5-HT1B gene molecular marker related to growth of penaeus vannamei boone and application of 5-HT1B gene molecular marker

Abstract

The invention discloses a 5-HT1B gene molecular marker related to growth of penaeus vannamei boone and application, and belongs to the technical field of molecular marker-assisted breeding of aquatic animals. The sequence of the molecular marker is shown as SEQ ID NO.3, the molecular marker comprises five sites of E3-157G / A, E3-454C / G, E3-469C / T, E3-478G / C and E3-514G / T, and the dominant genotypes are AA or AG, GG or CG, CT, CG and TT or GT in sequence. The invention further provides a haplotype molecular marker composed of the E3-157G / A and the E3-514G / T, and the haplotype molecular marker comprises the E3-157G / A and the E3-514G The penaeus vannamei feed can be used for culture and improvement of penaeus vannamei; the method is not limited by the development stage, and can provide technical means and theoretical support for early breeding of penaeus vannamei individuals / families / varieties; the method can further shorten the breeding time and reduce the breeding cost.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding of aquatic animals, and in particular relates to a 5-HT1B gene molecular marker related to the growth of Penaeus vannamei and its application. Background Art

[0002] Litopenaeus vannamei, also known as Vannamei shrimp, white shrimp, and white shrimp, is native to the Pacific waters of South America. It is the shrimp variety with the largest aquaculture area, the widest aquaculture range, and the highest annual output in my country. With the continuous expansion of its aquaculture scale, the aquaculture industry has an increasingly urgent demand for excellent germplasm of white shrimp. Growth traits are very important and direct target traits in animal genetic breeding. However, at present, white shrimp mainly relies on traditional breeding, which is costly and time-consuming from the construction, comparison and selection of families in the early stage to the maintenance and measurement in the later stage. There are also phenomena such as lax cultivation and screening of parents, inbreeding, and non-standard seedling technology, which seriously reduce the quality of seedlings, showing problems such as slow growth rate and large individual growth differences. Therefore, how to quickly complete the breeding of growth traits of white shrimp at low cost is a problem worthy of further exploration. Single nucleotide polymorphism (SNP) refers to the DNA sequence polymorphism caused by a variation at a specific nucleotide position in genomic DNA. It has the advantages of large number and wide distribution, genetic stability, strong representativeness, and automatic detection. It is one of the ideal genetic markers. With the development and maturity of molecular marker-assisted breeding, its application in genetic breeding of aquatic animals is becoming more and more extensive. Compared with traditional genetic breeding, molecular marker-assisted breeding has the characteristics of short breeding interval, high accuracy and reliability. The use of molecular marker-assisted breeding can significantly accelerate the breeding process.

[0003] 5-hydroxytryptamine (5-HT) was first discovered and separated from serum, so it is also called serotonin. It is a biological neurotransmitter that participates in a variety of physiological and behavioral functions of organisms and can only work when it binds to receptors. Serotonin receptors can be divided into seven subfamilies from 5-HT1 to 5-HT7, among which 5-HT1 receptor is the largest family in the 5-HT receptor family, with five receptor proteins: 5-HT1A, 5-HT1B, 5-HT1D, 5-HT1E, and 5-HT1F. 5-hydroxytryptamine (serotonin) receptor 1B (5-HT1B) may be involved in regulating the feeding and glycogenolysis process of fish and has a strong mediating effect, but there is currently a lack of research on the relationship between the 5-HT1B gene and the growth traits of white shrimp. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a 5-HT1B gene SNP molecular marker related to the growth traits of white shrimp and its application, which can provide some information and technical support for the growth trait-related and subsequent research of white shrimp, and is conducive to the genetic improvement of the growth traits of white shrimp.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] One of the purposes of the present invention is to provide a SNP molecular marker associated with the growth of white shrimp. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3, including five sites, namely, E3-157 G / A, E3-454 C / G, E3-469 C / T, E3-478G / C and E3-514 G / T, wherein: E3-157 G / A has three genotypes: GG, AG and AA, and AA or AG is a dominant genotype; E3-454 C / G has three genotypes: CC, CG and GG, and GG or CG is a dominant genotype; E3-469 C / T has two genotypes: CC and CT, and CT is a dominant genotype; E3-478 G / C has two genotypes: GG and CG, and CG is a dominant genotype; E3-514 G / T has three genotypes: GG, GT and TT, and TT or GT is a dominant genotype.

