LAMP-CRISPR detection system and application thereof

Abstract

The invention belongs to the technical field of biology, and relates to an LAMP-CRISPR detection system and application thereof. The LAMP-CRISPR detection system comprises an LAMP amplification system and a CRISPR detection system, wherein the LAMP amplification system comprises primers for specifically amplifying PEDV (porcine epidemic diarrhea virus), TGEV (transmissible gastroenteritis virus), PDCoV (PDCoV) and PoRV G9; the CRISPR detection system comprises a Cas protein, crRNA-F / R and an ssDNA (single-stranded deoxyribonucleic acid) probe; the crRNA-F / R sequence is as shown in SEQ ID NO. 23 to 28, SEQ ID NO. 29 to 34, SEQ ID NO. 35 to 40 or SEQ ID NO. 41 to 42; and the sequence of the ssDNA probe is as shown in SEQ ID NO. 43-44. By optimizing the system, the problem of low detection accuracy of a multiple detection system is effectively solved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a LAMP-CRISPR detection system and an application thereof. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV) and porcine rotavirus (PoRV) are the main pathogens causing viral diarrhea in pigs, especially affecting suckling piglets. These viruses often lead to clinical cases of mixed infection, which increases the difficulty of disease diagnosis.

[0003] Prior art CN 115094060 A discloses a kit for visual detection of PCV2 nucleic acid based on LAMP-CRISPR / Cas12a, including a CRPSPR-Cas12 detection system and a LAMP amplification primer, which is a combination of the LAMP detection method and the CRPSPR-Cas12 detection method to establish a visual detection method for porcine circovirus type 2 nucleic acid. This detection method has excellent specificity, sensitivity and repeatability, and is easy to operate, does not require expensive instruments and equipment, and has the advantage of visualization. The detection method is promoted and applied to pig farms and testing units, which is conducive to the rapid diagnosis of porcine circovirus type 2 related diseases. However, this prior art can only detect one virus. Summary of the invention

[0004] The object of the present invention is to provide a LAMP-CRISPR detection system and its application for simultaneously detecting four porcine diarrhea viruses, namely porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV) and porcine rotavirus G9 (PoRV G9).

[0005] To achieve the above purpose, the technical solution adopted by the present invention is:

[0006] A LAMP-CRISPR detection system, comprising a LAMP amplification system and a CRISPR detection system, wherein the LAMP amplification system comprises four sets of primers for specifically amplifying PEDV, TGEV, PDCoV and PoRV G9;

[0007] The CRISPR detection system includes Cas protein, crRNA-F / R and ssDNA probe; the sequence of the crRNA-F / R is shown in SEQ ID NO.23-28, SEQ ID NO.29-34, SEQ ID NO.35-40 or SEQ ID NO.41-42; the sequence of the ssDNA probe is shown in SEQ ID NO.43-44.

[0008] In a preferred embodiment, the primers for specifically amplifying PEDV are shown as SEQ ID NOs. 1-6.

[0009] In a preferred embodiment, the primers for specifically amplifying PEDV include three sets of primers: PEDV-F / B, PEDV-FIP / BIP and PEDV-LF / LB. The sequence of PEDV-F / B is shown in SEQ ID NO.1-2; PEDV-FIP / BIP is shown in SEQ ID NO.3-4; and PEDV-LF / LB is shown in SEQ ID NO.5-6.

[0010] In a preferred embodiment, in the LAMP amplification system, the concentration of PEDV-F / B is 0.05 μM.

[0011] In a preferred embodiment, the primers for specific amplification of TGEV are shown as SEQ ID NO.7-12.

[0012] In a preferred embodiment, the primers for specific amplification of TGEV include three sets of primers: TGEV-F / B, TGEV-FIP / BIP and TGEV-LF / LB. The sequence of TGEV-F / B is shown in SEQ ID NO.7-8; TGEV-FIP / BIP is shown in SEQID NO.9-10; and TGEV-LF / LB is shown in SEQ ID NO.11-12.

[0013] In a preferred embodiment, in the LAMP amplification system, the concentration of TGEV-F / B is 0.05 μM.

[0014] In a preferred embodiment, the primers for specific amplification of PDCoV are shown as SEQ ID NO.13-17.

[0015] In a preferred embodiment, the primers for specifically amplifying PDCoV include three sets of primers: PDCoV-F / B, PDCoV-FIP / BIP and PDCoV-LB, the sequence of PDCoV-F / B is shown in SEQ ID NO.13-14; PDCoV-FIP / BIP is shown in SEQ ID NO.15-16; PDCoV-LB is shown in SEQ ID NO.17.

[0016] In a preferred embodiment, in the LAMP amplification system, the concentration of PDCoV-F / B is 0.05 μM.

[0017] In a preferred embodiment, the primers for specific amplification of PoRV G9 are shown as SEQ ID NOs. 18-22.

