Application of miR-210-3p and / or miR-31-5p in thin endometrium

Abstract

This application relates to the application of miR-210-3p and / or miR-31-5p in thin endometrium. This application provides a biological agent comprising a substance that inhibits the expression or function of miR-210-3p and / or a substance that inhibits the expression or function of miR-31-5p. This application discovers that reducing the transcriptional expression of miR-210-3p and / or miR-31-5p can promote the differentiation of HucMSC into EEC and / or promote the proliferation and migration of HucMSC, and treat thin endometrium.

Description

Technical Field

[0001] The present application relates to the field of biomedicine, and specifically to the application of miR-210-3p and / or miR-31-5p in thin endometrium. Background Art

[0002] Thin endometrium usually refers to the endometrial thickness of less than 7-8 mm measured by ultrasound during the assisted reproductive technology (ART) cycle, when the follicles are mature or under the action of sufficient exogenous estrogen. One of the pathophysiological characteristics of thin endometrium is damage to the endometrial basal layer, increased uterine artery blood flow resistance and vascular dysplasia. The ischemic and hypoxic environment causes slow growth of endometrial cells, reduced glandular number and endometrial fibrosis, which ultimately causes endometrial regeneration disorders, affects endometrial receptivity, and reduces clinical pregnancy rate and live birth rate. Researchers are looking for effective treatments for thin endometrium through various approaches. Molecular markers are being tried in the diagnosis and treatment of thin endometrium.

[0003] Human umbilical cord mesenchymal stem cells (HucMSCs) regulate biological processes such as angiogenesis, immune response, cell proliferation and apoptosis, inflammatory response, and fibrosis. They have the advantages of simple material collection, rapid proliferation, low immunogenicity and tumorigenicity, and their effectiveness in treating thin endometrium has been confirmed, but the specific mechanism has not yet been clarified. The paracrine effect of HucMSCs plays an important role in the repair of damage. Exosomes (-ex) are important carriers of paracrine secretion. The micro messengerribonucleic acid (miRNA) carried in them participates in tissue damage repair and may benefit thin endometrium. Finding miRNAs related to the occurrence and development mechanism of thin endometrium is of great significance for the diagnosis and treatment of thin endometrium. Summary of the invention

[0004] Based on this, it is necessary to provide a biological preparation that can promote the proliferation and / or migration of HucMSC and the differentiation of HucMSC into EEC in one embodiment of the present application, and the biological preparation includes a substance that inhibits the expression or function of miR-210-3p and / or a substance that inhibits the expression or function of miR-31-5p, and the biological preparation is used to prevent and / or treat thin endometrium.

[0005] The technical solutions include the following:

[0006] The present application provides a biological agent, which includes a substance that inhibits the expression or function of miR-210-3p and / or a substance that inhibits the expression or function of miR-31-5p.

[0007] In one embodiment, the substance includes siRNA.

[0008] In one embodiment, the siRNA that inhibits the expression of miR-210-3p is shown as SEQ ID NO: 5-6.

[0009] In one embodiment, the siRNA that inhibits the expression of miR-31-5p is shown as SEQ ID NO: 7-8.

[0010] In one embodiment, the substance further includes an expression vector.

[0011] In one embodiment, the expression vector includes a viral vector.

[0012] In one embodiment, the biological agent further includes exosomes secreted by hypoxic injury endometrial glandular epithelial cells.

[0013] The present application also provides the use of the biological agent in the preparation of a product for preventing and / or treating thin endometrium.

[0014] In one embodiment, the type of the thin endometrium is the thin endometrium caused by hypoxic injury of endometrial cells.

[0015] The present application also provides the use of the biological agent in the preparation of a product for promoting the differentiation of HucMSC into EEC.

[0016] The present application also provides the use of the biological agent in the preparation of a product for promoting the proliferation and / or migration of HucMSC.

[0017] The present application also provides a product, including an active ingredient, and the active ingredient includes a substance that inhibits the expression or function of miR-210-3p and / or a substance that inhibits the expression or function of miR-31-5p.

[0018] In one embodiment, the product further includes exosomes secreted by hypoxic injury endometrial glandular epithelial cells.

[0019] In one embodiment, the product includes a drug.