[0007] E3-157 G / A is located at the 157th base of the sequence shown in SEQ ID NO.3, and the base at this position is A or G;

[0008] E3-454 C / G is located at the 454th base of the sequence shown in SEQ ID NO.3, and the base at this position is C or G;

[0009] E3-469 C / T is located at the 469th base of the sequence shown in SEQ ID NO.3, and the base at this position is C or T;

[0010] E3-478 G / C is located at the 478th base of the sequence shown in SEQ ID NO.3, and the base at this position is G or C;

[0011] E3-514 G / T is located at the 514th base of the sequence shown in SEQ ID NO.3, and the base at this position is G or T.

[0012] Furthermore, the growth-related traits are any one or more of body weight, total length, body length, carapace length and pure meat weight.

[0013] The second object of the present invention is to provide a haplotype molecular marker associated with the growth of white shrimp, wherein the haplotype molecular marker includes the sites E3-157 G / A and E3-514 G / T in the SNP molecular marker, and the two are completely linked.

[0014] The third object of the present invention is to provide a primer pair for detecting the SNP molecular marker and / or the haplotype molecular marker, the nucleotide sequence of the primer pair is shown as SEQ ID NO.1 and SEQ ID NO.2.

[0015] The fourth object of the present invention is to provide a method for SNP molecular marker-assisted breeding of families / individuals with different growth conditions of white shrimp, wherein the method is performed by using the primer pair.

[0016] Furthermore, the method comprises the steps of: using the primers to perform PCR amplification and sequencing on the DNA samples of the whiteleg shrimp family / individual to be tested; if the results show that the genotypes of the five sites described in claim 1 are any one or more of the dominant genotypes, then the family / individual is a fast-growing family / individual; if the results show that the genotypes of the five sites described in claim 1 are all genotypes other than the dominant genotype, then the family / individual is a slow-growing family / individual.

[0017] The specific steps of the method are as follows:

[0018] (1) Extracting DNA from the muscle tissue of Penaeus vannamei, extracting 2 μL of DNA from each individual Penaeus vannamei in the family as a mixed sample;

[0019] (2) Using the mixed DNA samples of each family as template, PCR amplification was performed using primers SEQ ID NO.1 and SEQ ID NO.2 to obtain an amplified fragment (SEQ ID NO.3), the length of which was 711 bp;

[0020] The 20 μL system for PCR amplification is: 2.0 μL DNA template, 0.5 μL upstream and downstream primers, 10 μL 2×AccurateTaq Master Mix (dye plus), 7 μL ddH2O;

[0021] The amplification procedure is: pre-denaturation at 95°C for 5 min; 35 cycles of chain reaction, including: denaturation at 95°C for 30 s, annealing at 57.5°C for 45 s, extension at 72°C for 1 min; final extension at 72°C for 5 min;

[0022] (3) After obtaining the PCR amplification product, perform first-generation sequencing.

[0023] If the test results are one or more of the following, the tested whiteleg shrimp family / individual is a faster growing family / individual: the genotype of the E3-157 G / A site is AA or AG; the genotype of the E3-454 C / G site is GG or CG; the genotype of the E3-469 C / T site is CT; the genotype of the E3-478 G / C site is CG; the genotype of the E3-514 G / T site is TT or GT. If the genotypes of the five sites E3-157 G / A, E3-454 C / G, E3-469 C / T, E3-478 G / C, and E3-514 G / T are GG, CC, CC, GG, and GG, respectively, the tested whiteleg shrimp family / individual is a slower growing family / individual.

[0024] A fifth object of the present invention is to provide a method for haplotype molecular marker-assisted breeding of families / individuals with different growth conditions of white shrimp, wherein the method is performed by using the primer pair.

[0025] Furthermore, the method comprises the steps of: using the primers to perform PCR amplification and sequencing on the DNA samples of the whiteleg shrimp family / individual to be tested; if the genotypes of the two sites (E3-157 G / A and E3-514 G / T) are any one or more of the dominant genotypes, the family / individual is a fast-growing family / individual; if the genotypes of the two sites are all genotypes other than the dominant genotypes, the family / individual is a slow-growing family / individual.