[0018] In a preferred embodiment, the primers for specific amplification of PDCoV include three sets of primers: PoRV G9-F / B, PoRVG9-FIP / BIP and PoRV G9-LB, the sequence of PoRV G9-F / B is shown in SEQ ID NO.18-19; PoRVG9-FIP / BIP is shown in SEQ ID NO.20-21; PoRV G9-LB is shown in SEQ ID NO.22.

[0019] In a preferred embodiment, in the LAMP amplification system, the concentration of PoRV G9-F / B is 0.05 μM.

[0020] In a preferred embodiment, the LAMP amplification system further includes 2×LAMP Polymerase buffer at a concentration of 1×, 0.32 U / μL Bst 3.0 DNA Polymerase, 6 mM MgSO4, and 1.4 mM dNTP Mix.

[0021] In a preferred embodiment, the Cas protein is any one of Cas12a, Cas13, Cas12b or Cas14.

[0022] In a preferred embodiment, the Cas protein is LbCas12a protein.

[0023] In a preferred embodiment, the sequence of the crRNA-F / R is shown in SEQ ID NO.27-28, SEQ ID NO.31-32, SEQ ID NO.35-36 or SEQ ID NO.41-42.

[0024] In a preferred embodiment, the molar ratio of Cas protein to crRNA is 2:1-1:4.

[0025] In a preferred embodiment, the molar ratio of Cas protein to crRNA is 1:2-3.

[0026] In a preferred embodiment, the concentration of the ssDNA probe is 0.25-3 μM.

[0027] In a preferred embodiment, the concentration of the ssDNA probe is 2 μM.

[0028] The present invention also claims to protect the use of the LAMP-CRISPR detection system in the preparation of reagents for detecting porcine diarrhea virus.

[0029] A test strip for detecting porcine diarrhea virus, comprising the LAMP-CRISPR detection system.

[0030] In a preferred embodiment, the sequence of the ssDNA probe is shown as SEQ ID NO.44.

[0031] A kit for detecting porcine diarrhea virus comprises the LAMP-CRISPR detection system.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] During the multiple LAMP amplification process, multiple sets of primer pairing and competitive amplification of a single set of primers can lead to problems such as primer polymers, non-specific amplification, and prolonged amplification time. The present invention effectively solves the problems of non-specific amplification, prolonged amplification time, etc. by optimizing primer concentration, crRNA, the molar ratio of Cas protein and crRNA, and the concentration of ssDNA probes, and improves the accuracy of detection. At the same time, the LAMP-CRISPR detection system of the present invention is also combined with a lateral flow test strip to develop a multiple swine diarrhea virus CRISPR non-fluorescent visualization detection platform, which effectively reduces the positive misjudgment of excessive background fluorescence caused by degradation due to the high temperature of FAM-BHQ1-ssDNA, and further solves the problem of low-temperature storage of the detection kit. In order to better adapt to clinical real-time detection, the CRISPR detection method provides strong support. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The optimization results of crRNA; A, C and E: PEDV, TGEV and PDCoV crRNA screening visualization results; B, D and F: PEDV, TGEV and PDCoV fluorescence numerical bar graphs;

[0035] Figure 2 Optimization results for the optimal ratio of huLbCas12a protein to crRNA; A, C, E and G: Visualization results of optimization of the ratio of huLbCas12a protein to crRNA for PEDV, TGEV, PDCoVG9 and PoRV; B, D, F and H: Fluorescence numerical bar graphs for PEDV, TGEV, PDCoV and PoRV G9;

[0036] Figure 3The results of optimizing the optimal concentration of the FAM-BHQ1-ssDNA probe; A: Visualization results of optimizing the ssDNA probe concentration of the PEDV CRISPR detection system; B: Fluorescence numerical bar graph of the PEDV CRISPR detection system;

[0037] Figure 4 Verification results of the dual LAMP-CRISPR detection system; A: dual LAMP gel electrophoresis; B and C: dual LAMP-CRISPR visualization detection results; Legend: M: DL3000 DNAMarker; 1 and 2: original primer concentration; 3 and 4: 1 / 2 original primer concentration; 5 and 6: 1 / 3 original primer concentration;

[0038] Figure 5 Verification results of triple LAMP-CRISPR detection system; A: triple LAMP gel electrophoresis; B, C and D: triple LAMP-CRISPR visualization detection results; Legend: M: DL3000 DNA Marker; 1 and 2: original primer concentration; 3 and 4: 1 / 2 original primer concentration; 5 and 6: 1 / 3 original primer concentration;

[0039] Figure 6 Verification results of the quadruple LAMP-CRISPR detection system; A: quadruple LAMP gel electrophoresis; B, C, D, E: quadruple LAMP-CRISPR visualization detection results; Legend: M: DL3000 DNA Marker; 1 and 2: 1 / 2 primer concentration; 3 and 4: 1 / 3 original primer concentration; 5 and 6: 1 / 4 original primer concentration;

