NtHAK37 gene and application thereof

By cloning and overexpressing the tobacco NtHAK37 gene, the problem of tobacco growth restriction under drought conditions was solved, the drought resistance of tobacco was improved, and a theoretical basis and breeding basis for new drought-resistant germplasm were provided.

CN119307541BActive Publication Date: 2026-02-06ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411749889.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-02
Publication Date
2026-02-06
Estimated Expiration
2044-12-02

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively elucidate the drought stress response mechanism of tobacco, and the lack of drought-resistant genes leads to limited growth of tobacco in arid regions, affecting yield and quality.

Method used

The NtHAK37 gene was cloned from tobacco through whole-genome resequencing and association analysis. Overexpression of this gene enhanced the tolerance of tobacco to drought stress. Agrobacterium-mediated transformation was used to transfer the gene into tobacco, construct recombinant plasmids, and cultivate new drought-resistant germplasm.

Benefits of technology

It significantly improved the tolerance of tobacco to drought stress, enhanced plant height, fresh weight, photosynthetic rate, number of leaves and functional leaf area, and improved the growth of tobacco under drought conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119307541B_ABST
    Figure CN119307541B_ABST
Patent Text Reader

Abstract

The application discloses an NtHAK37 gene and application thereof, and belongs to the technical field of genetic engineering. A CDS region nucleotide sequence of the NtHAK37 gene is shown as SEQ ID NO. 1. The application verifies the function of the gene on tobacco K326 by cloning and analyzing the NtHAK37 gene and combining overexpression technology. The NtHAK37 gene positively regulates the tolerance of a plant to drought stress, and overexpression of the NtHAK37 gene significantly increases the tolerance of the plant to drought stress. The application provides a theoretical basis and related genes for crop drought stress tolerance breeding and production, and especially for creation of new tobacco drought tolerance germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular to NtHAK37 gene and its application in regulating the drought tolerance of plants. BACKGROUND

[0002] Global climate change has brought many challenges to agricultural production, and extreme weather events such as high temperature, flooding and drought have become increasingly common (Yang et al., 2023). Drought is defined as the availability of water resources being lower than the normal level of plant growth. Under drought conditions, plant growth is inhibited, cell morphology changes, photosynthesis is limited, and the osmoregulation and antioxidant system is damaged, showing severe growth inhibition. Due to its high frequency, long duration and wide spatial coverage (Zhan et al., 2024), the loss caused by drought may exceed that of many other abiotic stresses (Feng et al., 2020). Developing and cultivating drought-tolerant crop varieties is an economically effective method to achieve sustainable production of crops in drought areas.

[0003] As sessile organisms, plants have evolved complex mechanisms to adapt to drought, including regulating stomatal control of transpiration rate (Su et al., 2024) and root growth and development (He et al., 2015) to maintain water status during the initial stage of water deficit, accumulating osmoregulatory substances to maintain cell water potential (Du et al., 2023), and using antioxidant defense systems to alleviate damage caused by drought stress (Huo et al., 2016). Therefore, identifying drought-tolerant germplasm, mining drought-tolerant genes, and understanding the mechanisms related to crop drought tolerance are crucial for cultivating drought-tolerant crop varieties and ensuring agricultural production.

[0004] Tobacco (Nicotiana tabacum L.) is an annual herb of the Solanaceae family. Due to its high medicinal value and ease of tissue culture, it has become a model plant for research in agriculture and biology. At the same time, tobacco is also an important economic crop widely planted around the world (Zou et al., 2018). However, due to the frequent occurrence of drought climate in tobacco planting areas, it leads to reduced plant height, small leaf expansion, reduced mineral element absorption, reduced reducing sugar content, increased total nitrogen and nicotine content, reduced oil content in tobacco leaves, and difficulty in forming and transforming tobacco aroma substances. Therefore, there is increasing interest in understanding the mechanisms of drought stress response in tobacco, identifying drought-tolerant genes, and cultivating more drought-tolerant tobacco varieties. SUMMARY

[0005] The present application aims to provide a gene with drought tolerance cloned from tobacco, and provide a related gene and theoretical basis for creating new drought-tolerant tobacco germplasm.

