Molecular marker of excellent rice stem-strengthening large-panicle genotype SCM3YCN1 and application of molecular marker

Abstract

The invention discloses a molecular marker of a rice stem-strengthening large-panicle excellent genotype SCM3YCN1 and application of the molecular marker. The invention relates to an excellent genotype SCM3YCN1 of an SCM3 gene, which can increase the stalk strength and the number of grains per ear, and is identified aiming at the creation of a strong-stalk large-ear type material and genome sequencing analysis. The molecular marker developed by utilizing the variation site of the excellent genotype SCM3YCN1 can be used for improving the rice yield and the lodging-resistant character, and the breeding of high-yield lodging-resistant varieties can be accelerated. Genetic typing is carried out on the developed SNP marker by utilizing a KASP technology, an excellent genotype SCM3YCN1 can be rapidly and accurately detected, the SNP marker is applied to commercial molecular breeding in a high-throughput manner, and the selection efficiency in the breeding process is greatly improved.

Description

Technical Field

[0001] The invention belongs to the field of molecular markers, and relates to a molecular marker for screening rice varieties with strong stems and large panicles and excellent genotypes, and specifically relates to a rice variety with strong stems and large panicles, and an excellent genotype SCM3. YCN1 Molecular markers and their applications. Background Art

[0002] In recent years, with global warming, extreme wind and rainstorms have occurred frequently, causing large areas of rice to fall over during the filling and maturity period, resulting in reduced rice quality and seed germination rate, while increasing harvest costs. The lodging phenomenon is more serious in high-yield varieties, so cultivating rice varieties with strong stems and large panicles can balance the relationship between high yield and lodging resistance, which is conducive to achieving high and stable rice yields. At present, there are relatively few variety resources and genes for breeding rice varieties with strong stems and large panicles, which hinders the cultivation of high-yield and lodging-resistant varieties.

[0003] Stalk strength is one of the most important agronomic traits of rice, which directly determines the resistance of rice stalks to breaking. Improving the strength of rice stalks can effectively enhance the ability of rice to resist lodging. However, the determination of rice stalk strength is time-consuming and laborious, and it is not possible to observe it from the field phenotype, which limits the selection efficiency of breeders in breeding for lodging resistance.

[0004] The SCM3 gene reported by previous researchers can effectively improve the strength of the culm, but it comes from indica rice varieties and will cause a reduction in tillers. At present, there are relatively few japonica rice varieties with strong stalks and large panicles in China, which limits the cultivation of high-yield, lodging-resistant, and high-quality conventional japonica rice. The molecular marker-assisted selection (MAS) technology directly selects the genotype of the variety, is not affected by the environment, and has the advantages of low cost, high efficiency, and strong reliability. However, molecular markers that can be directly used for strong stalks and large panicles of rice have not been found so far. If we can create or screen japonica rice varieties with strong stalks and large panicles and analyze the genetic variation of their stalk strength-related genes, develop molecular markers with good operability, and carry out MAS breeding, it will effectively increase the speed of selecting new rice varieties with high yield and lodging resistance. Summary of the invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a rice genotype SCM3 with strong stems and large panicles. YCN1 molecular markers.

[0006] The technical problem that the present invention also solves is to provide a method for detecting the rice strong stem and large panicle superior genotype SCM3 YCN1 Primer set for molecular markers.

[0007] The technical problem that the present invention also solves is to provide the application of the primer set or the kit in identifying, screening or cultivating strong-stem and large-panicle type rice breeding.

[0008] The technical problem that the present invention also aims to solve is to provide a method for obtaining a rice variety with strong stems and large panicles.

[0009] The final technical problem to be solved by the present invention is to provide a method for detecting the rice strong stem and large panicle gene SCM3.

[0010] Technical solution: In order to solve the above technical problems, the present invention provides a rice genotype SCM3 with strong stems and large panicles. YCN1 The molecular marker is SCM3 YCN1 _k_28430214, SCM3 YCN1 The nucleic acid variation site detected by _k_28430214 is located at the 28430214th base on chromosome 3 of the rice reference genome MSU7.0, and the base is T or G.