[0040] Figure 7 This is a sensitivity evaluation of the LAMP-CRISPR detection system for porcine diarrhea virus; A, C, E and G: visualization results of LAMP-CRISPR sensitivity evaluation; B, D, F and H: fluorescence numerical bar graphs of LAMP-CRISPR sensitivity analysis;

[0041] Figure 8 Specificity evaluation of the LAMP-CRISPR detection system for porcine diarrhea virus; A, C, E and G: Visualization results of LAMP-CRISPR specificity evaluation; B, D, F and H: Fluorescence numerical bar graphs of LAMP-CRISPR specificity analysis;

[0042] Fig. 9 It is a schematic diagram of the interpretation of the test results of the lateral flow test strip;

[0043] Fig.10 This is a diagram for interpreting lateral flow test strips;

[0044] Fig.11This is the electrophoresis diagram of the PoRV G9 RT-PCR detection results; Figure legend: M: DL3000 DNA Marker; 1-9: pig diarrhea samples. DETAILED DESCRIPTION

[0045] In order to make the invention purpose, technical solution and technical effect of the present invention clearer, the present invention is further described in detail below in conjunction with specific implementation methods. It should be understood that the specific implementation methods described in this specification are only for explaining the present invention, not for limiting the present invention.

[0046] Example 1

[0047] Materials and reagents

[0048] Viral RNA was extracted using a commercial Trizol extraction kit, and the operation method was the same as the instruction manual; pET28a-PEDV-N, pET28a-PDCoV-N, pCI-neo-TGEV-N and PUC57-PoRV G9 were purchased from Beijing Qingke Biotechnology Co., Ltd. Loading buffer was purchased from Quanshijin Biotechnology Co., Ltd. DNA or RNA genomes of porcine circovirus type 2, porcine parvovirus, pseudorabies virus, classical swine fever virus, porcine blue ear virus, porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine deltacoronavirus and porcine rotavirus G9 were extracted using a DNA / RNA nucleic acid extraction kit. Tissue sample RNA was reverse transcribed into cDNA using a cDNA reverse transcription kit. DNA / RNA extraction kits were purchased from Aisheng Biotechnology (Hangzhou) Co., Ltd.; cDNA reverse transcription kits were purchased from Novozyme Biotechnology Co., Ltd.; LbCas12a protein was purchased from Hunan Agricultural University.

[0049] 1.1LAMP detection primer design and sequence

[0050] 1.1.1 Primer design

[0051] LAMP detection primers were designed with reference to the N gene sequences of different genotypes of PEDV, TGEV and PDCoV and the VP7 gene sequences of PoRV G9 type. The primer sequences are shown in Table 1.

[0052] Table 1 LAMP-related primer sequences of the present invention

[0053]

[0054]

[0055] 1.1.2 Establishment of LAMP detection method

[0056] The LAMP primer set in Table 1 was centrifuged at 13000rpm / min for 5min. According to the reaction system shown in Table 2, each reagent was diluted to a working concentration, and the reaction system was prepared in an ultra-clean workbench without nucleic acid contamination, vortexed and mixed, centrifuged for 10s, placed in a 64℃ reaction instrument for 30-60min, and finally inactivated at 80℃. After the reaction, the reaction sample was added with one-fifth volume of Loading buffer, and nucleic acid electrophoresis was performed using 2% agarose gel to observe the results.

[0057] Table 2 LAMP amplification system

[0058]

[0059] 1.2.1 Design and synthesis of crRNA and FAM-BHQ1-ssDNA probes

[0060] crRNA design:In the conserved regions of PEDV N gene, TGEV N gene, PDCoV N gene and PoRV G9 VP7 gene, according to the principle that huLbCas12a recognizes "TTTV" characteristic sequence as the detection target site, the detection sequence of 20-23bp after PAM is designed. Design mode:After the T7 promoter sequence (TAATACGACTCACTATAGG), the scaffold sequence (AATTTCTACTAAGTGTAGAT) of huLbCas12a is connected, and then the target sequence (20-23bp sequence after specific PAM) is connected, and its complete structure is crRNA-F, and then reverse complementation is crRNA-R. In the present invention, T7 promoter is designed so that T7 polymerase can be used to recognize annealed crRNA DNA double strands and transcribe, so as to prepare sgRNA in large quantities. The crRNA-F / R DNA double-strand information obtained after annealing is as shown in Table 3.

[0061] Table 3 crRNA sequence information designed for PEDV, TGEV, PDCoV and PoRV conservative sequences

[0062]

[0063]

[0064] Preparation of crRNA: The crRNA oligonucleotide chains of PEDV, TGEV, PDCoV and PoRV were annealed to form double-stranded DNA (dsDNA), and the synthesized oligonucleotide chains were collected by centrifugation at a speed of more than 10000rpm / min, and then diluted to 10μM with DEPC water. The oligonucleotide chain annealing system is shown in Table 4. The annealing system was mixed and placed in a constant temperature water bath, heated to 95°C, and then stopped heating until it naturally cooled to room temperature.

