Method for analyzing and evaluating corrosion degrees of power grid holding pole carbon steel in different regions by using 16S rRNA amplicon sequencing

Abstract

The invention relates to a method for analyzing and evaluating the corrosion degree of power grid derrick carbon steel in different regions by utilizing 16S rRNA amplicon sequencing. The method comprises the following steps: performing genome DNA extraction and quality control on microorganisms of soil samples at contact corrosion positions of derricks and soil layers in different regions of a power grid system, performing 16S rRNA amplicon sequencing, performing OTU clustering analysis, performing species annotation and the like. Through bioinformatics analysis and combination with a corrosion degree standard, a method for evaluating the corrosion degrees of the carbon steel in different regions through a result of microorganism composition is established, and carbon steel corrosion prevention is guided.

Description

Technical Field

[0001] The invention belongs to steel corrosion monitoring and identification technology, and relates to a method for evaluating the degree of carbon steel corrosion of power grid poles in different regions by using microbial community analysis. Background Art

[0002] Carbon steel is often used in metal materials such as poles in power grid systems. Since poles and other facilities are often in outdoor environments for a long time and are exposed to rain, soil, etc., they are inevitably corroded to varying degrees. The harm caused by carbon steel corrosion cannot be underestimated, especially when it comes to facilities of large state-owned enterprises such as power grid systems. Carbon steel corrosion will not only affect economic development, but also human life safety.

[0003] Previous studies have shown that carbon steel corrosion is mediated by electrochemical reactions as well as the participation of microorganisms, among which some microbial metabolism and other life activities can affect the electrochemical properties and surface state of metals, thereby accelerating or inhibiting corrosion. From this perspective, changes in microbial diversity and composition are also a new direction for determining the degree of metal corrosion.

[0004] Therefore, it is feasible to study a method to determine the corrosion degree of carbon steel through microbial diversity and composition analysis. By using scientific methods to timely detect the corrosion degree of carbon steel in different regions, effectively determine its remaining service life, timely replace facility materials or use repainting and plating to reduce economic losses, and avoid safety threats as much as possible, to maximize its economy and safety to a certain extent.

[0005] In addition, most studies on carbon steel corrosion in power grid systems lack scientific analysis of the microbial diversity and composition of soil samples at the contact point between the pole and the soil layer, and existing methods such as plate separation and deformed gradient gel electrophoresis are difficult to fully reflect microbial diversity. Therefore, in order to solve the above problems, the present invention adopts 16S rRNA amplicon sequencing technology to establish a systematic and standardized method for evaluating the degree of carbon steel corrosion in different regions, and provides certain guidance for the development of microbial-based corrosion prevention technology. Summary of the invention

[0006] The present invention utilizes 16S rRNA amplicon sequencing technology to analyze and evaluate the degree of carbon steel corrosion of power grid poles in different regions. The method comprises collecting soil samples, extracting genomic DNA and DNA quality control, amplifying 16S rRNA hypervariable regions, constructing sample libraries, sequencing on a machine and analyzing results. The above steps provide a solution for utilizing 16S rRNA amplicon sequencing technology to analyze and evaluate the degree of carbon steel corrosion of power grid poles in different regions.

[0007] A method for evaluating the degree of carbon steel corrosion of power grid poles in different regions by using 16S rRNA amplicon sequencing analysis comprises the following steps: (1) Collect soil samples at the contact point between the pole and the soil layer: Soil samples were collected at the contact point between the poles and soil of the power grid system in the north and south, at different altitudes, in dry and wet areas, and in different temperature ranges. The sampling area was 3 cm outside the pole and 0-5 cm deep. The sampling was done once every 60-90°. At least 3 points were taken from one sampling site, and the 3 points were put together to form a soil sample. Each soil sample weighed 1-3 g and was collected in a sterile 50 mL centrifuge tube. At least 3 soil samples were taken from each region as parallel. Genomic DNA was extracted immediately after the soil samples were transported to the laboratory at low temperature, or stored below -20°C for no more than 1 month. (2) Extraction of genomic DNA and DNA quality control: A soil bacterial DNA extraction kit is used to extract bacterial genomic DNA from the soil sample collected in step (1). At least three parallel extractions are performed in each centrifuge tube. 0.5-1 g of soil is weighed for one parallel extraction. Genomic DNA is extracted according to the instructions of the soil bacterial DNA extraction kit. A 0.8-1% agarose gel is prepared. Electrophoresis is performed at 80-120 V for 30-60 min. The electrophoresis bands are then observed on a gel imager. The fragment size range is 0.15-13 Mb. The absorbance of DNA at 230 nm, 260 nm and 280 nm is measured using an ultra-micro UV spectrophotometer. The values ​​of A260 / A280 and A260 / A230 are then calculated to predict the purity of the nucleic acid. Each sample is then subjected to high-fidelity PCR pre-amplification. The amplification products are detected by agarose gel electrophoresis. Samples that pass DNA quality control and succeed in PCR amplification are defined as qualified. (3) 16S rRNA amplicon sequencing: The pre-amplified sample DNA was used as a PCR amplification template, and a positive control sample was set to amplify the target region V3-V4 or V4-V5. At the same time, a specific label sequence was introduced to the end of the sample DNA library. The amplified product was detected by agarose gel electrophoresis, and the concentration of the labeled sample DNA library was appropriately diluted. Different samples had different sequencing throughput requirements. The samples were mixed according to the corresponding molar ratio, and then the sample DNA library was sequenced using the Illumina 2×250 bp double-end sequencing strategy, followed by bioinformatics analysis; (4) Establishing a corresponding relationship between microbial community composition and rust degree: The microbial community composition comparison corresponding to the rust degree was obtained by comparing the apparent characteristics of the known rust areas with the number of microbial OTUs, community composition analysis, Alpha diversity level and Beta diversity in different regions.