[0006] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0007] The present application uses whole genome resequencing and whole genome association analysis technology, combined with agronomic traits under drought stress, to identify a gene Nta14g09530 related to tobacco drought stress resistance from 300 core tobacco germplasm. The gene is located on the 14th chromosome of tobacco and is annotated as High affinity K+transporter 5. According to the position of HAK family on the tobacco chromosome, the gene is named NtHAK37.

[0008] NtHAK37 gene cloning and analysis: the full-length CDS region sequence of the gene is cloned from tobacco K326, and the nucleotide sequence is shown as SEQ ID NO. 1.

[0009] The full-length CDS region of NtHAK37 gene is 1938bp, encoding a protein sequence composed of 645 amino acid residues, and the amino acid sequence is shown as SEQ ID NO. 2. The molecular weight of the protein is 73.00kDa, and the isoelectric point pI=7.94.

[0010] NtHAK37 protein sequence domain and transmembrane helix analysis, the results show that the protein contains one functional domain: K_trans functional domain and 10 transmembrane helices.

[0011] Tobacco HAK family analysis, the results show that there are 55 HAK family members in tobacco, distributed on 19 chromosomes, named NtHAK1-NtHAK55 according to the chromosome distribution, and the target gene NtHAK37 is located on the 14th chromosome. NtHAK37 gene promoter sequence analysis shows that this region has a variety of cis-acting elements, including 4 drought-induced elements, 1 abscisic acid response element and 5 light response elements.

[0012] NtHAK37 evolution analysis shows that NtHAK37 protein has the highest sequence similarity with tomato SlHAK5, with a similarity of 65.8%.

[0013] The NtHAK37 gene is expressed in the roots, root tips, stems, old leaves, middle leaves and young leaves of the plants, and the expression amount is the highest in the root tips and the second in the roots. The expression amount of NtHAK37 in the drought-resistant genotype T218 and the drought-sensitive genotype T180 screened in the early stage is detected, and the results show that, compared with the control condition, the expression amount of NtHAK37 of the drought-resistant genotype T218 increases under drought stress, but the expression amount of NtHAK37 of the drought-sensitive genotype T180 does not change obviously under drought stress.

[0014] The NtHAK37 gene is overexpressed in tobacco K326 by using overexpression technology, and the results show that, under drought stress, the growth of the plant overexpressing NtHAK37 is significantly better than that of the wild K326 plant. Under drought treatment, the plant height, fresh weight, photosynthetic rate, SPAD value, leaf number per plant and functional leaf area reduction rate of the overexpression strain are all less than those of the wild K326 plant. These results show that NtHAK37 positively regulates the drought resistance of tobacco.

[0015] Therefore, the application provides the application of the NtHAK37 gene in regulating the drought stress tolerance of plants. Mechanism research shows that the NtHAK37 gene positively regulates the drought stress tolerance of plants.

[0016] Further, the plant can be but is not limited to tobacco.

[0017] Based on the positive regulation of the NtHAK37 gene on the drought stress tolerance of plants, the expression of the NtHAK37 gene in plants can be up-regulated by using genetic engineering technology to enhance the drought stress tolerance. Specifically, the application comprises: using biological technology to up-regulate the expression of the NtHAK37 gene in plants to improve the drought stress tolerance of the plants.

[0018] Further, the application comprises: cloning the NtHAK37 gene fragment with the nucleotide sequence as shown in SEQ ID NO. 1 into a plant overexpression vector to construct a recombinant plasmid, and using the agrobacterium-mediated technology to transfer the target fragment in the recombinant plasmid into a receptor plant to cultivate a transgenic plant with enhanced drought stress tolerance.

