Application of miR-1303 and / or miR-4521 in thin endometrium

Abstract

This application relates to the application of miR-1303 and / or miR-4521 in thin endometrium. This application provides the application of miR-1303 inhibitor and / or miR-4521 inhibitor in the preparation of products for preventing and / or treating thin endometrium. This application discovers that inhibiting the transcriptional expression of miR-1303 and miR-4521 can treat thin endometrium by promoting the differentiation of HucMSC into EEC and / or promoting the proliferation and migration of HucMSC, providing new ideas for the diagnosis, prevention and treatment of thin endometrium.

Description

Technical Field

[0001] This application relates to the field of biomedicine, and specifically to the application of miR-1303 and / or miR-4521 in thin endometrium. Background Art

[0002] Thin endometrium usually refers to that during the assisted reproductive technology (ART) cycle, when the follicles are mature or under the action of sufficient exogenous estrogen, the endometrial thickness measured by ultrasound is <7-8 mm. One of the pathophysiological characteristics of thin endometrium is the damage of the basal layer of the endometrium, increased resistance of uterine artery blood flow, and poor vascular development. The ischemic and hypoxic environment makes the endometrial cells grow slowly, the number of glands decrease, and endometrial fibrosis occur, ultimately resulting in endometrial regeneration disorder, affecting endometrial receptivity, and reducing the clinical pregnancy rate and live birth rate.

[0003] Human umbilical cord mesenchymal stem cells (HucMSC) regulate biological processes such as angiogenesis, immune response, cell proliferation and apoptosis, inflammatory response, and fibrosis. They have the advantages of simple material collection, rapid proliferation, low immunogenicity and tumorigenicity. Their effectiveness in treating thin endometrium has been confirmed, but the specific mechanism is not yet clear. The paracrine effect of HucMSC plays an important role in the repair process. Exosomes (-ex) are important carriers of paracrine, and the micro messenger ribonucleic acid (miRNA) carried in them is involved in tissue damage repair and may be beneficial to thin endometrium.

[0004] Therefore, this application deeply explores the role and regulatory mechanism of miRNA levels on HucMSC, providing ideas for the treatment of thin endometrium. Summary of the Invention

[0005] Based on this, an embodiment of this application provides the application of miR-1303 inhibitor and / or miR-4521 inhibitor in the preparation of products for preventing and / or treating thin endometrium.

[0006] The technical solution includes the following:

[0007] The application of miR-1303 inhibitor and / or miR-4521 inhibitor in the preparation of products for preventing and / or treating thin endometrium.

[0008] In one embodiment, the type of the thin endometrium is the thin endometrium caused by hypoxia damage of endometrial cells.

[0009] In one embodiment, the product comprises a drug.

[0010] In one embodiment, the drug comprises an active ingredient and a pharmaceutically acceptable excipient, and the active ingredient comprises an miR-1303 inhibitor and / or an miR-4521 inhibitor.

[0011] In one embodiment, the drug further comprises exosomes secreted by hypoxic injury endometrial glandular epithelial cells.

[0012] Use of an miR-1303 inhibitor and / or an miR-4521 inhibitor in the preparation of a biological agent for promoting the differentiation of HucMSC into EEC.

[0013] Use of an miR-1303 inhibitor and / or an miR-4521 inhibitor in the preparation of a biological agent for promoting the proliferation and / or migration of HucMSC.

[0014] In one embodiment, the miR-1303 inhibitor comprises a substance that inhibits the expression or function of miR-1303, and / or the miR-4521 inhibitor comprises a substance that inhibits the expression or function of miR-4521.

[0015] In one embodiment, the substance comprises siRNA.

[0016] It can be understood that in other embodiments, those skilled in the art can select other substances that can inhibit the expression of miR-1303 and / or substances that inhibit the expression of miR-4521, such as gene editing systems, etc. Substances that can achieve the purpose of inhibiting the expression or function of miR-1303 and / or miR-4521 in this application are within the protection scope of this application.