[0011] The present invention also includes detecting the rice strong stem and large panicle superior genotype SCM3 YCN1 A primer set for molecular markers, the primer set comprising specific primer pairs as follows:

[0012] SCM3 YCN1 _k_28430214Rc X:GGAGTTCGATCTTAGTGCCGTAC;

[0013] SCM3 YCN1 _k_28430214Ra Y:GGAGTTCGATCTTAGTGCCGTAA.

[0014] The present invention also includes the primer set, which also includes the following universal primer: AGGATCAGTGGGAGCTCGG.

[0015] Wherein, the specific primers are connected to different fluorescent linker sequences respectively, and the fluorescent linker sequence is a FAM or HEX fluorescent linker sequence.

[0016] The present invention also includes a method for detecting the strong stem and large ear gene SCM3 YCN1 A kit for gene SNP molecular labeling, the kit comprising the primer set as described above.

[0017] The present invention also includes the application of the primer set or the kit in identifying, screening or cultivating rice with strong stems and large panicles.

[0018] The present invention also includes a method for obtaining a rice variety with strong stems and large panicles, the method comprising making the base at the 28430214th base on the third chromosome of the rice reference genome MSU7.0 of the rice be T.

[0019] The present invention also includes a rice strong stem and large panicle gene SCM3 YCN1 The detection method comprises the following steps:

[0020] 1) Extracting genomic DNA from rice samples;

[0021] 2) Using rice genomic DNA as a template, using the primer set or the kit to PCR amplify SCM3 YCN1 _k_28430214 molecular marker was used to perform KASP reaction;

[0022] 3) The samples after the reaction were subjected to fluorescence detection on an ELISA instrument, and the genotyping results were obtained by the SNP automatic typing tool. The amplified samples were detected as FAM fluorescence signals on the ELISA instrument, and then the genotyping results obtained by the SNP automatic typing tool showed that the SNP site was base G, and the rice sample was judged to be homozygous SCM3 YCN1 Genotype, rice plants show non-strong stems and large panicles; the fluorescence detection of the amplified sample on the microplate reader is HEX fluorescence signal, and then the genotyping result obtained by the SNP automatic typing tool shows that the SNP site is base T, so the rice sample is judged to be homozygous SCM3 YCN1 Genotype, rice plants show strong stems and large panicles; the amplified sample detected FAM and HEX fluorescence signals on the microplate reader at the same time, and then the genotyping result obtained by the SNP automatic typing tool showed that the SNP site was heterozygous for base G / T, so the rice sample was judged to be heterozygous SCM3 YCN1 / scm3 genotype, the rice plants show strong stems and large panicles.

[0023] The amplification reaction system of the KASP reaction in step 2) includes: a DNA template, a PARMS master mix, the primer set, ddH 2 O and mineral oil.

[0024] Wherein, the PCR amplification reaction system is as follows:

[0025]

[0026] Wherein, the PCR amplification reaction conditions are as follows:

[0027]

[0028] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention is aimed at creating strong stem and large ear type materials and identifying an excellent genotype of SCM3 gene that can increase stem strength and number of grains per ear through genome sequencing analysis. YCN1 . Using the superior genotype SCM3 YCN1 The molecular markers developed from the mutation sites can be used to improve the yield and lodging resistance of rice, and can accelerate the selection of high-yield and lodging-resistant varieties. The present invention can infer the phenotype by detecting the genotype at the seedling stage, saving breeding time and reducing the planting area. The present invention uses KASP technology to perform genotyping on the developed SNP markers, which can quickly and accurately detect the superior genotype SCM3 YCN1 High-throughput applications are used in commercial molecular breeding. During the experiment, no cumbersome procedures such as PCR, enzyme cutting, gel electrophoresis and sequencing are required, which reduces the use of harmful chemicals and labor, and greatly improves the selection efficiency in the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 QTLseq analysis of strong stem and large panicle in Yangchannuo 1×Wuxiangjing 5245F2 population;

[0030] Figure 2 For SCM3 YCN1 _k_28430214's marker typing diagram;

[0031] Figure 3 For SCM3 YCN1 Marker typing diagram of indel-2;

[0032] Figure 4 Analysis of stem bending strength of 42 rice varieties;

[0033] Figure 5 Analysis of stem diameter at the second node of 42 rice varieties;

[0034] Figure 6 Analysis of the number of grains per panicle in the main stem of 42 rice varieties;

[0035] Figure 7 Analysis of seed setting rate of 42 rice varieties;