[0008] Preferably, the rust degree is divided into A, B, C, and D grades, and the rust condition is observed according to the national standard GB / T8923.1-2011.

[0009] Compared with the prior art, the beneficial effects of the present invention are as follows: the present technical scheme can effectively obtain the bacterial genomic DNA of the soil layer of corroded poles in power grid systems in different regions, and after 16S rRNA amplicon sequencing, the bacterial information of the soil layer of corroded poles in power grid systems in different regions can be accurately obtained by analyzing the sequencing data. Analysis of the microbial diversity of the soil layer of corroded poles is helpful to scientifically evaluate the degree of carbon steel corrosion of power grid poles in different regions, establish a systematic and standardized method for evaluating the degree of carbon steel corrosion in different regions (expressed in four corrosion grades A, B, C and D in national standard documents), and provide guidance for the development of microbial-based corrosion prevention technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 The results of DNA electrophoresis of microbial genomes in soil layers of each sample; Figure 2 Venn diagram analysis of bacterial OTU for each sample; Figure 3 Annotate the species bar graphs at the bacterial phylum level for each sample; Figure 4 Annotation histograms of bacterial genus-level species for each sample; Figure 5 PCoA analysis of Beta diversity of microbial communities of each sample. DETAILED DESCRIPTION

[0011] In order to explain the present invention more clearly and in detail, the following will be further described by specific examples. In addition, the embodiments described in the present invention are only used to explain the present invention, not to limit the present invention, that is, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. And the experimental materials and reagents in the following examples can be obtained from regular commercial platforms unless otherwise specified.

[0012] Example 1 A method for evaluating the degree of corrosion of carbon steel of arid power grid poles using 16S rRNA amplicon sequencing analysis is performed in the following steps: (1) Collect soil samples at the contact point between the pole and the soil layer in arid areas Soil samples were collected at the contact point between the pole and the soil of the power grid system in arid areas. With the pole as the center, the soil within 1 cm around the pole and 2 cm deep was taken as the sampling area. The soil was sampled once every 90°, and three samples were taken to form a soil sample. Three soil samples were taken in each area as parallel, each soil sample was 3g, and collected in a sterile 50mL centrifuge tube. The soil samples were transported to the laboratory at low temperature and genomic DNA was extracted immediately.

[0013] (2) Extraction of genomic DNA and DNA quality control A soil bacteria DNA extraction kit was used to extract bacterial genomic DNA from the soil samples collected in step (1). At least three parallel extractions were performed in each centrifuge tube. 0.6 g of soil was weighed for one parallel extraction, and genomic DNA was extracted according to the instructions of the soil bacteria DNA extraction kit. A 0.8% agarose gel was prepared, and electrophoresis was performed at 80V for 40 minutes. After that, the electrophoresis bands were observed on a gel imager. An ultra-micro UV spectrophotometer was used to measure the absorbance of DNA at 230nm, 260nm, and 280nm. The values ​​of A260 / A280 and A260 / A230 were then calculated to estimate the purity of the nucleic acid. Each sample was then subjected to high-fidelity PCR pre-amplification, and the amplification products were detected by agarose gel electrophoresis. Samples that passed the DNA quality control and successfully underwent PCR amplification were defined as qualified. The conditions of sample extraction, quality inspection, and pre-experimental amplification are shown in Table 1-1, and the electrophoresis detection results are shown in Figure 1 .