[0065] Table 4 crRNA annealing system

[0066]

[0067] The double-strand concentration after annealing was determined using NanoDrop2000C, followed by T7 in vitro transcription. The transcription system is shown in the following table.

[0068] Table 5 crRNA T7 in vitro transcription system

[0069]

[0070] The transcription condition was 37°C overnight to obtain the required crRNA.

[0071] To obtain high-purity crRNA and remove the dsDNA template in the system: add 2 μL DNA polymerase I to the transcription-completed system, add DEPC H2O to 52 μL system, and let stand at 37°C for 15 minutes.

[0072] The crRNA was purified by phenol-chloroform extraction and ethanol precipitation. The specific operation is as follows:

[0073] (1) Transfer the dsDNA-removed crRNA to a 1.5 mL RNase-Free centrifuge tube, add DEPC H2O to make up to 180 μL, then add 20 μL 5 M ammonium acetate solution, and vortex to mix;

[0074] (2) Add 200 μL of an equal volume of phenol-chloroform mixture and mix by inverting;

[0075] (3) Centrifuge at 12,000 rpm / min for 10 min at 4°C and transfer the upper layer (aqueous phase) to a new 1.5 mL RNase-Free centrifuge tube;

[0076] Add the same volume of chloroform, centrifuge as above, and transfer the upper layer to a new 1.5 mL RNase-Free centrifuge tube;

[0077] (5) Repeat the above steps once

[0078] (6) Add 2 times the volume of pre-cooled anhydrous ethanol of the aqueous phase and let stand at -20°C for 35 min to fully precipitate crRNA;

[0079] (7) Centrifuge at 12,000 rpm / min for 15 min at 4°C, discard the supernatant, and collect the precipitate;

[0080] (8) Add 0.5 mL of pre-cooled 75% ethanol to wash the precipitate, and centrifuge at 10,000 rpm / min at 4°C for 5 min;

[0081] (9) Repeat the above step (8) once;

[0082] (10) Add 50 μL RNase-Free Elution to dissolve the crRNA precipitate.

[0083] The crRNA concentration was determined using NanoDrop2000C, and the samples were dispensed into 1.5 mL RNase-Free centrifuge tubes and stored at -80°C.

[0084] The probe is shown in Table 6. Based on the non-specific cleavage characteristics of huLbCas12a protein, an A-rich ssDNA sequence probe was designed, using a FAM fluorescent group and a BHQ1 quenching group. When the ssDNA sequence is broken, the fluorescence is converted from a quenched state to a radioactive state, that is, when FAM fluorescence is detected in the CRISPR detection system shown in Table 7, it shows that huLbCas12a protein undergoes non-specific cleavage. FAM-BHQ1-ssDNA and FAM-Biotin-ssDNA were synthesized by Beijing Qingke Biotechnology Co., Ltd. and stored in aliquots at -20°C in the dark.

[0085] Table 6 Probe sequence information

[0086]

[0087] Table 7 CRISPR detection system

[0088]

[0089] 1.3 CRISPR detection system optimization

[0090] 1.3.1 Optimal crRNA screening

[0091] In order to maximize the efficiency of the PCR-CRISPR detection system, the present invention optimizes the components of the CRISPR system. The present invention selects the sequence of 20bp after PAM as crRNA. Nine groups were designed for screening for three crRNAs targeting conserved sequences, namely crRNA1 to 9 (Table 3), each of which includes an experimental group and a control group (PoRV has only one target site and is not screened). The remaining components are consistent with the system in Table 7. The LAMP amplification product is the product obtained from the amplification system in Table 2. The DNA template is a mixture of DNA transcribed from RNA extracted from four viruses, PEDV, TGEV, PDCoV and PoRV G9. All primers in Table 1 are added to the table. The crRNA screening experiment was repeated three times for each group, and the system was prepared in eight tubes, and the fluorescence data was collected using an ABIQuantStudio 5qPCR instrument. Program: 37°C constant temperature for 30min, recording once per minute. After the reaction is completed, place it under a gel imager and observe it with ultraviolet light.

[0092] Results: The results of crRNA screening are as follows Figure 1 As shown in Figures A and B, the PEDV CRISPR detection system is a UV transmission visual image after reaction and a bar graph of the fluorescence value recorded by the qPCR instrument 30 minutes later. The results show that the fluorescence value produced by the crRNA3 group is stronger than that of other groups, and the difference is significant. Therefore, crRNA3 is selected for the PEDV CRISPR detection system. Similarly, Figure 1 C and 1D are the observation graph and bar graph of the TEDV CRISPR detection system. It can be seen from the figure that the excitation fluorescence intensity of the three crRNAs is similar, but the background fluorescence intensity of the crRNA5 negative group is significantly weaker than that of other groups. Therefore, crRNA5 is the best crRNA for the TEDV CRISPR detection system. Figure 1 Results from E and 1F show that in the PDCoV crRNA screening, the crRNA7 group showed a higher fluorescence intensity, and the fluorescence data was significantly different from that of other groups, so crRNA7 was selected as the crRNA for subsequent TEDV CRISPR detection. PoRV G9 type has only one detection site, so crRNA10 is the default optimal detection crRNA.