[0036] Figure 8 Analysis of SCM3 genotypes and flexural strength of 32 strains of Yangchannuo No. 1×Wuxiangjing 5245F2:3; Legend: The letters under the strain number on the horizontal axis represent SCM3 YCN1 _k_28430214 The base of the variant site detected by the molecular marker

[0037] Fig. 9Analysis of SCM3 genotypes and stem diameter of 32 strains of Yangchannuo No. 1×Wuxiangjing 5245F2:3; Legend: The letters below the strain number on the abscissa represent SCM3 YCN1 _k_28430214 The base of the variant site detected by the molecular marker.

[0038] Fig.10 Analysis of SCM3 genotypes and main stem grain number per ear of 32 strains of Yangchannuo No. 1×Wuxiangjing 5245F2:3; Legend: The letters under the strain number on the abscissa represent SCM3 YCN1 _k_28430214 is the base of the variant site detected by the molecular marker;

[0039] Fig.11 Analysis of SCM3 genotypes and flexural strength of 30 strains of Yangchannuo No. 1×Nanjing 5718F2:3; Legend: The letters under the strain number on the horizontal axis represent SCM3 YCN1 _k_28430214 is the base of the variant site detected by the molecular marker;

[0040] Fig.12 Analysis of SCM3 genotypes and stem diameters of 30 lines of Yangchannuo 1×Nanjing 5718F2:3; Figure legend: The letters below the line number on the abscissa represent SCM3 YCN1 _k_28430214 is the base of the variant site detected by the molecular marker;

[0041] Fig.13 Analysis of SCM3 genotypes and main stem grain number per ear of 30 Yangchannuo 1×Nanjing 5718F2:3 lines; Legend: The letters under the line number on the horizontal axis represent SCM3 YCN1 _k_28430214 The base of the variant site detected by the molecular marker. DETAILED DESCRIPTION

[0042] Example 1

[0043] 1. Discovery of strong-stem and large-panicle variety resources and QTLseq analysis of strong-stem and large-panicle gene loci

[0044] The variety Yangchannuo No. 1 (Gan Shen Rice 20190032, https: / / www.ricedata.cn / variety / varis / 619751.htm) bred by this breeding team showed excellent lodging resistance and high yield in the field (Table 1). As shown in Table 1, compared with the rice varieties Nanjing 9108 and Nanjing 46, which are widely planted in production, Yangchannuo No. 1 has significantly increased stem bending resistance, stem diameter at the second node, number of grains per main stem panicle, and 1000-grain weight, showing better lodging resistance and high yield.

[0045] In order to explore and utilize the superior lodging-resistant genotypes in the Yangchannuo 1 variety, we prepared a hybrid combination of Yangchannuo 1 and Wuxiangjing 5245 (variety right number: CNA20191002045) and constructed an F2 segregation population. From these, 30 plants with strong stems and large panicles and 30 plants without strong stems and large panicles were selected for mixing to construct a mixed pool of strong stems and large panicles and a mixed pool of non-strong stems and large panicles. We extracted DNA from the two extreme mixed pools of strong stems and large panicles and non-strong stems and large panicles from the two parents, Yangchannuo 1 and Wuxiangjing 5245, and their F2 segregation populations, and sent them to Shanghai Lingen Biotechnology Co., Ltd. for genome resequencing and QTLseq analysis. The analysis results showed that there was a significant QTL locus for strong stems and large panicles in the interval 28400000-28600000 of chromosome 3 ( Figure 1 ).

[0046] In order to further explore and utilize the gene resources of strong stems and large panicles, we used the second-generation genome resequencing technology to analyze and detect the sequence in the 28400000-28600000 interval of chromosome 3 of Yangchannuo No. 1 and compared it with the reference genome Nipponbare (genebank: AP014959.1) and analyzed the gene function annotation. The analysis results showed that there was a gene SCM3 in this interval that controls the diameter of rice stems. Further comparison and analysis of the SCM3 gene sequences in four varieties, Yangchannuo No. 1, Wuxiangjing 5245 and Nipponbare, revealed that there were two variant sites in this gene. One was located at base 28428731 (- / TGTG) on chromosome 3 of the rice reference genome MSU7.0, and the other was located at base 28430214 on chromosome 3 of the rice reference genome MSU7.0, a single base variation (G / T) 1206 bp downstream of ATG. The genotypes of the two variant sites in the SCM3 gene of the two strong-stem and large-spike varieties Yangchannuo No. 1 were consistent with the genotypes of the strong-stem and large-spike mixed pool in the above QTLseq analysis. Therefore, the SCM3 genotype with strong-stem and large-spike in Yangchannuo No. 1 was named SCM3 YCN1 (Table 2).