[0014] Table 1-1 Sample extraction, quality inspection and pre-experimental amplification In this example, the sample DNA quality is qualified. Note: A and B in Table 1-1 are the quality grades of experimental amplification, which are not the same as the rust degree classification.

[0015] (3) 16S rRNA amplicon sequencing The sample DNA was used as a PCR amplification template, a positive control sample was set, the target region V4-V5 was amplified, and a specific tag sequence was introduced to the end of the sample DNA library. The amplified product was detected by agarose gel electrophoresis.

[0016] 16S rRNA hypervariable region amplification Sample DNA and internal reference DNA are used as PCR amplification templates and added to the same PCR amplification system to amplify the target region of the sample. An appropriate proportion of internal reference DNA is added to each sample, and a positive control sample is set at the same time.

[0017] Primers with index sequences are used to introduce specific tag sequences to the ends of sample DNA libraries through high-fidelity PCR, so that multiple samples can be mixed during downstream sequencing. Subsequent bioinformatics processing can distinguish samples with different tag sequences, and the amplified products are detected by agarose gel electrophoresis.

[0018] The primer information of this embodiment is: Destination area 16S V4V5 Primer F = Illumina adapter sequence 1+ 5'GTGCCAGCMGCCGCGG'3 Primer R = Illumina adapter sequence 2+ 5'CCGTCAATTCMTTTRAGTTT'3 Illumina adapter sequence 1 = 5'AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'3 Illumina adapter sequence 2 = 5'CTGTCTCTTATACACATCTCCGAGCCCACGAGACXXXXXXXXATCTCGTATGCCGTCTTCTGCTTG'3 XXXXXXXX is the label sequence for identifying the sample.

[0019] The concentration of the labeled sample DNA sample library was then appropriately diluted. Different samples had different sequencing throughput requirements. The samples were mixed according to the corresponding molar ratio, and then the sample DNA library was sequenced using the Illumina 2×250 bp paired-end sequencing strategy, followed by bioinformatics analysis.

[0020] The DADA2 plug-in of QIIME2 software was used to perform data quality filtering, noise reduction, splicing and chimera removal, and generate feature tables and representative sequences.

[0021] Table 1-2 Data processing by DADA2 plug-in The DADA2 plugin of QIIME2 was used to generate amplicon sequence variants (ASV) after quality control. The abundance of each ASV in each sample is shown in Table 1-3: Table 1-3 ASV / OTU abundance table Each ASV / OTU representative sequence was then compared with the database to perform taxonomic annotation of ASV / OTU, as shown in Tables 1-4.

[0022] Table 1-4 ASV / OTU taxonomy Since there are unique and common ASVs between samples in different groups, the Venn diagram was used in this example to visualize the ASVs between and within groups of soil samples at the contact between the pole and the soil layer in the arid area. The number of OTUs unique to the Dry group was 6074, accounting for 48.06% of the total number of OTUs in each group. The Venn diagram is shown in Figure 2 .

[0023] Analyze soil microorganisms of power grid poles in arid areas. Figure 3 The bacterial composition with a relative abundance of ≥1% at the phylum level is shown. In this example, Proteobacteria, Actinobacteriota, Bacteroidota, Myxococcota, and Planctomycetota are dominant phyla, accounting for 33.72%, 23.59%, 14.8%, 7.34%, and 5.49% of the phylum-level composition of microbial diversity in the drought group, respectively.

[0024] The community composition of soil microorganisms at the genus level in power grid system poles in arid areas was analyzed. Figure 2 It shows Flavobacterium (Flavobacterium), Haliangium , Methylophilus (Methylophilus), Massilia (Massellella spp.) and Pseudomonas (Pseudomonas) was the dominant genus in the drought group, accounting for 11.54%, 8.6%, 7.99%, 6.12% and 6.02% of the genus level composition of microbial diversity in the drought group, respectively.

[0025] The Alpha diversity levels of the two regions were analyzed. Table 1-5 statistically summarizes the Alpha diversity information of the soil microbial community in the power grid system pole support. The Chao1 and ACE indexes are used to estimate the total number of species in the sample. The larger the value, the more species there are. The Shannon and Simpson diversity indices are both used to estimate the diversity of microorganisms in the sample. The larger the Shannon value, the higher the community diversity, while the larger the Simpson index value, the lower the community diversity.