[0093] 1.3.2 Screening for the optimal ratio of huLbCas12a and crRNA

[0094] Theoretical data show that when the molar ratio of huLbCas12a: crRNA is 1: 1, the protein-RNA binary complex can achieve the best shearing efficiency. However, in practical applications, the effects of factors such as huLbCas12a and crRNA stability, assembly efficiency of the binary complex, and buffer need to be considered. In addition, the affinity of crRNA and huLbCas12a of different viruses is also different, so the present invention designs an optimization experiment to determine the optimal ratio of huLbCas12a to crRNA. Other experimental groups with 1.3.1. Five control groups were designed for the optimization of the ratio of huLbCas12a to crRNA, each group containing positive and negative controls, respectively 2: 1 (250: 125nM), 1: 1 (250: 250nM), 1: 2 (250: 500nM), 1: 3 (250: 750nM), and 1: 4 (250: 1000nM). The specific data recording and collection steps are consistent with 1.3.1.

[0095] Results: Figure 2 As shown by Figure 2 A and 2B show that the fluorescence intensity of the PEDV CRISPR detection system is the highest when the huLbCas12a:crRNA ratio is 1:2 (250:500 nM), so the 1:2 ratio is the best. Figure 2 The analysis results of C and 2D also showed that the fluorescence intensity of the TEDV CRISPR detection system was the strongest when the ratio of huLbCas12a:crRNA was 1:2; Figures E and F showed that the fluorescence of the TEDV CRISPR detection system was the strongest when the ratio was 1:2; Figure 2 G and 2H show that the fluorescence of the PoRVCRISPR detection system gradually increases with the molar ratio and reaches the maximum peak at 1:3 (250:750 nM).

[0096] 1.3.3 ssDNA probe concentration screening

[0097] In order to make the CRISPR detection system achieve the best effect by visual observation and analysis during the actual detection process, the present invention optimizes the concentration of ssDNA probes. Based on the system with the optimal huLbCas12a and crRNA ratio, ssDNA probes with final concentrations of 250nM, 500nM, 1μM, 2μM and 3μM were added respectively, fully mixed, and a negative control group was set. The specific data recording and collection steps are carried out with reference to 1.3.1.

[0098] Results: The PEDV CRISPR detection system verified the optimal concentration of ssDNA probes that can be observed by naked eyes after cleavage. Figure 3As shown in the figure, when the concentration of ssDNA probe increases within the range of 250nM to 3μM, the fluorescence intensity observed under UV transmission also increases. When the probe concentration is 2-3μM, strong observable fluorescence is generated, and it is clearly distinguished from the background fluorescence of the negative control group. Therefore, 2μM ssDNA probe is selected as the optimal concentration.

[0099] 1.4 Establishment of multiple LAMP-CRISPR detection system

[0100] In clinical cases, the symptoms of porcine diarrhea are generally caused by cross-infection of PEDV, TGEV, PDCoV and PoRV. Multiplex amplification can simultaneously amplify multiple target genes in a single reaction, which can greatly improve the detection efficiency of the LAMP-CRISPR system. However, in the actual multiplex LAMP amplification process, multiple sets of primer pairing and competitive amplification of a single set of primers can lead to problems such as primer polymers, nonspecific amplification, and prolonged amplification time. In order to achieve simultaneous enrichment of multiple nucleic acids, the present invention optimizes double, triple and quadruple LAMP amplification systems.

[0101] 1.4.1 Validation of the dual LAMP-CRISPR system

[0102] First, TGEV and PoRV were selected to prepare the reaction master tube according to the system optimized by primer concentration in Table 2, and the F3 / B3 primer group was set as three experimental groups with original concentration (0.2μM), 1 / 2 concentration (0.1μM) and 1 / 3 concentration (0.667μM), and a negative control group was set. The cDNA mixed samples of four viruses, PEDV, TGEV, PDCoV and PoRV, were used as DNA templates, reacted at 64℃ for 50min, and inactivated at 80℃ after the amplification reaction. 5μL of the reaction sample was added to one-fifth volume of Loading buffer, and nucleic acid electrophoresis was performed with 2% agarose gel to observe the results; then, the CRISPR detection system containing CrRNA for different viruses (each group used the best CrRNA after optimization, for example, TEDV selected crRNA5) was added, and the reaction was carried out at 37℃ in the ABIQuantStudio 5 instrument for 30min, and the fluorescence data was recorded. After the reaction, it was placed under ultraviolet light for transmission observation.