[0020] In one embodiment, the substance includes siRNA.

[0021] In one embodiment, the siRNA that inhibits the expression of miR-210-3p is shown as SEQ ID NO:5-6.

[0022] In one embodiment, the siRNA that inhibits the expression of miR-31-5p is shown as SEQ ID NO:7-8.

[0023] In one embodiment, the expression vector includes, but is not limited to, viral vectors and plasmids.

[0024] In one embodiment, the viral vector includes lentivirus and / or adenovirus.

[0025] The present application also provides the use of miR-210-3p and / or miR-31-5p in screening drugs for preventing and / or treating thin endometrium, wherein the drugs can inhibit the expression level of miR-210-3p and / or miR-31-5p in HucMSC cells, and / or inhibit the function of miR-210-3p and / or miR-31-5p.

[0026] The present application also provides a method for screening drugs for preventing and / or treating thin endometrium, comprising the following steps:

[0027] Co-culturing a candidate drug with HucMSC cells; and

[0028] Screening a candidate drug that can inhibit the expression or function of miR-210-3p and / or miR-31-5p in HucMSC cells as a drug for preventing and / or treating thin endometrium.

[0029] In one embodiment, the co-culturing time is 24h-96h. Optionally, the co-culturing time is 24h, 48h, 72h, 96h, or the range composed of any two of the above values.

[0030] In one embodiment, the detection method for the expression of miR-210-3p and / or miR-31-5p includes the PCR method.

[0031] In one embodiment, the detection reagent for the expression of miR-210-3p and / or miR-31-5p includes detection primers.

[0032] In one embodiment, the detection primers for the expression of miR-31-5p are shown as SEQ ID NO:3-4.

[0033] In one embodiment, the detection primers for the expression of miR-210-3p are shown as SEQ ID NO:1-2.

[0034] Use of a reagent for detecting the expression level of miR-210-3p and / or miR-31-5p in the preparation of a product for diagnosing thin endometrium.

[0035] In one embodiment, the product includes a diagnostic kit.

[0036] In one embodiment, the miR-210-3p and / or miR-31-5p are significantly up-regulated in HucMSCs of patients with thin endometrium.

[0037] In one embodiment, the reagent for detecting the expression level of miR-210-3p and / or miR-31-5p includes primers.

[0038] In one embodiment, the primers for detecting miR-210-3p are shown as SEQ ID NO: 1-2, and the primers for detecting miR-31-5p are shown as SEQ ID NO: 3-4.

[0039] Compared with the traditional technology, the present application has the following beneficial effects:

[0040] The present application discovers that reducing the transcriptional expression of miR-210-3p and miR-31-5p, promoting the differentiation of HucMSCs into EECs and / or promoting the proliferation and migration of HucMSCs can treat thin endometrium, providing new ideas for the diagnosis, prevention and treatment of thin endometrium. Brief Description of the Drawings

[0041] In order to more clearly illustrate the technical solutions in the embodiments of the present application and more completely understand the present application and its beneficial effects, the following will briefly introduce the drawings required in the description of the embodiments. Obviously, the following drawings are only some embodiments of the present application. For those skilled in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0042] Figure 1 Expression results of miR-210-3p and miR-31-5p in the HucMSC group, EECD-ex + HucMSC group and EEC-ex + HucMSC group;

[0043] Figure 2 Graph showing the results of the CCK8 cell proliferation experiment in Example 2;

[0044] Figure 3 Graph showing the results of the EdU cell proliferation experiment (72h and 96h) in Example 2;

[0045] Figure 4These are the results of the Transwell cell migration experiment in Example 2. Figure A shows the results at 12 h, and Figure B shows the results at 24 h.

[0046] Figure 5 These are the results of the Wound Healing cell scratch experiment in Example 2. Figure A shows the results at 12 h, and Figure B shows the results at 24 h.