[0026] In this example, the Chao1 and ACE index values ​​of the drought group are both positive and greater than 3000, indicating that the total number of microbial species in the area is large; the Shannon index value is 7.16892±0.12635, and the Simpson index value is 0.00245±0.000472111. The two indexes conform to the rule that the Shannon value is large and the Simpson value is small, and the microbial diversity is high. Therefore, the Alpha diversity level can indirectly reflect the microbial diversity of the area, thereby evaluating the degree of corrosion.

[0027] Table 1-5 Alpha diversity of soil microbial communities in power grid poles From the perspective of Beta diversity analysis of soil microbial communities in power grid systems in arid areas, PCoA analysis based on unifrac distance is used. Figure 5 The results showed that arid areas were separated from other areas on the PC1 axis, with an explanatory degree of 43.67%, indicating that different regions would affect the composition of bacterial communities and cause changes, and changes in the composition of microbial communities would affect the oxidation and reduction of metals, thereby reflecting the degree of metal corrosion.

[0028] Based on the above results and the local corrosion situation, when the dominant bacterial genus in the sample is identified, Flavobacterium (Flavobacterium), Haliangium , Methylophilus (Methylophilus), Massilia (Massellella spp.) and Pseudomonas 3 or more species of (Pseudomonas), and Flavobacterium When the proportion of (Flavobacterium) is higher than 10%, the Chao1 and ACE index values ​​are both positive and greater than 3000, the Shannon index value is greater than 7, and the smaller the Simpson index value, the corresponding corrosion degree is Class B (according to the national standard GB / T8923.1-2011, the apparent characteristics of the rust on the bracket are observed, and the rust degree grades are divided into A, B, C, and D).

[0029] Example 2 A method for evaluating the degree of corrosion of carbon steel in wet power grid poles using 16S rRNA amplicon sequencing analysis is performed in the following steps: (1) Collect soil samples at the contact point between the pole and the soil layer in humid areas: The soil samples at the contact point between the pole and the soil of the power grid system in the humid area are sampled, which is the same as that in Example 1.

[0030] (2) Extraction of genomic DNA and DNA quality control; The specific steps are the same as those in Example 1. The results of sample extraction, quality inspection and pre-experimental amplification are shown in Table 2-1, and the results of electrophoresis detection are shown in Figure 1 .

[0031] Table 2-1 Sample extraction, quality inspection and pre-experimental amplification The quality of the sample DNA in this example is qualified.

[0032] (3) 16S rRNA amplicon sequencing The specific steps are the same as those in Example 1. The primer information in this example is the same as that in Example 1.

[0033] The DADA2 plug-in of QIIME2 software was used to perform data quality filtering, noise reduction, splicing and chimera removal, and generate feature tables and representative sequences.

[0034] Table 2-2 Data processing by DADA2 plug-in The DADA2 plugin of QIIME2 was used to perform quality control and generate amplicon sequence variants (ASV). The abundance of each ASV in each sample is shown in Table 2-3: Table 2-3 ASV / OTU abundance table Each ASV / OTU representative sequence was then compared with the database to perform taxonomic annotation of ASV / OTU, as shown in Table 2-4.

[0035] Table 2-4 ASV / OTU taxonomy Since there are unique and common ASVs between samples in different groups, the Venn diagram was used in this example to visualize the ASVs between and within groups of soil samples at the contact between the pole and the soil layer in the humid area. The number of unique OTUs in the Wet group was 5787, accounting for 45.79% of the total number of OTUs in each group. The Venn diagram is shown in Figure 2 .

[0036] Analyze the soil microorganisms of power grid poles in humid areas. Figure 3 The bacterial composition with a relative abundance of ≥1% at the phylum level is shown. In this example, Proteobacteria, Actinobacteriota, Chloroflex, Bacteroidota, and Acidobacteria are the dominant phyla, accounting for 24.87%, 22.32%, 15.41%, 11.31%, and 8.46% of the phylum-level composition of microbial diversity in the wet group, respectively.

[0037] The community composition of soil microorganisms at the genus level in power grid system poles in humid areas was analyzed. Figure 2 It shows Nocardioides (Nocardia), Ferruginibacter and Sphingomonas(Sphingomonas) was the dominant genus in the moist group, accounting for 32.37%, 14.19%, 10.5% and 10.2% of the microbial diversity composition in the moist group, respectively.

[0038] The Alpha diversity levels of the two regions were analyzed. Table 2-5 statistically summarizes the Alpha diversity information of the soil microbial community in the power grid system pole support. The Chao1 and ACE indexes are used to estimate the total number of species in the sample. The larger the value, the more species there are. The Shannon and Simpson diversity indices are both used to estimate the diversity of microorganisms in the sample. The larger the Shannon value, the higher the community diversity, while the larger the Simpson index value, the lower the community diversity.