[0017] In one embodiment, the siRNA that inhibits the expression of miR-1303 is shown as SEQ ID NO:5.

[0018] In one embodiment, the siRNA that inhibits the expression of miR-4521 is shown as SEQ ID NO:6.

[0019] In one embodiment, the substance further comprises an expression vector. Optionally, the expression vector includes but is not limited to viral vectors and plasmids. In one embodiment, the viral vector includes lentivirus and / or adenovirus.

[0020] Use of miR-1303 and / or miR-4521 in screening drugs for preventing and / or treating thin endometrium; optionally, the drug can reduce the expression level of miR-1303 and / or miR-4521 in HucMSC cells, and / or inhibit the function of miR-1303 and / or miR-4521.

[0021] In one embodiment, in the screening, the candidate drug is co-cultured with HucMSC cells, and after the culture, the expression level of miR-1303 and / or miR-4521 in the HucMSC cells is detected to determine whether it is a drug for preventing and / or treating thin endometrium.

[0022] In one embodiment, the detection method for the expression level of miR-1303 and / or miR-4521 in HucMSC cells includes RT-qPCR.

[0023] In one embodiment, the detection primers for the expression level of miR-1303 are shown as SEQ ID NO:1-2, and the detection primers for the expression level of miR-4521 are shown as SEQ ID NO:3-4.

[0024] Use of a reagent for detecting the expression level of miR-1303 and / or miR-4521 in the preparation of a product for diagnosing thin endometrium.

[0025] In one embodiment, the product includes a diagnostic kit.

[0026] In one embodiment, miR-1303 and / or miR-4521 are significantly up-regulated in HucMSC of patients with thin endometrium.

[0027] In one embodiment, the reagent for detecting the expression level of miR-1303 and / or miR-4521 includes primers.

[0028] In one embodiment, the primers for detecting miR-1303 are shown as SEQ ID NO:1-2, and the primers for detecting miR-4521 are shown as SEQ ID NO:3-4.

[0029] Compared with the traditional technology, the present application has the following beneficial effects:

[0030] The present application discovers that inhibiting the transcriptional expression of miR-1303 and miR-4521 can treat thin endometrium by promoting the differentiation of HucMSC into EEC and / or promoting the proliferation and migration of HucMSC, providing new ideas for the diagnosis, prevention and treatment of thin endometrium. Brief Description of the Drawings

[0031] To more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and its beneficial effects, the accompanying drawings required for the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present application. For those skilled in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.

[0032] Figure 1 It is the result graph of the CCK8 cell proliferation experiment in Example 1;

[0033] Figure 2 It is the result graph of the EdU cell proliferation experiment in Example 1, where Figure A is at 72h and Figure B is at 96h;

[0034] Figure 3 It is the result of the Transwell cell migration experiment in Example 1, where Figure A is at 12h and Figure B is at 24h;

[0035] Figure 4 It is the result of the Wound Healing cell scratch experiment in Example 1, where Figure A is at 12h and Figure B is at 24h;

[0036] Figure 5 It is the result of the Western Blot experiment on the differentiation of HucMSC stem cells into EECs in Example 1;

[0037] Figure 6 It is the expression results of miR-1303 and miR-4521 in the HucMSC group, the EECD-ex + HucMSC group, and the EEC-ex + HucMSC group;

[0038] Figure 7 It is the result graph of the CCK8 cell proliferation experiment in Example 2;

[0039] Figure 8 It is the result graph of the EdU cell proliferation experiment in Example 2, where Figure A is at 72h and Figure B is at 96h;

[0040] Figure 9 It is the result of the Transwell cell migration experiment in Example 2, where Figure A is at 12h and Figure B is at 24h;

[0041] Figure 10 It is the result of the Wound Healing cell scratch experiment in Example 2, where Figure A is at 12h and Figure B is at 24h;

[0042] Figure 11 It is the result of the Western Blot experiment on the differentiation of HucMSC stem cells into EECs in Example 2. Detailed implementation manners

[0043] To make the above objects, features and advantages of the present application more obvious and understandable, the following provides a detailed description of the specific implementation manners of the present application. Many specific details are set forth in the following description in order to fully understand the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the connotation of the present application. Therefore, the present application is not limited by the specific embodiments disclosed below.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0045] The term "and / or" as used herein includes any and all combinations of one or more of the related listed items.