[0026] The specific steps of the method are as follows:

[0027] (1) Extracting DNA from muscle tissue of Penaeus vannamei;

[0028] (2) Using the extracted DNA as a template, PCR amplification was performed using primers SEQ ID NO.1 and SEQ ID NO.2 to obtain an amplified fragment (SEQ ID NO.3), the length of which was 711 bp;

[0029] The 20 μL system for PCR amplification is: 2.0 μL DNA template, 0.5 μL upstream and downstream primers, 10 μL 2×AccurateTaq Master Mix (dye plus), 7 μL ddH2O;

[0030] The amplification program is: pre-denaturation at 95°C for 5 minutes; 35 cycles of chain reaction, including: denaturation at 95°C for 30 seconds, annealing at 57.5°C for 45 seconds, extension at 72°C for 1 minute; and final extension at 72°C for 5 minutes.

[0031] (3) After obtaining the PCR amplification product, perform first-generation sequencing.

[0032] If the test result is one or more of the following, the tested whiteleg shrimp family / individual is a faster growing family / individual: the genotype of the E3-157 G / A site is AA or AG; the genotype of the E3-514 G / T site is TT or GT.

[0033] Furthermore, if the genotypes of the two loci are AA+TT, the growth of the family / individual is optimal.

[0034] The sixth object of the present invention is to provide an application of the SNP molecular marker, the haplotype molecular marker, the primer pair or the method in the selection of whiteleg shrimp families / individuals / variety and the cultivation / improvement of whiteleg shrimp.

[0035] Compared with the prior art, the present invention has the following technical effects:

[0036] 1. Based on the analysis and screening of the 5-HT1B gene of Penaeus vannamei, the present invention provides a SNP molecular marker and a haplotype molecular marker related to the growth traits of Penaeus vannamei, which can be applied to the cultivation and improvement of Penaeus vannamei individuals / families; 2. The present invention is not limited by the developmental stage of Penaeus vannamei, and can provide effective technical means and theoretical support for the early breeding of Penaeus vannamei individuals / families; 3. The present invention can further shorten the breeding time and reduce the breeding cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is a partial fragment sequence in the DNA mixed sample amplification result and sequencing result in Example 1 of the present invention, wherein: a is a band of amplification products of the 4 family DNA mixed pools, b-f are 5 SNP sites and partial sequence fragments before and after in the mixed pool sequencing results;

[0038] Figure 2 This is part of the results of amplification of individual DNA samples of Penaeus vannamei in Example 2 of the present invention;

[0039] Figure 3 It is a sequencing peak graph of different genotypes of 5 SNP sites in the 5-HT1B gene of white shrimp in Example 2 of the present invention, wherein: a is a peak graph of GG, AG, and AA genotypes at the E3-157 G / A site, b is a peak graph of CC, CG, and GG genotypes at the E3-454 C / G site, c is a peak graph of CC and CT genotypes at the E3-469 C / T site, d is a peak graph of GG and CG genotypes at the E3-478 G / C site, and e is a peak graph of GG, GT, and TT genotypes at the E3-514 G / T site;

[0040] Figure 4This is a linkage analysis map of 5 SNP sites in the 5-HT1B gene of Penaeus vannamei in Example 5 of the present invention. DETAILED DESCRIPTION

[0041] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention. The reagents, kits and instruments used in the following examples can all be obtained commercially, and the methods used in the examples are consistent with the conventional methods unless otherwise specified.

[0042] The technical solution of the present invention is further described in detail below in conjunction with embodiments.

[0043] Example 1 Screening of candidate SNPs associated with growth traits in the 5-HT1B gene of white shrimp

[0044] 1. Measurement and analysis of sample growth indicators

[0045] Using the extreme value method, according to daily breeding data, two fast-growing families (L1, L2) and two slow-growing families (S1, S2) in the same growth cycle were selected, and 30 white shrimps from each family were taken, totaling 120. The growth traits such as body weight, total length, body length, carapace length, and pure meat weight were measured, and the analysis results are shown in Table 1. Table 1 shows that the growth indicators of L1 and L2 were significantly higher than those of L1 and L2 (P<0.05).