[0047] Figure 6 These are the results of the Western Blot experiment on the differentiation of HucMSC stem cells into EEC in Example 2. Figure A is the band diagram, and Figure B is the quantitative statistical chart. Detailed implementation manners

[0048] To make the above objects, features, and advantages of the present application more obvious and understandable, the following provides a detailed description of the specific implementation manners of the present application. Many specific details are set forth in the following description to fully understand the present application. However, the present application can be implemented in many other ways different from those described herein. Those skilled in the art can make similar improvements without departing from the connotation of the present application. Therefore, the present application is not limited by the specific embodiments disclosed below.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs. The terms used in the description of this application herein are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0050] The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0051] In this article, EEC, the full English name is endometrial epithelial cells, which refers to normal endometrial glandular epithelial cells.

[0052] In this article, EECD, the full English name is endometrial epithelial cell under damage, which refers to endometrial glandular epithelial cells damaged by hypoxia.

[0053] In this article, HucMSC, the full English name is human umbilical cord mesenchymal stem cell, which refers to human umbilical cord mesenchymal stem cells.

[0054] In this article, ex, the full English name is Exosome, which refers to exosome vesicles secreted by EEC or EECD (with a diameter between 30 - 150 nm).

[0055] The implementation solutions of this application will be described in detail below in conjunction with embodiments. It should be understood that these embodiments are only used to illustrate the application and not to limit the scope of the application. For the experimental methods without specific conditions noted in the following embodiments, preference is given to the guidance provided in this application. It can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions recommended by the manufacturer, or referring to the experimental methods known in the art.

[0056] In the following specific embodiments, for the measurement parameters of raw material components, if not otherwise specified, there may be slight deviations within the weighing accuracy range. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0057] The following examples involve the culture of EEC, EECD and HucMSC cells, as well as the preparation of EEC exosomes and EECD exosomes:

[0058] I. Culture of EEC cells

[0059] Normal endometrial glandular epithelial cells (EEC) were purchased from Shanghai Saibakang Biotechnology (human primary EEC, product number: HUM-iCell-f004), and the complete culture medium system of this company for this cell was used accordingly. The EEC was cultured in a constant temperature incubator at 37 °C and 5% CO2. When the density of EEC increased to 80% - 90%, cell amplification and passage were started, and the steps were as follows:

[0060] (1) Add the cell complete culture medium to PBS with a final concentration of 1× penicillin-streptomycin double antibody. Take out 0.25% trypsin from the 4 °C refrigerator and let it stand at room temperature for later use.

[0061] (2) Aspirate and discard the complete culture medium (reserve 3 mL for subsequent termination of digestion), gently wash the cells 3 times with 3 mL PBS, add 500 μL of 0.25% trypsin, and place it in a 37 °C CO2 incubator to digest the cells for 2 min. When the cells start to show a cascading flow state visually and a large area of cells are seen to be adherent and suspended and swimming under an inverted microscope, terminate the digestion and pipette the cells at the bottom 15 - 20 times. Centrifuge the cell suspension at 1,000 rpm / min at room temperature for 5 min.

[0062] (3) Discard the supernatant, disperse the cell mass precipitate at the bottom of the centrifuge tube with the finger pulp, add 3 mL of complete culture medium, and pipette to resuspend the cells. Prepare a new sterile cell culture flask, aspirate 4 mL of new complete culture medium and 1 mL of cell suspension into the new flask. After thoroughly mixing the cells, let them stand for 5 min to allow the cells to settle evenly to the bottom of the culture flask. Observe the cell adhesion situation and then transfer it to the CO2 incubator.

[0063] (4) After the EEC density has increased to 90%, digest, centrifuge, and resuspend the cells in fresh complete medium for subsequent identification.

[0064] The cells were observed to adhere and grow under a 100-fold optical microscope, showing a spindle shape, like paving stones, with no obvious cell boundaries and a parallel distribution, which is in line with the morphological characteristics of EEC. Take the second-generation EEC, and use immunofluorescence (IF) technology to identify the cell surface marker cytokeratin (PCK) of EEC cells, and verify the positive rate of PCK in EEC. The positive rate of PCK in EEC cells > 90%, indicating successful in vitro culture of EEC.