[0046] In this article, EEC, the full English name is endometrial epithelial cells, refers to normal endometrial glandular epithelial cells.

[0047] In this article, EECD, the full English name is endometrial epithelial cell under damage, refers to endometrial glandular epithelial cells damaged by hypoxia.

[0048] In this article, HucMSC, the full English name is human umbilical cord mesenchymal stem cell, refers to human umbilical cord mesenchymal stem cells.

[0049] In this article, ex, the full English name is Exosome, refers to exosomes secreted by EEC or EECD cells.

[0050] The following will describe the implementation schemes of the present application in detail in combination with embodiments. It should be understood that these embodiments are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specific conditions noted in the following embodiments, preference is given to the guidance given in the present application, and it can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions recommended by the manufacturer, or referring to the experimental methods known in the art.

[0051] In the following specific embodiments, for the measurement parameters of raw material components, if there is no special description, there may be slight deviations within the weighing accuracy range. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0052] The following examples involve the following main experimental methods:

[0053] 1. EEC cell culture and identification

[0054] Normal endometrial glandular epithelial cells (EEC) were purchased from Shanghai Saibaikang Biotechnology (human primary EEC, catalog number: HUM-iCell-f004), and the company's complete culture medium system for this cell was used. EEC was cultured in a 37°C, 5% CO2 constant temperature incubator. When the EEC density increased to 80% to 90%, cell expansion and passage were started, and the steps were as follows:

[0055] (1) Add complete cell culture medium to PBS containing penicillin-streptomycin double antibody at a final concentration of 1×, take out 0.25% trypsin from a 4°C refrigerator, and place it at room temperature for later use.

[0056] (2) Aspirate the complete medium (retain 3 mL for subsequent digestion termination), gently wash the cells 3 times with 3 mL PBS, add 500 μL of 0.25% trypsin, and digest the cells in a 37°C CO2 incubator for 2 minutes. When the cells begin to flow like a waterfall, and a large area of ​​cells are observed to be attached to the wall and floating under an inverted microscope, the digestion is terminated, and the cells at the bottom are blown 15 to 20 times. The cell suspension is centrifuged at 1,000 rpm / min at room temperature for 5 minutes.

[0057] (3) Discard the supernatant, use your fingertips to disperse the cell pellet at the bottom of the centrifuge tube, add 3 mL of complete culture medium, and resuspend the cells by pipetting. Prepare a new sterile cell culture flask, pipette 4 mL of new complete culture medium and 1 mL of cell suspension into the new flask. Mix the cells thoroughly and let stand for 5 minutes to allow the cells to evenly settle to the bottom of the flask. Observe the cell adhesion and transfer to a CO2 incubator.

[0058] (4) After the EEC density has expanded to 90%, digest, centrifuge and resuspend the cells in fresh complete medium for subsequent identification.

[0059] Under a 100x optical microscope, cells were observed to grow attached to the wall, in a spindle-shaped, cobblestone-like shape, with no obvious boundaries and parallel distribution, which is consistent with the morphological characteristics of EEC. The second generation of EEC was taken, and the EEC cell surface marker cytokeratin (PCK) was identified by immunofluorescence (IF) technology, and the PCK positive rate of EEC was verified. The PCK positive rate of EEC cells was >90%, indicating that EEC was successfully cultured in vitro.