[0039] In this example, the Chao1 and ACE index values ​​of the wet group are also positive and greater than 3000, indicating that the total number of microbial species in the area is large; the Shannon index value is 6.78733±0.6788, and the Simpson index value is 0.00702±0.00651. The two indexes conform to the rule that the Shannon value is large and the Simpson value is small, and the microbial diversity is high. Therefore, the Alpha diversity level can indirectly reflect the microbial diversity of the area, and then evaluate the degree of corrosion, that is, the higher the Alpha diversity level, the relatively lower the degree of corrosion, and vice versa.

[0040] Table 2-5 Alpha diversity of soil microbial communities in power grid poles From the perspective of Beta diversity analysis of soil microbial communities in power grid systems in humid areas, PCoA analysis based on unifrac distance is used. Figure 5 The results showed that the humid areas were separated from other areas on the PC1 axis, with an explanatory degree of 43.67%, indicating that different regions would affect the composition of bacterial communities and cause changes, and changes in the composition of microbial communities would affect the oxidation and reduction of metals, thereby reflecting the degree of metal corrosion.

[0041] Based on the above results and the local corrosion situation, when the dominant bacterial genus in the sample is identified, Nocardioides (Nocardia), Ferruginibacter and Sphingomonas When there are 3 or more species of Sphingomonas and the proportion of Sphingomonas is higher than 10%, the Chao1 and ACE index values ​​are both positive and greater than 3000, the Shannon index value is greater than 7, and the smaller the Simpson index value, the corrosion degree is in Grade C.

Claims

1. A method for evaluating the degree of carbon steel corrosion of power grid poles in different regions using 16S rRNA amplicon sequencing analysis, characterized in that: The steps include: (1) Collect soil samples at the contact point between the pole and the soil layer: Soil samples can be collected at the contact point between the pole and soil of the power grid system in the north and south, at high and low altitudes, in dry and wet areas, and in different temperature ranges. With the pole of the power grid system as the center, the soil within 3 cm outside the pole and 0-5 cm in depth is taken as the sampling area. The sampling is done once every 60-90 degrees. At least 3 points are taken from one sampling site, and the 3 points are put together to form a soil sample. Each soil sample is 1-3g and collected in a sterile 50mL centrifuge tube. At least 3 soil samples are taken from each region as parallel. After the soil samples are transported at low temperature to the laboratory, genomic DNA is extracted immediately or stored below -20℃ for no more than 1 month; (2) Extraction of genomic DNA and DNA quality control: A soil bacterial DNA extraction kit is used to extract bacterial genomic DNA from the soil sample collected in step (1). At least three parallel extractions are performed in each centrifuge tube. 0.5-1 g of soil is weighed for one parallel extraction. Genomic DNA is extracted according to the instructions of the soil bacterial DNA extraction kit. A 0.8-1% agarose gel is prepared. Electrophoresis is performed at 80-120 V for 30-60 min. The electrophoresis bands are then observed on a gel imager. The fragment size range is 0.15-13 Mb. The absorbance of DNA at 230 nm, 260 nm and 280 nm is measured using an ultra-micro UV spectrophotometer. The values ​​of A260 / A280 and A260 / A230 are then calculated to predict the purity of the nucleic acid. Each sample is then subjected to high-fidelity PCR pre-amplification. The amplification products are detected by agarose gel electrophoresis. Samples that pass DNA quality control and succeed in PCR amplification are defined as qualified. (3) 16S rRNA amplicon sequencing: The pre-amplified sample DNA was used as a PCR amplification template, and a positive control sample was set to amplify the target region V3-V4 or V4-V5. At the same time, a specific label sequence was introduced to the end of the sample DNA library. The amplified product was detected by agarose gel electrophoresis, and the concentration of the labeled sample DNA library was appropriately diluted. Different samples had different sequencing throughput requirements. The samples were mixed according to the corresponding molar ratio, and then the sample DNA library was sequenced using the Illumina 2×250 bp double-end sequencing strategy, followed by bioinformatics analysis; The corresponding relationship between microbial community composition and rust degree is established: The microbial community composition comparison corresponding to the rust degree was obtained by comparing the apparent characteristics of known rust areas with the number of microbial OTUs, community composition analysis, Alpha diversity level and Beta diversity in different areas.

2. The method for evaluating the degree of carbon steel corrosion of power grid poles in different regions by using 16S rRNA amplicon sequencing analysis according to claim 1, characterized in that: The rust degree is divided into A, B, C, and D, and the rust condition is observed according to the national standard GB / T8923.1-2011.

Images