[0046] Table 1 Analysis of growth data of Penaeus vannamei from different families

[0047]

[0048] Note: If the letters of the same indicator in the same column are completely different, the difference is significant (P<0.05); if the letters are the same, the difference is not significant (P≥0.05).

[0049] 2. Sample DNA Extraction

[0050] Muscle tissues of 120 whiteleg shrimps were taken, and DNA was extracted from the samples using a marine animal tissue genomic DNA extraction kit (TIANGEN, Tiangen Biochemical Technology Co., Ltd.) according to the instructions. DNA integrity was tested using 1.5% agarose gel electrophoresis, and the electrophoresis results showed that the PCR amplification product bands of the four DNA pools were clear and bright without smears, and were stored in a -20°C refrigerator for later use.

[0051] 3. Primer Design and Synthesis

[0052] The NCBI website was used to query the sequence of the 5-HT1B gene of white shrimp (Gene ID: 113811101). Primers were designed using Primer Premier 6.0 software and synthesized by Beijing Liuhe BGI Technology Co., Ltd. The primers were located on the third exon (E3) of the target gene and were 711 bp long. The primer sequences were as follows:

[0053] 5-HT1B-F: 5'-CCGTCTCGTGTTGCAGGTTC-3' (SEQ ID NO. 1);

[0054] 5-HT1B-R: 5'-GGTTGAGCGTGGAGTTGAAGTAG-3' (SEQ ID NO. 2).

[0055] 4. Mixed PCR amplification and sequencing

[0056] 2 μL of DNA from 30 shrimps of each family was extracted as a mixed sample, and the target fragment was amplified using the mixed samples of DNA from the four families as templates. The total volume of the PCR amplification reaction system was 20 μL, including: 2×Accurate Taq Master Mix (dye plus) 10 μL; upstream primer 0.5 μL; downstream primer 0.5 μL; DNA template 2.0 μL; ddH2O 7 μL. The PCR amplification program was: 95°C pre-denaturation for 5 min; (95°C denaturation for 30 s, 59.5°C annealing for 45 s, 72°C extension for 1 min) × 35 cycles; 72°C extension for 5 min. The amplification results are shown in the figure below. Figure 1 The results showed that the PCR product was detected by 1.5% agarose gel electrophoresis to determine the correct length of the band ( Figure 1 a). Then it was sent to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. for sequencing.

[0057] The amplified 5-HT1B gene sequence (SEQ ID NO.3) is as follows:

[0058] CCGTCTCGTGTTGCAGGTTCTGGGCGGTGACCAACGTGGACTACATCCACCACCGGTCGCCGCGGCGCGTGGGCGGGATGATCGCCGCCATCTGGATCGTGTCGTTCCTGGTGTCGCGGCCGCCCATGATGGGCTGGAAGGACCCCGAGTGGCACGACCGCCTCGCCGAGAAGATGT GCATCATCTCGCAGGACGTCGGCTACCAGATCTTCGCCACCATCACCTCCTTCTACCTGCCGCTGCTGGTGATCCTCATCCTGTACTGGCGCGTGTACCAGACGGCCCGCAAGCGCATCCGCCGGAAGTTCGGCACCAACGCGCAGTCGGCGCTGTGCCGCGGCCCCATCACCATCAG CGAGACCACGACCTTCGCGCGCATGGCCACGCAGCCGTCGCCGGAGAAGACGTCCAACGGCAGCACGCTCAACGGCCACCCGATGGACGCCAGCCGCGAGGACTCGACGTCGGGCAGCCAGGCGGCCATCACGCACGTGCTCCCGCGGCAGCTGCGCCGGCGGGAGGGCGAGCTGCGG AAGGAGCGCAAGGCCGCCAAGACGCTGGCCATCATCACGGGCGCCTTCGTGATGTGCTGGCTGCCCTTCTTCATCCTGGCGGTGCTGATGCCGCTGTGCCCGCCCTCCTTCTGCAACTTCAACCCCTACCTGATCGCCACCTTCCTGTGGCTGGGCTACTTCAACTCCACGCTCAACC

[0059] 5. Analysis of Sequencing Results

[0060] Use SeqMan software to view the mixed sample sequencing results, such as Figure 1 The results showed that 5 overlapping peaks were found in the sequencing results of the PCR amplification products of the 4 mixed DNA samples amplified by the primers shown in SEQ ID NO.1-2 ( Figure 1b~f). The first SNP site is located at the 157th base of the third exon of the 5-HT1B gene, which mutated from G to A and was named E3-157G / A; the second to fifth SNP sites were named: E3-454 C / G; E3-469 C / T; E3-478 G / C; E3-514 G / T. In the S1 and S2 families, these five sites did not mutate, that is, the genotypes of the first to fifth SNP sites of the S1 and S2 families were: GG, CC, CC, GG and GG.