[0060] 2. EECD Model Construction

[0061] The EECD model was constructed under oxygen-glucose deprivation (OGD) conditions. For normal EEC culture, after subculturing twice according to the cell culture amplification and passage steps described above, when the cell state was stable and the cell density reached 80% - 90%, the low-glucose basal medium supplemented with 1% penicillin-streptomycin double antibody was replaced, and the well plate was transferred to a special hypoxia incubator with 1% O2, 94% N2, and 5% CO2. For the well plate seeded with EEC, it was set to be cultured under OGD conditions for 4 h (the expression of hypoxia-related proteins VEGFA and αvβ3 was significantly up-regulated, and the expression of the epithelial cell marker protein E-cadherin was significantly decreased). After 4 h, it was restored to normoxia and high glucose, and continued to be cultured for 24 h before subsequent experiments.

[0062] III. Extraction of exosomes from EEC and EECD supernatants

[0063] (1) Take the cell culture medium, aliquot it into sterilized centrifuge bottles or centrifuge tubes, and centrifuge at 4°C and 1000×g for 10 min in a low-temperature centrifuge to remove cell culture supernatant, debris, and dead cells in the culture medium;

[0064] (2) After centrifugation, the supernatant was filtered through a 0.2 mm filter and aliquoted into sterilized centrifuge bottles;

[0065] (3) Centrifuge the supernatant culture medium at 4°C and 100,000×g for 3 h;

[0066] (4) Discard the supernatant, add 10 mL of pre-cooled 1×PBS, and wash the precipitate at 4°C and 100,000×g in an ultra-high-speed centrifuge for 90 min;

[0067] (5) Discard the supernatant, resuspend the exosome-containing particles at the bottom of the tube with 50 μL of pre-cooled 1×PBS, transfer them to a 1.5 ml EP tube, and perform BCA quantification, then store at -80°C for later use. Observed by transmission electron microscopy (TEM), the morphology of exosomes was a double-sided concave bilayer disc-shaped structure. Analyzed by nanoparticle tracking analysis (NTA) technology, the diameter of exosomes was 30 - 200 nm and the purity was high, and WB identification showed significantly high expression of exosome marker proteins CD81 and CD63, determining the successful extraction of exosomes from EEC and EECD supernatants.

[0068] IV. HucMSC cell culture

[0069] HucMSCs were purchased from Shanghai Saibakang Biotechnology (primary HucMSCs, catalog number: HUM-iCell-e009). They were cultured in a medium system and cell digestion system consisting of Gibco's α-MEM basal medium, FBS (Australian fetal bovine serum), 0.25% trypsin, and 100× penicillin-streptomycin double antibody in a 37°C CO₂ incubator for cell expansion and passage. The 4th to 6th generation of cultured HucMSCs were collected. After the cell density was expanded to 90%, the cells were digested, centrifuged, and resuspended in fresh complete medium for subsequent experiments.

[0070] V. Co-culture of EEC exosomes (EEC-ex) and EECD exosomes (EECD-ex) with HucMSCs to detect cell proliferation

[0071] 1. CCK8 assay

[0072] Before preparing the cell suspension, EEC and EECD exosomes were added to HucMSCs at 2 μg / well respectively. No exosomes were added to the control group. After co-culturing the exosomes and HucMSCs for 24 h, 48 h, and 72 h, the cells were digested to prepare a cell suspension.

[0073] CCK8 working solution was prepared by mixing 10 μL of CCK8 stock solution with 100 μL of serum-free basal medium. The CCK8 assay was performed under light protection throughout the process. The medium in the 96-well plate was aspirated, and the prepared CCK8 reagent was added to the wells. The plate was transferred to a 37°C cell incubator and incubated for 1.5 h to allow the CCK8 reagent to fully bind to the proliferating cells.

[0074] 95 μL of the CCK8 supernatant from each experimental group after incubating the cells in the previous step was aspirated and transferred to a new 96-well plate. The prepared CCK8 working solution was also transferred to the new 96-well plate for blank control. Finally, the absorbance value of the new 96-well plate was read at 450 nm using a microplate reader. Data at 0 h, 24 h, 48 h, and 72 h were collected, and Graphpad Prism 7.0.0 was used for statistical analysis of the differences in cell proliferation activity (abscissa: time; ordinate: absorbance value OD).