[0065] II. Construction of the EECD model

[0066] The EECD model was constructed under oxygen-glucose deprivation (OGD) conditions. For normal EEC culture, after passage 2 according to the previous cell culture amplification and passage steps, when the cell state is stable and the cell density reaches 80% - 90%, replace the low-glucose basal medium supplemented with 1% penicillin-streptomycin double antibody, and transfer the well plate to a special incubator under hypoxic conditions of 1% O2, 94% N2, and 5% CO2. For the well plate paved with EEC, set the culture time under OGD conditions for 4 h (the expression of hypoxia-related proteins VEGFA and αvβ3 is significantly up-regulated, and the expression of the epithelial cell marker protein E-cadherin is significantly decreased). After 4 h, restore normoxia and high glucose, and continue to culture for 24 h before subsequent experiments.

[0067] III. Extraction of exosomes from EEC and EECD supernatants

[0068] (1) Take the cell culture medium, aliquot it into sterilized centrifuge bottles or centrifuge tubes, and centrifuge at 4°C and 1000×g for 10 min in a low-temperature centrifuge to remove cell culture supernatant, debris, and dead cells in the culture medium;

[0069] (2) After centrifugation, filter the supernatant through a 0.2 mm filter and aliquot it into sterilized centrifuge bottles;

[0070] (3) Centrifuge the supernatant culture medium at 4°C and 100,000×g for 3 h;

[0071] (4) Discard the supernatant, add 10 mL of pre-cooled 1×PBS, and wash the precipitate at 4°C and 100,000×g in an ultra-high-speed centrifuge for 90 min;

[0072] (5) Discard the supernatant. Resuspend the exosome-containing particles at the bottom of the tube with 50 μL of pre-cooled 1× PBS, transfer them to a 1.5 ml EP tube, and perform BCA quantification. Store at -80 °C for later use. Observation by transmission electron microscopy (TEM) showed that the morphology of exosomes was a double-sided concave bilayer disc-shaped structure. Nanoparticle tracking analysis (NTA) technology was used to analyze that the diameter of exosomes was 30 - 200 nm and indicated high purity, and Western blot (WB) identification showed significantly high expression of exosome marker proteins CD81 and CD63, confirming the successful extraction of exosomes from EEC and EECD supernatants.

[0073] IV. HucMSC Cell Culture

[0074] HucMSCs were purchased from Shanghai Saibakang Biotechnology (primary HucMSCs, product number: HUM-iCell-e009). A culture medium system and cell digestion system consisting of Gibco's α-MEM basal medium, FBS (Australian fetal bovine serum), 0.25% trypsin, and 100× penicillin-streptomycin double antibody were used for culturing in a 37 °C, CO₂ incubator for cell amplification and passage. The 4th - 6th generation of cultured HucMSCs were collected. After the cell density was amplified to 90%, the cells were digested, centrifuged, and resuspended with fresh complete medium for subsequent experiments.

[0075] The gene sequences of miR-210-3p and miR-31-5p involved in this application are as follows:

[0076] miR-210-3p: CUGUGCGUGUGACAGCGGCUGA, SEQ ID NO:9;

[0077] miR-31-5p: AGGCAAGAUGCUGGCAUAGCU, SEQ ID NO:10.

[0078] Example 1

[0079] Experimental grouping: HucMSC group; EEC-ex + HucMSC group; EECD-ex + HucMSC group.

[0080] Add EEC exosomes and EECD exosomes to HucMSCs at 2 μg / well respectively. No exosomes were added to the control group. The exosomes and HucMSCs were co-cultured for 48 h.

[0081] PCR was used to detect the expression of miR-210-3p and miR-31-5p in the HucMSC group, EEC-ex + HucMSC group, and EECD-ex + HucMSC group.

[0082] Total RNA was extracted from three groups of cell samples using TRIzol Reagent, and cDNA was synthesized by reverse transcription using Invitrogen's reverse transcription kit superscript III. The expression of miR-210-3p and miR-31-5p was detected by real-time fluorescence quantitative Real time PCR.

[0083] Among them, the reaction system (Table 1) and reaction conditions (Table 2) for Real time PCR detection.

[0084] Table 1 Real time PCR reaction system

[0085]

[0086] Table 2 Reaction conditions

[0087]

[0088] Among them, the primers for detecting the expression of miR-210-3p are as follows:

[0089] Forward primer: AACCATGCTGTGCGTGTGACA, SEQ ID NO:1;

[0090] Reverse primer: ATCCAGTGCAGGGTCCGAGG, SEQ ID NO:2.

