and then the circular double-stranded recombinant adenovirus vector is extracted; (3) The recombinant adenovirus vector obtained in (2) is subjected to nanopore sequencing, and the measured sequence is compared with the expected sequence for verification.
2. The method according to claim 1, characterized in that: The in vitro homologous recombination described in step (2) is achieved using a combination of three enzymes, which are: 5' exonuclease, DNA polymerase and DNA ligase.
3. The method according to claim 1, characterized in that: The competent cells described in step (2) are DH10B.
4. The method according to claim 1, characterized in that: The structure of the double-stranded DNA fragment with the transcription start site element ori in step (2) is left homology arm-ori-resistance gene-right homology arm or left homology arm-resistance gene-ori-right homology arm, and the left homology arm and the right homology arm are homologous to the ITR sequences at both ends of the linear double-stranded DNA of the adenovirus genome to be verified.
5. The method according to claim 4, characterized in that: The length of the homology arm is 30 to 200 bp; further, the length of the homology arm is 30 to 120 bp.
6. The method according to claim 4, characterized in that: The leftmost base of the left homology arm is the same as the first base at the 5' end of the linear double-stranded DNA of the adenovirus genome to be verified; Alternatively, the rightmost base of the right homology arm is the same as the first base at the 3' end of the linear double-stranded DNA of the adenovirus genome to be verified.
7. The method according to claim 4, characterized in that: The lengths of the left and right homology arms are inconsistent.
8. The method according to claim 4, characterized in that: The ITR sequence is the ITR sequence of serotype 5 adenovirus, and its nucleotide sequence is: 5'-catcatcaataatataccttattttggattgaagccaatatgataatgaggggggtggagtttgtgacgtggcgcggggcgtgggaacggggc gggtgacgtag-3'.
9. The method according to claim 1, characterized in that: The temperature of the in vitro recombination is 49-51°C; or, the time of the recombination is 15-60 minutes; further, the temperature of the in vitro recombination is 50°C.
10. The method according to claim 4, characterized in that: The resistance gene is any one of an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, and a tetracycline resistance gene.
11. The method according to any one of claims 1 to 10, characterized in that: The ori element is pMB1 ori, pUC ori, pBR322 ori, ColE1 ori, R6K ori, p15A ori, pSC101 ori ori.
12. The method according to claim 1, characterized in that: The step (3) of subjecting the recombinant adenovirus vector to nanopore sequencing comprises: a) detecting and adjusting the concentration of the circular double-stranded recombinant adenovirus vector obtained in step (2) to a concentration suitable for the sequencer to work, thereby obtaining a sample to be detected; b) mixing the sample to be tested obtained in step a) with the transposase connected with the sequencing adapter, the transposase cuts the circular double-stranded DNA chain, and adds sequencing adapters at both ends of the DNA breakpoint, and then adds the motor protein, and then the sequencing can be performed on the nanopore sequencer; c) Analyze and integrate the sequencing data to obtain the sequencing results of the recombinant adenovirus vector.