[0075] 2. EdU assay

[0076] Before preparing the cell suspension, EEC and EECD exosomes were added to HucMSCs at 2 μg / well respectively. No exosomes were added to the control group. After co-culturing the exosomes and HucMSCs for 72 h and 96 h, EdU detection was performed according to the Beyotime BevotCLick TM EdU-594 Cell Proliferation Detection Kit.

[0077] VI. Detection of cell migration by co-culturing EEC exosomes (EEC-ex) and EECD exosomes (EECD-ex) with HucMSC

[0078] 1. Transwell

[0079] (1) Before preparing the cell suspension, add EEC and EECD exosomes to HucMSC at 2 μg / well respectively. No exosomes are added to the control group. After co-culturing exosomes with HucMSC for 12 h and 24 h, digest the cells to prepare the cell suspension;

[0080] (2) Digest the cells. After terminating digestion, centrifuge to discard the culture medium, wash 1 - 2 times with PBS, and resuspend with serum-free medium containing BSA. Adjust the cell density to 5×10 5 cells / ml;

[0081] (3) Add 100 μl of the cell suspension to the Transwell chamber.

[0082] (4) Add 600 μl of medium containing 20% FBS to the lower chamber of the 24-well plate.

[0083] (5) Incubate routinely and observe the differences in the migration ability of HucMSC cells treated with different groups at different time points (12 h, 24 h).

[0084] 2. Wound healing cell scratch assay

[0085] (1) Before preparing the cell suspension, add EEC exosomes and EECD exosomes to HucMSC at 2 μg / well respectively. The cells are seeded in a 6-well plate. No exosomes are added to the control group. Exosomes are co-cultured with HucMSC for 12 h and 24 h.

[0086] (2) For the co-cultured HucMSC cells, use a sterile yellow pipette tip (the end in contact with the pipette) to make a vertical scratch along the center of the well plate to create a cell rupture zone.

[0087] (3) Observe the cell migration. Take pictures of the scratched area every 12 h, record the distance of the rupture zone for each time point and each group. Stop observing after the cell rupture zone closes, and perform statistical analysis.

[0088] VII. Detection of differential expression of miR-1303 and miR-4521 in the EECD-ex + HucMSC group, EEC-ex + HucMSC group, and HucMSC group by RT-qPCR

[0089] Total RNA was extracted from three groups of cell samples using TRIzol Reagent, and cDNA was synthesized by reverse transcription using Invitrogen's reverse transcription kit superscript III. The expression of miR-1303 and miR-4521 was detected by real-time fluorescence quantitative Real time PCR.

[0090] The miRNA sequences of miR-1303 and miR-4521 involved in this application are as follows:

[0091] miR-1303: UUUAGAGACGGGGUCUUGCUCU, SEQ ID NO:7;

[0092] miR-4521: GCUAAGGAAGUCCUGUGCUCAG, SEQ ID NO:8.

[0093] Among them, the reaction system (Table 1), reaction conditions (Table 2), and primers (Table 3) for Real time PCR detection.

[0094] Table 1 Real time PCR reaction system

[0095]

[0096] Table 2 Reaction conditions

[0097]

[0098] Table 3 Primers

[0099] gene sequence miR-1303-F ATGTGCGTTTAGAGACGGGGTC, SEQ ID NO:1 miR-1303-R ATCCAGTGCAGGGTCCGAGG, SEQ ID NO:2 miR-4521-F AAGTCGCGCTAAGGAAGTCCTG, SEQ ID NO:3 miR-4521-R ATCCAGTGCAGGGTCCGAGG, SEQ ID NO:4

[0100] Example 1 Effects of exosomes secreted by EECD on HucMSC

[0101] Experimental grouping: HucMSC group; EEC-ex + HucMSC group; EECD-ex + HucMSC group.

[0102] Among them, the EEC-ex + HucMSC group represents the co-culture of EEC-ex and HucMSC; the EECD-ex + HucMSC group represents the co-culture of EECD-ex and HucMSC.