[0019] The plant overexpression vector in the application can be a vector commonly used in the art for agrobacterium-mediated genetic transformation technology, and can be but is not limited to a pHK-35S vector.

[0020] Further, the agrobacterium is GV3101 agrobacterium.

[0021] Further, the receptor plant is tobacco K326.

[0022] The application has the following beneficial effects:

[0023] This invention, through the cloning and analysis of the NtHAK37 gene and its functional verification in tobacco K326 using overexpression technology, demonstrates that the NtHAK37 gene positively regulates plant tolerance to drought stress, and overexpression of the NtHAK37 gene significantly increases plant tolerance to drought stress. This invention provides a theoretical basis and related genes for crop breeding and production with drought tolerance, especially for the creation of new drought-tolerant tobacco germplasm. Attached Figure Description

[0024] Figure 1 This is a prediction plot of the functional domain of NtHAK37.

[0025] Figure 2 The image shows the predicted transmembrane helix of NtHAK37.

[0026] Figure 3 Chromosome analysis of the HAK family of tobacco.

[0027] Figure 4 Gene structure analysis of the HAK family of tobacco.

[0028] Figure 5 Phylogenetic analysis of NtHAK37 and the HAK family genes in rice, tomato, and Arabidopsis.

[0029] Figure 6 This is a comparison diagram of the amino acid sequences of NtHAK37 with AtHAK5, SlHAK5, and OsHAK5.

[0030] Figure 7 The expression patterns of the NtHAK37 gene are shown in (A) and (B) respectively. (A) shows the expression patterns of the NtHAK37 gene in different parts of tobacco. (B) shows the induced expression of the NtHAK37 gene in drought-tolerant genotype T218 and drought-sensitive genotype T180 under drought treatment.

[0031] Figure 8 To identify the drought-tolerant phenotype of overexpressing plants, (A) the relative expression level of the NtHAK37 gene in each treatment line was detected by qRT-PCR; (B) phenotypic analysis of each line after drought stress treatment; (C) plant height (cm) of each line after drought stress treatment; (D) fresh leaf weight (g) of each line after drought stress treatment; and (E) photosynthetic rate (μmol CO2 m) of each line after drought stress treatment. -2 s -1 (F) represents the SPAD value of each line after drought stress treatment; (G) represents the number of leaves per plant in each line after drought stress treatment; (H) represents the functional leaf area (cm²) of each line after drought stress treatment. 2 ). Detailed Implementation

[0032] The technical solutions of the present application are further specifically described below through specific examples. It should be understood that the implementation of the present application is not limited to the following examples, and any form of variation and / or change made to the present application will fall within the scope of protection of the present application.

[0033] In the present application, all parts and percentages are by weight unless otherwise specified, and the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following examples are conventional methods in the art unless otherwise specified.

[0034] The present application is based on the analysis of the agronomic traits of 300 core tobacco germplasm under drought stress by the research group in the early stage, and identifies, clones and analyzes key genes that regulate tobacco drought tolerance. It has important guiding significance for elucidating the molecular mechanism of tobacco response to drought stress and the breeding and production of drought-tolerant tobacco.

[0035] Example 1: Cloning and analysis of NtHAK37 gene CDS region

[0036] 1. Tobacco growth conditions

[0037] Tobacco K326 seeds were sterilized with 75% alcohol for 30s and washed with sterile water for 1min. The sterilized tobacco seeds were sown on moistened nutrient soil and germinated in a phytotron (22℃ / 18℃, day / night), and after 10d the germinated seedlings were transplanted to outdoor soil culture. The pot specifications were: 10.0cm x 10.0cm x 12.5cm, and the soil was collected from the test farm (0-20cm depth). One day before transplanting, the soil was uniformly moistened with 1 / 5 Hogland nutrient solution (pH = 5.8-6.0), and seedlings with uniform growth were selected, with one seedling per pot. After 30d, drought treatment was performed: the control was normally watered to maintain soil moisture content of about 35%-45%, and the drought treatment stopped watering and allowed the soil to dry naturally.