[0061] Example 25 Identification of HT1B gene SNP genotype

[0062] 1. Single sample (single shrimp DNA sample) amplification and sequencing

[0063] Using the DNA of each individual Penaeus vannamei in the L1 and L2 families containing double peaks in Example 1 as a template, 60 DNAs were amplified using the primers (SEQ ID NO.1, SEQ ID NO.2) and amplification procedures in Example 1. The PCR products were detected by 1.5% agarose electrophoresis. The electrophoresis results are shown in Figure 2 shown. Figure 2 The PCR product band was single and clear without tailing. Referring to the DL 2,000 DNA Marker, the band length was 711 bp, which was consistent with the target band. Then it was sent to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. for sequencing.

[0064] 2. Analysis of Sequencing Results

[0065] Use SeqMan software to check the results. Figure 3 The results showed that there were three genotypes at E3-157 G / A: GG homozygous, AG heterozygous, and AA homozygous; there were three genotypes at E3-454 C / G: CC homozygous, CG heterozygous, and GG homozygous; there were two genotypes at E3-469 C / T: CC homozygous and CT heterozygous; there were two genotypes at E3-478 G / C: GG homozygous and CG heterozygous; there were three genotypes at E3-514 G / T: GG homozygous, GT heterozygous, and TT homozygous.

[0066] Example 3 Genetic characteristics of 5-HT1B gene SNP sites within a family

[0067] According to the results in Example 2, the genetic characteristics of the white shrimp families with mutation sites were analyzed, and the gene frequency, genotype frequency, and χ 2Popgen32 software was used to calculate genetic heterozygosity (H) and effective allele number (Ne), and PIC CALC software was used to calculate polymorphism information content (PIC). The results are shown in Table 2.

[0068] Table 2 shows that there are 4 mutation sites in family L1: E3-157 G / A, E3-469 C / T, E3-478 G / C, E3-514G / T; there is 1 mutation site in family L2: E3-454 C / G. The gene heterozygosity of each site is within the range of 0.25-0.5, which is moderately polymorphic; 2 The test results showed that the χ 2 The values ​​are all less than χ 2 0.05 (k-1), that is, P>0.05, and both families of whiteleg shrimp conformed to the Hardy-Weinberg equilibrium (P>0.05).

[0069] Table 2 Analysis of population genetic characteristics of five SNPs in the 5HT1B gene of Penaeus vannamei within the family

[0070]

[0071] Note: 2 0.05 (df=2)=5.99; when χ 2 When <5.99, P>0.05, it conforms to the Hardy-Weinberg equilibrium.

[0072] Example 4 Analysis of correlation between 5-HT1B gene SNP sites and growth traits among individuals

[0073] According to the results in Example 2, SPSS26.0 software was used to test the significance of the association between the genotypes of the five loci and the growth traits of the 120 white shrimp individuals in Example 1. P<0.05 indicates a significant difference, and the trait value is expressed as "mean ± standard error". The results are shown in Table 3. The results show:

[0074] Different genotypes of E3-157 G / A locus were significantly correlated with the body weight and pure meat weight of white shrimp. The genotype AA was significantly higher than GG, but the difference between it and AG was not significant. There was no significant difference in total length, body length and cephalothorax length among the genotypes.

[0075] Different genotypes of E3-454 C / G locus were significantly correlated with the body mass, total length, body length and pure meat weight of white shrimp, and the genotypes GG and CG were significantly higher than CC; there was no significant difference in the length of the cephalothorax among the genotypes.