[0103] I. Stem cell proliferation

[0104] 1. CCK-8 experiment, the results are as Figure 1As shown, compared with HucMSC, the proliferation activity of the EECD-ex+HucMSC group was significantly increased, showing co-culture time-dependence (24h, 48h, 72h), that is, with the extension of co-culture time, the effect of EECD-ex on promoting HucMSC proliferation became more obvious; there was no significant difference between the HucMSC group and the EEC-ex+HucMSC group.

[0105] 2. EdU experiment, the results are as Figure 2 shown. Compared with the HucMSC group, the proportion of proliferating cells in the EECD-ex+HucMSC group was significantly increased, showing co-culture time-dependence (72h, 96h), that is, with the extension of co-culture time, the effect of EECD-ex on promoting HucMSC proliferation became more obvious; there was no significant difference between the HucMSC group and the EEC-ex+HucMSC group.

[0106] II. Stem cell migration

[0107] 1. Transwell experiment, the results are as Figure 3 shown. Compared with the HucMSC group, the cell migration activity of the EECD-ex+HucMSC group was significantly increased, showing co-culture time-dependence (12h, 24h), that is, with the extension of co-culture time, the effect of EECD-ex on promoting HucMSC migration became more obvious; there was no significant difference between the HucMSC group and the EEC-ex+HucMSC group.

[0108] 2. Wound Healing scratch experiment, the results are as Figure 4 shown. Compared with the HucMSC group, the EECD-ex+HucMSC group significantly promoted cell migration activity, showing co-culture time-dependence (12h, 24h), that is, with the extension of co-culture time, the effect of EECD-ex on promoting HucMSC migration became more obvious; there was no significant difference between the HucMSC group and the EEC-ex+HucMSC group.

[0109] III. Differentiation potential of stem cells into EEC

[0110] Western Blot experiment, the results are as Figure 5 shown. Compared with the HucMSC group, the EECD-ex+HucMSC group significantly promoted the high expression of glandular epithelial markers CK19 and CD9, showing co-culture time-dependence (48h, 72h, 96h, 120h), that is, with the extension of co-culture time, EECD-ex further promoted the high expression of glandular epithelial markers CK19 and CD9 in the HucMSC group; there was no difference between the HucMSC group and the EEC-ex+HucMSC group; the expression of stromal marker proteins Vimentin and CD13 gradually decreased, also showing time-dependence. It shows that EECD-ex promoted the differentiation and development of HucMSC into EEC.

[0111] IV. RT-qPCR Detection

[0112] RT-qPCR was used to detect the expression levels of miR-1303 and miR-4521 in the HucMSC group, EEC-ex + HucMSC group, and EECD-ex + HucMSC group.

[0113] The results were as Figure 6 shown. Compared with the HucMSC group, the transcriptional levels of miR-1303 and miR-4521 in the EECD-ex + HucMSC group were significantly decreased, indicating that EECD-ex inhibited the transcriptional expression of miR-1303 and miR-4521.

[0114] In summary, EECD-ex inhibited the transcriptional expression of miR-1303 and miR-4521, promoted the proliferation, migration activation, and differentiation potential of HucMSC stem cells into EECs.

[0115] Example 2

[0116] Experimental grouping: HucMSC-NC inhibitor; HucMSC-miR-1303 inhibitor; HucMSC-miR-4521 inhibitor.

[0117] miR-1303 inhibitor: AGAGCAAGACCCCGTCTCTAAA, SEQ ID NO:5;

[0118] miR-4521 inhibitor: CTGAGCACAGGACTTCCTTAGC, SEQ ID NO:6.

[0119] I. Stem Cell Proliferation

[0120] Lentiviruses of miR-1303 inhibitor and miR-4521 inhibitor (synthesized by GeneChem) were synthesized and used to infect HucMSC cells respectively. The control group was infected with lentivirus of NC inhibitor. Proliferation experiments were performed at 24 h, 48 h, and 72 h after transfection.