[0038] 2. Cloning of NtHAK37 gene CDS region sequence

[0039] Total RNA was extracted according to the instructions of the RNA extraction kit (Takara, Japan), and genomic DNA contamination in the total RNA was removed with DNase I. The extracted total RNA was reverse transcribed into cDNA for cloning, and specific primers were designed according to the sequence obtained by Blast:

[0040] NtHAK37_CDS_F:

[0041] 5'-ATGTGTCGATATGCAAAAGTGAGTCTTATCCC-3' (SEQ ID NO. 3);

[0042] NtHAK37_CDS_R:

[0043] 5'-TTATAATTCATAAGTCATGCCGACCCTTAGCA-3' (SEQ ID NO. 4).

[0044] The amplified product was ligated into pMD18-T (Takara, Japan) vector, transformed into E. coli DH5a, and positive clones were selected for sequencing. The plasmid was named pMD18-T-NtHAK37. The synthesis of PCR primers and gene sequencing were completed by Zhejiang Shangya Biotechnology Co., Ltd.

[0045] 3. Sequence analysis of NtHAK37 gene

[0046] The NtHAK37 protein sequence was analyzed for functional domains by SMART (http: / / smart.embl-heidelberg.de / ) website. As shown in Table 1, the protein contains a K_trans functional domain. The transmembrane helix was predicted by TMHMM (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ). As shown in Table 2, the protein has 10 transmembrane helix structures. Figure 1 Figure 2

[0047] Identification of HAK family in tobacco. First, the entire tobacco protein database was searched by local BLASTP (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) using previously known HAK proteins from Arabidopsis, rice, and tomato as queries, with an e-value cutoff of 10 -10 and a score threshold of 100. Second, the HAK family. hmm file was obtained from the Pfam database, and the tobacco protein database was searched using the HMMER v3.0 software package (http: / / hmmer.org / ), with an e-value cutoff of 10 -20 and a score threshold of 200. Genes identified by both methods were considered members of the tobacco HAK family. As shown in Table 3, a total of 55 NtHAK family genes were identified, distributed on 19 chromosomes. Figure 3

[0048] ​​​Motif prediction was performed using MEME (https: / / meme-suite.org / meme / tools / meme), conserved domain analysis was performed using Batch CD-Search (https: / / www.ncbi.nlm.nih.gov / Structure / bwrpsb / bwrpsb.cgi), phylogenetic tree was constructed by MAFFT and MEGA-X software, promoter cis-acting element prediction and gene structure analysis were performed using TBTools, as shown in Figure 4 The NtHAK37 promoter includes 4 drought-induced elements, 1 abscisic acid response element, and 5 light response elements.

[0049] The HAK protein sequences in different species including NtHAK37 were analyzed by MAFFT and MEGA-X software, and a phylogenetic tree was constructed. As shown in Figure 5 、 Figure 6 NtHAK37 is in the same evolutionary branch as tomato SlHAK5 in evolution, and the sequence similarity between them is 65.8%.

[0050] 4. NtHAK37 gene expression analysis

[0051] The total RNA extraction kit (Takara, Japan) was used to extract the total RNA of the roots, root tips, stems, old leaves, middle leaves, and young leaves of normally growing tobacco K326, as well as the total RNA of the controls, drought-treated T218 (drought-resistant genotype), and T180 (drought-sensitive genotype). DNase I was used to remove genomic DNA contamination in the total RNA, and the PrimeScript RT reagent Kit (Takara, Japan) was used to reverse transcribe the total RNA of each sample into single-stranded cDNA. SYBR green fluorescent enzyme complex (Takara, Japan) and Light Cycler 480 PCR instrument (Roche, Switzerland) were used for fluorescence quantitative PCR analysis (qRT-PCR) of the expression of NtHAK37 gene in the corresponding samples, and a reference gene NtL25 was used to correct the expression values.