[0076] Since there are only two genotypes at the E3-469 C / T site and the E3-478 G / C site, it is impossible to perform differential analysis. However, judging from the mean, the growth indicators of the mutant heterozygous genotype are better than those of the homozygous type.

[0077] Different genotypes of E3-514 G / T locus were significantly correlated with the body mass and pure meat weight of white shrimp. The genotype TT was significantly higher than GG, but the difference between it and TG was not significant. There was no significant difference in total length, body length and cephalothorax length among the genotypes.

[0078] Table 3 Analysis of correlation between 5-HT1B gene SNPs and growth among individuals of Penaeus vannamei

[0079]

[0080] Note: If the letters of the same indicator in the same column are completely different, the difference is significant (P<0.05); if the letters are the same, the difference is not significant (P≥0.05).

[0081] Example 5 Linkage analysis of SNP loci in 5-HT1B gene of Penaeus vannamei individuals

[0082] Haploview software was used to perform linkage disequilibrium (LD) analysis on the five SNPs of the 5-HT1B gene, and SPSS was used to perform one-way ANOVA on haplotypes with biological statistical significance (n ≥ 3), and the differences were annotated according to the Waller-Duncan test. Figure 4 And as shown in Table 4.

[0083] The results showed that the E3-157 G / A site and the E3-514 G / T site were completely linked ( Figure 4 ), all three haplotypes were biologically significant (n≥3), namely H1H1 (GG+GG), H1H2 (AG+GT) and H2H2 (AA+TT). The body weight and pure meat weight of the H2H2 haplotype were significantly higher than those of the H1H1 (P<0.05), and there was no significant difference with the H1H2 haplotype (P≥0.05), as shown in Table 4.

[0084] Table 4 Correlation analysis between 5-HT1B gene haplotype and growth traits of Penaeus vannamei

[0085]

[0086]

[0087] Note: If the letters of the same indicator in the same column are completely different, the difference is significant (P<0.05); if the letters are the same, the difference is not significant (P≥0.05).

[0088] Example 6 Verification of SNPs in the 5-HT1B gene of Penaeus vannamei

[0089] Five whiteleg shrimp families (X1-X5) under the same culture conditions were randomly selected, and 20 shrimps were taken from each family, for a total of 100 whiteleg shrimps. According to the methods in Example 1 and Example 2, the 100 shrimps were subjected to growth index measurement, DNA extraction, PCR amplification and sequencing analysis. The results are shown in Tables 5-7.

[0090] The mixed sequencing results showed that there were polymorphisms at E3-157 G / A, E3-469 C / T, E3-478G / C and E3-514 G / T sites in the three families X1, X2 and X4, and no mutations occurred at E3-157 G / A, E3-454 C / G, E3-469 C / T, E3-478 G / C and E3-514 G / T sites in the two families X3 and X5; the growth trait analysis results (Table 5) showed that the data of the three families X1, X2 and X4 were significantly higher than those of the two families X3 and X5. This result is consistent with the trend of the results obtained in Example 1.

[0091] The results of single sample sequencing showed that the AA and AG genotypes at the E3-157 G / A site had 4 growth indicators significantly higher than the GG genotype; the E3-469 C / T site and the E3-478 G / C site had only two genotypes, so differential analysis could not be performed, but from the mean, the growth indicators of the mutant heterozygous genotype were better than the homozygous type; the TT and TG genotypes at the E3-514 G / T site had 4 growth indicators significantly higher than the GG genotype (Table 6). This is consistent with the trend of the results obtained in Example 4.

[0092] The haplotype analysis results showed that the sites E3-157 G / A and E3-514 G / T were completely linked. When the site genotype was AA+TT (H2H2), 4 growth indicators were significantly higher than GG+GG (H1H1), and 3 growth indicators were significantly higher than AG+GT (H1H2) (Table 7). The trend was consistent with the results obtained in Example 5.

[0093] Table 5 Analysis of growth data of Penaeus vannamei from verified families

[0094]

[0095] Note: If the letters of the same indicator in the same column are completely different, the difference is significant (P<0.05); if the letters are the same, the difference is not significant (P≥0.05).

[0096] Table 6 Analysis of the correlation between verified individual 5-HT1B gene SNPs and growth

[0097]

[0098]

[0099] Note: If the letters of the same indicator in the same column are completely different, the difference is significant (P<0.05); if the letters are the same, the difference is not significant (P≥0.05).