[0091] The primers for detecting the expression of miR-31-5p are as follows:

[0092] Forward primer: AACGGCAGGCAAGATGCTGG, SEQ ID NO:3;

[0093] Reverse primer: ATCCAGTGCAGGGTCCGAGG, SEQ ID NO:4.

[0094] The results are as Figure 1 shown, EECD-ex promoted the down-regulation of miR-210-3p and miR-31-5p transcriptional expression.

[0095] Furthermore, the proliferation, migration and potential for differentiation into EEC of HucMSC cells in the HucMSC group, EEC-ex + HucMSC group and EECD-ex + HucMSC group were analyzed.

[0096] The above results showed that EECD-ex promoted the down-regulation of miR-210-3p and miR-31-5p transcriptional expression, and promoted the activation of HucMSC stem cell proliferation, migration functions and the potential for differentiation into EEC.

[0097] Example 2

[0098] Experimental grouping: HucMSC-NC inhibitor; HucMSC-miR-210-3p inhibitor; HucMSC-miR-31-5p inhibitor.

[0099] miR-210-3p inhibitor:

[0100] Upstream sequence: CUGUGCGUGUGACAGCGGCUGAAA, SEQ ID NO:5;

[0101] Downstream sequence: UCAGCCGCUGUCACACGCACAGUU, SEQ ID NO:6.

[0102] miR-31-5p inhibitor:

[0103] Upstream sequence: AGGCAAGAUGCUGGCAUAGCUAA, SEQ ID NO:7;

[0104] Downstream sequence: AGCUAUGCCAGCAUCUUGCCUUU, SEQ ID NO:8.

[0105] I. Stem cell proliferation

[0106] Lentiviruses of miR-210-3p inhibitor and miR-31-5p inhibitor (synthesized by GeneChem) were synthesized and used to infect HucMSC cells respectively. The control group was infected with lentivirus of NC inhibitor. After transfection for different time periods (24h - 96h), CCK-8 and EdU experiments were performed respectively:

[0107] 1. CCK-8 experiment

[0108] Cell suspensions of each group were prepared and added to 96-well plates. According to 10 μL of CCK8 stock solution + 100 μL of serum-free basal medium per well, CCK8 working solution was prepared. The CCK8 experiment was performed under light protection throughout the process. The medium in the 96-well plates was aspirated, and the CCK8 reagent prepared in the above steps was added to the wells. The plates were transferred to a 37 °C cell culture incubator and incubated for 1.5 h to allow the CCK8 reagent to fully bind to the cells in the proliferation phase.

[0109] Aspirate 95 μL of the CCK8 supernatant of the cells incubated in each experimental group in the previous step and transfer it to a new 96-well plate. Also transfer the prepared CCK8 working solution to the new 96-well plate for a blank control. Finally, read the absorbance value of the new 96-well plate at 450 nm using a microplate reader. Collect the data at 24 h, 48 h, and 72 h, and use Graphpad Prism 7.0.0 to statistically analyze the differences in cell proliferation activity (abscissa: time; ordinate: absorbance value OD).

[0110] The results are as Figure 2 shown. Compared with the group transfected with NC inhibitor + HucMSC, the cell proliferation activities of the groups transfected with miR-210-3p inhibitor + HucMSC and miR-31-5p inhibitor + HucMSC were significantly increased, showing transfection time dependence (24 h, 48 h, 72 h).

[0111] 2. EdU assay

[0112] After co-culturing the lentivirus with HucMSC for 72 h and 96 h, perform EdU detection according to the Beyotime BevotCLick TM EdU-594 Cell Proliferation Detection Kit.

[0113] The results are as Figure 3 shown. Compared with the group transfected with NC inhibitor + HucMSC, the cell proliferation ratios of the groups transfected with miR-210-3p inhibitor + HucMSC and miR-31-5p inhibitor + HucMSC were significantly increased, showing transfection time dependence (72 h and 96 h).