[0052] The RT-PCR primer sequences are as follows:

[0053] NtHAK37-qpcr-F: 5'-ATTTGCTCCAGCCATTTGCATT-3' (SEQ ID NO. 5);

[0054] NtHAK37-qpcr-R: 5'-TCCACCAAGAGAGATCCATCCT-3' (SEQ ID NO. 6);

[0055] qNtL25_F: 5'-CAAAAGTTACATTCCACCG-3' (SEQ ID NO.7);

[0056] qNtL25_R: 5'-TTTCTTCGTCCCCATCAGGC-3' (SEQ ID NO. 8).

[0057] The qRT-PCR system (total volume 20 μL) consisted of: 10 μL SYBR Green Realtime PCR Master Mix, 0.8 μL NtHAK37-qpcr-F / qNtL25_F, 0.8 μL NtHAK37-qpcr-R / qNtL25_R, 2 μL cDNA, and 6.4 μL ddH2O.

[0058] The specific PCR program was: 95℃ for 30 seconds, followed by 40 cycles of (95℃ for 5 seconds, 60℃ for 10 seconds, and 72℃ for 15 seconds). The melting curve program was: 60℃-95℃, 5 seconds per step, increasing in 0.5℃ increments. Using 2... -ΔΔCq Changes in gene expression values ​​were calculated using relative quantitative methods. Each experiment was repeated three times.

[0059] The results obtained are as follows: Figure 7 As shown in (A), the NtHAK37 gene is expressed in tobacco roots (R), root tips (RT), stems (S), old leaves (SL), middle leaves (ML), and young leaves (YL), with the highest expression level in root tips and the second highest in roots.

[0060] like Figure 7 As shown in (B), compared with the control condition, the expression level of NtHAK37 increased in the drought-resistant genotype T218 under drought stress, but the expression level of NtHAK37 remained unchanged in the drought-sensitive genotype T180 under drought stress, indicating that this gene may positively regulate the drought resistance of tobacco.

[0061] Example 2: Overexpression to verify NtHAK37 gene function

[0062] 1. Construction of overexpression vectors

[0063] Design primers with homologous arms:

[0064] NtHAK37_OX_F:

[0065] 5'- CTATTTACAATTACGGATCC ATGTGTCGATATGCAAAAGTGAGTCT TATCCC-3' (SEQ IDNO.9);

[0066] NtHAK37_OX_R:

[0067] 5’- TGAAGACAGAGCTAGTTACA TTATAATTCATAAGTCATGCCGACCC TTAGCA-3’(SEQ IDNO.10).

[0068] PCR amplification products were detected by 1% agarose gel electrophoresis, the target product was purified by gel recovery, and the concentration of the recovered product was measured.

[0069] The vector enzyme digestion system (20 μL) was: Nuclease-free Water 13 μL, 10×Buffer 2 μL, BsaI / Eco31I 1 μL, vector 4 μL. The vector used was based on pHK-35S vector, with double 35s promoter, and enhancer TMVΩ added at the end of the promoter (Synthetic microbe-to-plant communication channels. Nature Communications, 2024, 15: 1817).

[0070] The enzyme digestion reaction conditions were: 37°C for 1h.

[0071] The recombination reaction system (20 μL) was: Biorun 2×EasyClone Mix 10 μL, pBWA(V)H2STMVΩ-ccdB(D) 5 μL, NtHAK37 amplification product 5 μL.

[0072] The recombination reaction conditions were: 37°C for 30min

[0073] 5-10 μL of the ligation product was transformed into competent E. coli, and the kanamycin-resistant plate was cultured at 37°C for 12 hours, and the plasmid was extracted.