[0100] Table 7 Correlation analysis between 5-HT1B gene haplotype and growth traits of verified individuals

[0101]

[0102] Note: If the letters of the same indicator in the same column are completely different, the difference is significant (P<0.05); if the letters are the same, the difference is not significant (P≥0.05).

[0103] In summary, the families / individuals whose genotypes of the five loci are GG, CC, CC, GG and GG are slower growing families / individuals; the whiteleg shrimp individuals whose single sample sequencing results are one or more of the following situations are faster growing families / individuals: the genotype of the E3-157 G / A locus is AA or AG, the genotype of the E3-454 C / G locus is GG or CG, the genotype of the E3-469 C / T locus is CT, the genotype of the E3-478 G / C locus is CG, and the genotype of the E3-514 G / T locus is TT or GT; at the same time, when the genotypes of the E3-157 G / A and E3-514 G / T loci in the haplotype molecular marker are AA+TT, they are faster growing families / individuals; the present invention can be applied to the molecular marker-assisted breeding of whiteleg shrimp, and provides an effective and accurate molecular breeding marker method for whiteleg shrimp breeding.

[0104] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with the growth of Penaeus vannamei, characterized in that: The SNP molecular marker nucleotide sequence is shown in SEQ ID NO.3, including five sites, namely, E3-157 G / A, E3-454 C / G, E3-469 C / T, E3-478 G / C and E3-514 G / T, wherein: E3-157 G / A has three genotypes: GG, AG and AA, and AA or AG is the dominant genotype; E3-454 C / G has three genotypes: CC, CG and GG, and GG or CG is the dominant genotype; E3-469 C / T has two genotypes: CC and CT, and CT is the dominant genotype; E3-478 G / C has two genotypes: GG and CG, and CG is the dominant genotype; E3-514 G / T has three genotypes: GG, GT and TT, and TT or GT is the dominant genotype.

2. The SNP molecular marker according to claim 1, characterized in that: The growth-related traits are any one or more of body weight, total length, body length, carapace length and pure meat weight.

3. A haplotype molecular marker associated with the growth of Penaeus vannamei, characterized in that: The haplotype molecular marker comprises the sites E3-157 G / A and E3-514 G / T in the SNP molecular marker according to any one of claims 1 to 2.

4. A set of primer pairs for detecting the SNP molecular markers according to any one of claims 1 to 2 and / or the haplotype molecular markers according to claim 3, characterized in that: The nucleotide sequences of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.

2.

5. A method for SNP molecular marker-assisted breeding of families / individuals with different growth conditions of white shrimp, characterized in that: The method is carried out by using the primer pair according to claim 4.

6. The method according to claim 5, characterized in that The method comprises the steps of: using the primers to perform PCR amplification and sequencing on a DNA sample of a family / individual of the white shrimp to be tested; if the result shows that the genotypes of the five sites described in claim 1 are any one or more of the dominant genotypes, then the family / individual is a fast-growing family / individual; if the result shows that the genotypes of the five sites described in claim 1 are all genotypes other than the dominant genotype, then the family / individual is a slow-growing family / individual.

7. A method for haplotype molecular marker-assisted breeding of families / individuals with different growth conditions of white shrimp, characterized in that: The method is carried out by using the primer pair according to claim 4.

8. The method according to claim 7, characterized in that The method comprises the steps of: using the primers to perform PCR amplification and sequencing on a DNA sample of a family / individual of the white shrimp to be tested; if the genotypes of the two sites in claim 3 are any one or more of the dominant genotypes, the family / individual is a fast-growing family / individual; if the genotypes of the two sites in claim 3 are all genotypes other than the dominant genotypes, the family / individual is a slow-growing family / individual.

9. The method according to claim 8, characterized in that If the genotypes of the two loci in claim 3 are AA+TT, the growth of the family / individual is optimal.

10. Use of the SNP molecular marker according to any one of claims 1 to 2, the haplotype molecular marker according to claim 3, the primer pair according to claim 4, or the method according to any one of claims 5 to 9 in the selection of families / individuals / variety of Penaeus vannamei and the cultivation / improvement of Penaeus vannamei.

Images