[0114] II. Stem cell migration

[0115] Synthesize the lentiviruses of miR-210-3p inhibitor and miR-31-5p inhibitor (synthesized by GeneChem Co., Ltd.), infect HucMSC cells respectively, and infect the control group with the lentivirus of NC inhibitor. After transfection for 12 h and 24 h, perform Transwell and Wound Healing assays respectively:

[0116] 1. Transwell assay

[0117] It includes the following steps:

[0118] Digest the cells. After terminating digestion, centrifuge and discard the culture medium, wash 1-2 times with PBS, and resuspend with serum-free medium containing BSA. Adjust the cell density to 5×10 5cells / ml; Take 100 μl of the cell suspension and add it to the Transwell chamber; Add 600 μl of medium containing 20% FBS to the lower chamber of the 24-well plate; Culture routinely and observe the differences in the migration ability of HucMSC cells treated with different groups at different time points (12 h, 24 h).

[0119] The results are as Figure 4 shown. Compared with the transfection of NC inhibitor + HucMSC group, the migration activities of the transfection of miR-210-3p inhibitor + HucMSC group and miR-31-5p inhibitor + HucMSC group were significantly enhanced, showing a transfection time dependence (12 h and 24 h).

[0120] 2. Wound Healing scratch assay

[0121] It includes the following steps:

[0122] For each group of cells after transfection for 12 h and 24 h, use a sterile and disinfected yellow pipette tip, and make a vertical scratch along the center of the well plate at the end in contact with the pipette, so that a cell fracture zone appears; Observe the cell migration situation, take photos of the scratch site every 12 h, record the distance of the fracture zone for each time point and each group, stop observing after observing that the cell fracture zone closes, and perform statistical analysis.

[0123] The results are as Figure 5 shown. Compared with the transfection of NC inhibitor + HucMSC group, the migration activities of the transfection of miR-210-3p inhibitor and miR-31-5p inhibitor + HucMSC group were significantly enhanced, showing a transfection time dependence (12 h and 24 h).

[0124] IV. Differentiation potential of stem cells into EEC

[0125] Synthesize lentiviruses of miR-210-3p inhibitor and miR-31-5p inhibitor, infect HucMSC cells respectively, and the control group is infected with miR-NC lentivirus. After transfection at different time points, collect the total cell protein, and detect the expression of EEC (CK19 and CD9) and HucMSC indexes (Vimentin and CD13) by Western Blot.

[0126] The results are as Figure 6As shown, compared with the group transfected with NC inhibitor + HucMSC, in the groups transfected with miR-210-3p inhibitor and miR-31-5p inhibitor + HucMSC, as the transfection time of miR-210-3p inhibitor or miR-31-5p inhibitor into stem cells was prolonged (48h, 72h, 96h, 120h): the expression of mesenchymal marker proteins Vimentin and CD13 gradually decreased; the expression of adenoid epithelial marker proteins CK19 and CD9 gradually increased.

[0127] The above indicates that miR-210-3p inhibitor and miR-31-5p inhibitor may be potential marker molecules that mobilize the activation of HucMSC (human umbilical cord mesenchymal stem cells) and promote their differentiation into EEC (endometrial adenoid epithelial cells), playing a certain role in promoting the repair of thin endometrium.

[0128] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0129] The above-described embodiments only represent several implementation manners of the present application. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims, and the specification can be used to explain the content of the claims.

Claims

1. Use of a biological agent in the preparation of a product for preventing and / or treating thin endometrium, the biological agent comprising siRNA that inhibits the expression or function of miR-210-3p and / or siRNA that inhibits the expression or function of miR-31-5p, The siRNA for inhibiting the expression of miR-210-3p is shown in SEQ ID NO: 5-6, The siRNA that inhibits the expression of miR-31-5p is shown in SEQ ID NO: 7-8.

2. The use according to claim 1, characterized in that: The biological preparations also include exosomes secreted by hypoxia-damaged endometrial glandular epithelial cells.

3. The use according to claim 1, characterized in that: The type of thin endometrium is a thin endometrium caused by hypoxic damage to endometrial cells.

4. The use according to any one of claims 1 to 3, characterized in that The biological agent promotes the differentiation of HucMSC into EEC.

5. The use according to any one of claims 1 to 3, characterized in that The biological agent promotes the proliferation and / or migration of HucMSCs.

Images