[0074] 2. Tobacco genetic transformation

[0075] 1 μL of the recombinant plasmid was used to transform GV3101 Agrobacterium competent cells, and the Agrobacterium was picked into the infection solution to prepare an OD 600=0.2. Sterilized tobacco K326 seeds were sowed on germination medium and cultured at 23°C with 16h / 8h light / dark for 4-5 weeks. Aseptic tobacco leaves were cut into small pieces with a scalpel and inoculated on pre-culture medium. Tobacco leaves pre-cultured for 2-3 days were inoculated in Agrobacterium suspension and infected for 10-15 min. The infected leaves were inoculated on filter paper, air-dried and inoculated on co-culture medium and cultured in dark for 48-72h. The co-cultured leaves were transferred to induction medium to induce callus for about 10 days. The callus was inoculated on selection medium corresponding to the resistance and cultured for 15-30 days at 23±2°C. The positive callus growing vigorously was inoculated on differentiation medium with 4-5 callus per dish and cultured at 23°C with 16h / 8h light / dark for 15-30 days. During the differentiation process, if seedlings were formed, they were inoculated on strong seedling medium and cultured for 7-10 days. They were transplanted to large pots and seeds were collected. Two lines with higher expression were selected for subsequent drought treatment experiments.

[0076] 3. Phenotype identification of NtHAK37 overexpression lines

[0077] K326 and two NtHAK37 overexpression lines were used to verify the drought tolerance of tobacco after overexpression of NtHAK37. Soil culture drought treatment was also used and the planting method was as described above.

[0078] NtHAK37 expression was measured when the soil water content reached about 10% during drought treatment, as shown in Figure 8 (A).

[0079] Physiological and biochemical indexes and agronomic traits were measured when the soil water content reached 6%, as shown in Figure 8 (B). Compared with the control, the leaves of wild type K326 wilted significantly after drought treatment, while the leaves of NtHAK37 overexpression lines wilted less. As shown in Figure 8 (C-H), under drought treatment, the plant height, leaf fresh weight, photosynthetic rate, SPAD value, leaf number per plant and functional leaf area of wild type K326 lines were 76.72%, 35.43%, 34.11%, 81.34%, 53.13% and 68.55% of the control, respectively, while the corresponding values of the two overexpression lines were 92.44% / 94.02%, 58.59% / 59.70%, 60.35% / 51.41%, 117.10% / 104.68%, 74.6% / 72.31% and 82.56% / 74.57%, respectively.

[0080] The above results show that overexpression of NtHAK37 improves the drought tolerance of tobacco, further proving that NtHAK37 positively regulates the drought tolerance of tobacco.

[0081] In summary, by cloning and analyzing tobacco NtHAK37, and combining overexpression technology to verify the function of the gene on K326, it is found that the drought tolerance of NtHAK37 overexpression plants is significantly enhanced. The present application provides a theoretical basis and related genes for barley drought stress breeding and production.

[0082] Finally, it should also be noted that the above are only some specific embodiments of the present application. Obviously, the present application is not limited to the above embodiments, but can also have many variations. All variations that can be directly derived or inferred from the content disclosed by a person of ordinary skill in the art should be considered as falling within the scope of the present application.

Claims

1. Use of the NtHAK37 gene in modulating the tolerance of a plant to drought stress, characterized in that, The application comprises: up-regulating the expression of NtHAK37 gene in the plant by biological technical means to improve the drought stress tolerance of the plant; the CDS region nucleotide sequence of the NtHAK37 gene is shown as SEQ ID NO. 1; and the plant is tobacco.

2. Use according to claim 1, wherein The amino acid sequence of the protein coded by the NtHAK37 gene is shown as SEQ ID NO.

2.

3. The use according to claim 1, wherein The application comprises: cloning the NtHAK37 gene fragment with the nucleotide sequence shown as SEQ ID NO. 1 into a plant overexpression vector to construct a recombinant plasmid, using the agrobacterium-mediated technology to transfer the target fragment in the recombinant plasmid into a receptor plant, and cultivating to obtain a transgenic plant with enhanced drought stress tolerance.

4. The use according to claim 3, wherein the compound is ###0002### The agrobacterium is GV3101 agrobacterium.

5. The use according to claim 3, wherein the compound is ###0002### The receptor plant is tobacco K326.