[0103] The results are as follows Figure 4 As shown in the figure, it is shown that the LAMP primer set can specifically amplify TGEV and PoRV templates at the original concentration, 1 / 2 concentration and 1 / 3 concentration, and the amplified products can be recognized by crRNA (SEQ ID NO.31-32 / SEQ ID NO.35-36), thereby causing non-specific cleavage. Figure 4It can be found that as the primer concentration decreases, the band brightness also decreases, indicating that the LMAP amplification efficiency is related to the primer concentration.

[0104] 1.4.2 Validation of the triple LAMP-CRISPR system

[0105] On the basis of the successful amplification system of TGEV-PoRV LAMP, the PDCoV LAMP primer set was added, and three experimental groups of original concentration, 1 / 2 concentration and 1 / 3 concentration of F3 / B3 primer set were set up, and the negative control detection sequence was replaced by sterile water. The experimental steps were the same as the verification steps of the dual LAMP-CRISPR system.

[0106] The results are as follows Figure 5 As shown, the primer set of PDCoV was added to the double amplification system, and sets 2, 4, and 6 can achieve the amplification of the template sequence, and green fluorescence can be observed under ultraviolet transmission. The results show that when the primer set is the original concentration, 1 / 2 concentration, and 1 / 3 concentration, the triple amplification product can be detected by the CRISPR system.

[0107] 1.4.3 Validation of the quadruple LAMP-CRISPR system

[0108] On the basis of the successful amplification system of TGEV-PoRV-PDCoV LAMP, the PEDV LAMP primer set was added. What is different from the previous one is that the addition of four sets of LAMP primers keeps the primer concentration in the reaction system at a high level, which aggravates the formation of primer polymers. In this way, the present invention further reduces the primer concentration, sets three experimental groups of 1 / 2 concentration, 1 / 3 concentration and 1 / 4 concentration of the F3 / B3 primer group, and sets sterilized water for the negative control group. The experimental steps are the same as the verification steps of the dual LAMP-CRISPR system. Using the cDNA mixed samples of four viruses, PEDV, TGEV, PDCoV and PoRV, as templates, react at 64°C for 50min, inactivate at 80°C after the amplification reaction, take 5μL of the reaction sample and add one-fifth volume of Loading buffer, perform nucleic acid electrophoresis with 2% agarose gel, and observe the results; then add them to the CRISPR detection system containing cRrna for different viruses, react at 37°C for 30min in the ABIQuantStudio 5 instrument, and record the fluorescence data. After the reaction is completed, place it under UV light for observation.

[0109] result Figure 6As shown, under ultraviolet light, the negative tubes of TGEV, PoRV and PDCoV did not produce fluorescence, while the tubes with the quadruple LAMP amplification product stimulated strong green fluorescence. Figure E only observed that tube 6 stimulated fluorescence, indicating that at the concentrations of 1 / 2 and 1 / 3 primer sets, the quadruple amplification system only amplified the templates of TGEV, PoRV and PDCoV, and competitive amplification occurred. Only the 1 / 4 primer set concentration group had the appearance of fluorescence detection of the three viruses. The quadruple LAMP-CRISP detection system with a concentration of 1 / 4 primer set was selected in subsequent experiments.

[0110] 1.4.4 Sensitivity of the LAMP-CRISPR detection system for porcine diarrhea virus

[0111] In order to evaluate the sensitivity of the LAMP-CRISPR detection system for the four viruses, the standard plasmids of the four viruses were diluted in a gradient manner (gradient of 1×10 0 ~1×10 6 The optimized LAMP system and conditions were used for amplification (i.e., the F3 / B3 primer set was 1 / 4 concentration). After the reaction was completed, the amplified products of different copy numbers were added to the CRISPR detection system containing ssDNA probes (optimal crRNA, optimal ratio of huLbCas12a to crRNA, 2μM ssDNA probe), and reacted at 37°C for 30 minutes in the ABIQuantStudio 5qPCR instrument, and the fluorescence data was recorded. After the reaction was completed, the gel was placed under a gel imager and observed with UV light.

[0112] Results: From Figure 7 As shown in A and 7B, in the PEDV LAMP-CRISPR detection system, there are significant differences in the fluorescence values ​​between the NC group and the copy number group, and the fluorescence values ​​do not change with the copy number. Figure 7 A also shows that only the tubes in the NC group have no fluorescence; similarly, Figure 7 C and D show that the detection of single-digit copies can be achieved in the TEDV LAMP-CRISPR detection system; Figure 7 E and 7F are more intuitive in 10 0 Obvious fluorescence was observed in the 10 copy group, while 3 The fluorescence values ​​in the copy group were slightly lower than those in the other copy groups; Figure 7 G and 7H display, from 10 0 The copy number began to show significant strong green fluorescence. In summary, the sensitivity of the porcine diarrhea virus LAMP-CRISPR detection system can reach the detection of virus copy numbers of 1 to 10 copies / μL.