[0121] 1. CCK-8 assay. The results were as Figure 7 shown. Compared with the NC inhibitor + HucMSC group transfected, the cell proliferation activities of the miR-1303 inhibitor + HucMSC group and miR-4521 inhibitor + HucMSC group were significantly increased, showing a transfection time-dependence (24 h, 48 h, 72 h).

[0122] 2. EdU experiment, the results are as Figure 8 shown. Compared with the group transfected with NC inhibitor + HucMSC, the cell proliferation ratios in the groups transfected with miR-1303 inhibitor + HucMSC and miR-4521 inhibitor + HucMSC were significantly increased, showing transfection time-dependence (72 h and 96 h).

[0123] II. Stem cell migration

[0124] Lentiviruses of miR-1303 inhibitor and miR-4521 inhibitor (synthesized by GeneChem) were synthesized and used to infect HucMSC cells respectively. The control group was infected with lentivirus of NC inhibitor. After transfection for 12 h and 24 h, Transwell migration and scratch experiments were performed.

[0125] 1. Transwell experiment, the results are as Figure 9 shown. Compared with the group transfected with NC inhibitor + HucMSC, the migration activities in the groups transfected with miR-1303 inhibitor + HucMSC and miR-4521 inhibitor + HucMSC were significantly enhanced, showing transfection time-dependence (12 h and 24 h).

[0126] 2. Wound Healing scratch experiment, the results are as Figure 10 shown. Compared with the group transfected with NC inhibitor + HucMSC, the cell migration activities in the groups transfected with miR-1303 inhibitor + HucMSC and miR-4521 inhibitor + HucMSC were significantly enhanced, showing transfection time-dependence (12 h and 24 h).

[0127] III. Differentiation potential of stem cells into EEC

[0128] Lentiviruses of miR-1303 inhibitor and miR-4521 inhibitor (synthesized by GeneChem) were synthesized and used to infect HucMSC cells respectively. The control group was infected with lentivirus of miR-NC. After transfection for 48 h, 72 h, 96 h, and 120 h respectively, total cell proteins were collected, and the expressions of EEC (CK19 and CD9) and HucMSC indexes (Vimentin and CD13) were detected by Western Blot (WB).

[0129] Western Blot experiment, the results are as Figure 11As shown, compared with the transfection of NC inhibitor + HucMSC group, in the transfection of miR-1303 inhibitor + HucMSC group and miR-4521 inhibitor + HucMSC group, with the prolongation of the transfection time of miR-1303 inhibitor or miR-4521 inhibitor into stem cells (48h, 72h, 96h, 120h): the expression of mesenchymal marker proteins Vimentin and CD13 gradually decreased, and the expression of adenoid epithelial marker proteins CK19 and CD9 gradually increased.

[0130] The above description shows that miR-miR-1303 inhibitor and miR-4521 inhibitor are potential marker molecules that mobilize the activation of HucMSC and promote its differentiation and development into EEC, which plays a certain role in promoting the repair of thin endometrium.

[0131] The technical features of the above embodiments can be combined arbitrarily. For the sake of concise description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.

[0132] The above embodiments only represent several implementation manners of the present application, and the description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims, and the specification can be used to explain the content of the claims.

Claims

1. Use of a biological agent for promoting differentiation of HucMSC into EEC, promoting proliferation and / or migration of HucMSC in the preparation of a product for preventing and / or treating thin endometrium, wherein the biological agent comprises a miR-1303 inhibitor lentivirus as shown in SEQ ID NO: 5 and / or comprises a miR-4521 inhibitor lentivirus as shown in SEQ ID NO:

6.

2. The use according to claim 1, characterized in that: The type of thin endometrium is a thin endometrium caused by hypoxic damage to endometrial cells.

3. The use according to claim 1, characterized in that: The products include pharmaceuticals.

4. The use according to claim 3, characterized in that: The medicine comprises active ingredients and pharmaceutically acceptable excipients.

5. The use according to any one of claims 1 to 3, characterized in that: The biological preparation also includes EECD supernatant exosomes.

Images