[0113] 1.4.5 Specificity of the LAMP-CRISPR Detection System for Porcine Diarrhea Virus

[0114] In view of the fact that PEDV, TGEV, PDCoV and PoRV G9 are often mixed-infected in clinical sample testing, in order to exclude the possibility of cross-detection, the DNA genome or reverse transcribed cDNA of common porcine viruses was selected as the detection template. In order to determine whether there is cross-detection between different porcine viruses, the specificity of the four porcine diarrhea virus LAMP-CRISPR detection systems was evaluated. Prepare the reaction tube according to 3.2.5 LAMP amplification system, divide it into 9 groups, 3 replicates in each group, set up a negative control group, and select PCV2, PPV DNA genome and CSFV, PRRSV, PEDV, TGEV, PDCoV and PoRV G9 cDNA as templates for amplification. The amplification system is as shown in Table 2, only the cDNA is different. The amplified product is then subjected to CRISPR detection, and the subsequent steps are the same as 1.4.4.

[0115] Results: Figure 8 As shown in the figure, the LAMP-CRISPR detection system has good specificity.

[0116] 1.5 Establishment and application of multiplex LAMP-CRISPR detection method for porcine diarrhea virus

[0117] 1.5.1 Feasibility assessment of combining multiplex LAMP-CRISPR with lateral flow test strips

[0118] The purpose of using lateral flow test strips is to improve the accuracy of visual detection and avoid the instability of fluorescent probes. The specific steps are as follows: first, the LAMP-CRISPR detection system is prepared according to the optimization results, and the FAM-BHQ1-ssDNA probe is replaced with the FAM-Biotin-ssDNA probe. The LAMP-CRISPR detection reaction steps are the same as before. The optimized LAMP system and conditions are used for amplification (i.e., the F3 / B3 primer set is 1 / 4 concentration). After the reaction is completed, the amplified products of different copy numbers are added to the CRISPR detection system containing ssDNA probes (optimal crRNA, optimal ratio of huLbCas12a to crRNA, 2μM ssDNA probe). After the reaction is completed, the sample binding area of ​​the lateral flow test strip is inserted into the CRISPR reaction tube, submerging the binding area about 1 / 2 and keeping it horizontal. When the T line or C line is colored, take out the test strip and read the test results within 10 minutes. In order to conduct a feasibility assessment, the positive plasmid of PEDV was selected for detection.

[0119] like Fig. 9As shown in the figure, when the ssDNA sequence is broken, FAM and Biotin separate, and the sheared FAM group can be captured at the T detection line, showing a red line; while the C quality control line will bind to the incompletely cut ssDNA probe or not bind to the Biotin group, and it will appear red or no color. The specific color development effect is related to the cutting efficiency of the activated huLbCas12a in the CRS IPR system.

[0120] The results are as follows Fig.10 As shown, in 10 0 In the copies / μL group, it can be observed that both the T and C lines show red reactions, indicating that the FAM-Biotin-ssDNA probe is non-specifically cut by the huLbCas12a protein. The CRISPR detection system combined with the lateral flow test strip technology can achieve a detection sensitivity of 1 to 10 copies / μL, proving the feasibility of combining the two technologies. At the same time, the lateral flow test strip does not have particularly strict requirements on storage temperature, which provides a more solid foundation for the application of CRISPR detection methods in clinical real-time detection.

[0121] 1.5.2 Pig diarrhea sample testing

[0122] The 95 clinical samples collected were first tested for three porcine coronaviruses using the fluorescent quantitative PCR method of commercial detection kits (Qingdao Lijian and Kangrun), and then porcine rotavirus was tested using RT-PCR (refer to the prior art Ogawa H, Taira O, Hirai T, Takeuchi H, Nagao A, Ishikawa Y, Tuchiya K, Nunoya T, Ueda S. Multiplex PCR and multiplex RT-PCR for inclusive detection of major swine DNA and RNA viruses in pigs with multiple infections. J Virol Methods. 2009 Sep; 160 (1-2): 210-4. doi: 10.1016 / j.jviromet.2009.05.010. Epub 2009 May 23. PMID: 19467264.). The results are as follows: Fig.11 These results were then compared with the results of the quadruple LAMP-CRISPR assay established by the present invention to verify the compliance rate of the assay.

[0123] The test results are as follows:

[0124] Results: As shown in Tables 8, 9, 10 and 11.

[0125] Table 8 PEDV qPCR detection results

[0126]

[0127] Table 9 TGEV qPCR detection results

[0128]

[0129] Table 10 PDCoV qPCR detection results

[0130]

[0131] Table 11 Compliance Verification

[0132]

[0133] The results of the quadruple LAMP-CRISPR detection system for detecting three porcine coronavirus diarrhea viruses were 100% consistent with the results of qPCR, and 98.94% consistent with the results of PoRV RT-PCR. The specific results showed that the positive rate of PEDV detection was 31.57%; the positive rate of TEDV detection was 6.31%; the positive rate of PDCoV detection was 21%; and the positive rate of PoRV G9 type detection was 8.42%. Among the test samples, 3 samples were found to be mixed with TGEV and PEDV, and 1 sample was mixed with PoRV and PDCoV. However, in the actual sample detection, the detection rate of TGEV was not so high, because the use of TGEV live vaccine led to misdetection. In summary, the quadruple LAMP-CRISPR porcine diarrhea disease detection system can be effectively used in clinical detection.

[0134] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A LAMP-CRISPR detection system, characterized in that: It includes a LAMP amplification system and a CRISPR detection system, wherein the LAMP amplification system includes four sets of primers for specifically amplifying PEDV, TGEV, PDCoV and PoRV G9; The CRISPR detection system includes Cas protein, crRNA-F / R and ssDNA probe; the sequence of the crRNA-F / R is shown in SEQ ID NO.23-28, SEQ ID NO.29-34, SEQ ID NO.35-40 or SEQ ID NO.41-42; the sequence of the ssDNA probe is shown in SEQ ID NO.43-44.

2. The LAMP-CRISPR detection system according to claim 1, characterized in that The primers for specific amplification of PEDV are shown in SEQ ID NO.1-6; preferably, the primers for specific amplification of PEDV include three sets of primers: PEDV-F / B, PEDV-FIP / BIP and PEDV-LF / LB, and the sequence of PEDV-F / B is shown in SEQ ID NO.1-2; PEDV-FIP / BIP is shown in SEQ ID NO.3-4; PEDV-LF / LB is shown in SEQ ID NO.5-6.

3. The LAMP-CRISPR detection system according to claim 1, characterized in that The primers for specific amplification of TGEV are shown in SEQ ID NO.7-12; preferably, the primers for specific amplification of TGEV include three sets of primers: TGEV-F / B, TGEV-FIP / BIP and TGEV-LF / LB, and the sequence of TGEV-F / B is shown in SEQ ID NO.7-8; TGEV-FIP / BIP is shown in SEQ ID NO.9-10; TGEV-LF / LB is shown in SEQ ID NO.11-12.

4. The LAMP-CRISPR detection system according to claim 1, characterized in that Specific amplification The primers for PDCoV are shown in SEQ ID NO.13-17; preferably, the primers for specific amplification of PDCoV include three sets of primers: PDCoV-F / B, PDCoV-FIP / BIP and PDCoV-LB, and the sequence of PDCoV-F / B is shown in SEQ ID NO.13-14; PDCoV-FIP / BIP is shown in SEQ ID NO.15-16; PDCoV-LB is shown as SEQ ID NO.

17.

5. The LAMP-CRISPR detection system according to claim 1, characterized in that Specific amplification Primers for PoRV G9 are shown in SEQ ID NOs. 18-22; preferably, primers for specific amplification of PDCoV include three sets of primers: PoRVG9-F / B, PoRV G9-FIP / BIP and PoRV G9-LB, and the sequence of PoRV G9-F / B is shown in SEQ ID NOs. 18-19; PoRV G9-FIP / BIP is shown in SEQ ID NOs. 20-21; PoRV G9-LB is shown as SEQ ID NO.

22.

6. The LAMP-CRISPR detection system according to any one of claims 2 to 5, characterized in that In the LAMP amplification system, the concentration of PEDV-F / B was 0.05 μM; the concentration of TGEV-F / B was 0.05 μM; The concentration of PDCoV-F / B is 0.05μM; the concentration of PoRV G9-F / B is 0.05μM.

7. The LAMP-CRISPR detection system according to claim 1, characterized in that The LAMP amplification system also includes 2×LAMP Polymerase buffer at a concentration of 1×, 0.32U / μL Bst 3.0 DNA Polymerase, 6mM MgSO 4、 1.4 mM dNTP Mix.

8. The LAMP-CRISPR detection system according to claim 1, characterized in that The sequence of the crRNA-F / R is shown in SEQ ID NO.27-28, SEQ ID NO.31-32, SEQ ID NO.35-36 or SEQ ID NO.41-42.

9. The LAMP-CRISPR detection system according to claim 1, characterized in that The molar ratio of Cas protein and crRNA is 2:1-1:4; the concentration of ssDNA probe is 0.25-3 μM.

10. Use of the LAMP-CRISPR detection system according to any one of claims 1 to 9 in the preparation of a reagent for detecting porcine diarrhea virus.

11. A test strip for detecting porcine diarrhea virus, characterized in that: Comprising the LAMP-CRISPR detection system as described in any one of claims 1 to 9.

12. A kit for detecting porcine diarrhea virus, characterized in that: Comprising the LAMP-CRISPR detection system as described in any one of claims 1 to 9.

Images