[0047] Table 1 Comparison of main agronomic traits of Yangchannuo 1, Nanjing 9108 and Nanjing 46

[0048]

[0049] Note: The last four columns in the table are the mean values ​​plus or minus the standard error of 9 biological replicates.

[0050] Table 2 Comparison of SCM3 genotypes of five varieties including Yangchannuo No. 1

[0051]

[0052] 2. Molecular marker development

[0053] Based on the TGTG / -variant site, we developed the molecular marker SCM3 using the primer design and development tool of Rice Variation Map v2.0 (http: / / ricevarmap.ncpgr.cn / primer_by_id / ) on the rice variation database website. YCN1 Indel-2 (Table 3). Based on the G / T variant site, the molecular marker SCM3 was developed using the SNP typing tool website http: / / www.snpway.com / of Wuhan Jingpeptide Biotechnology Co., Ltd. YCN1 _k_28430214 (Table 4). SCM3 YCN1 The indel-2 primers were designed to include two specific forward and reverse primers, SCM3 YCN1 The design of _k_28430214 primers includes two specific primers and one universal primer. The primer set sequences are shown in Tables 3 and 4:

[0054] Table 3 Molecular marker SCM3 YCN1 Primers for indel-2

[0055]

[0056] Table 4 Primers of molecular marker SCM3_k_28430214

[0057]

[0058] 3. Detection of molecular markers

[0059] The SNP site is detected by using KASP technology, and the indel site is detected by using PCR and polyacrylamide gel electrophoresis technology. The method includes the following steps:

[0060] S1. Extract genomic DNA from rice leaf tissues of Yangchannuo No. 1, Wuxiangjing 5245 (variety right number: CNA20191002045) and Nanjing 5718 (variety right number: CNA20171721.3, approval number: Sushendao 20210047);

[0061] S2, using the genomic DNA of Yangchannuo 1, Wuxiangjing 5245 and Nanjing 5718 as templates, the KASP reaction was detected using the primer combination SCM3_k_28430214; YCN1 _k_28430214Rc X The fluorescent linker sequence is a FAM fluorescent linker sequence, SCM3 YCN1_k_28430214Ra YThe fluorescent linker sequence is a HEX fluorescent linker sequence; the fluorescent linker sequence is a fluorescent linker sequence specified by the KASP reaction reagent. The PARMS mix (E001-1) of Wuhan Jingpeptide Biotechnology Co., Ltd. was selected and used. During primer synthesis, the FAM or HEX fluorescent linker sequence was connected to the 5' end of the two specific primers respectively. The specific amplification reaction system and conditions are shown in Tables 5 and 6.

[0062] Table 5 PCR amplification reaction system is as follows (PARMS mix Wuhan Jingpeptide)

[0063]

[0064] Table 6 PCR amplification reaction conditions are as follows (dual-head 384 PCR instrument ABI Gene Amp 9700)

[0065]

[0066] After PCR was completed, the fluorescence signal was read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal to obtain a clear and intuitive genotyping diagram (such as Figure 2 The genotype results are output according to different colors.

[0067] If SCM3 YCN1 The competitive allele specific polymerase chain reaction (KASP) was performed with the primer set _k_28430214. The samples after the reaction were detected by fluorescence on the microplate reader TECAN INFINITE F NANO +, and the genotyping results were obtained by the SNP automatic typing tool on the online website SNPWay (http: / / www.snpway.com / ) of Wuhan Jingpeptide Biotechnology Co., Ltd. The amplified samples were detected by fluorescence on the microplate reader TECAN INFINITE F NANO + as FAM fluorescence signals, and then the genotyping results obtained by the SNP automatic typing tool showed that the SNP site was base G, corresponding to Figure 2 If the blue dot is found, the rice sample is judged to be a homozygous scm3 genotype, and the rice plant shows non-strong stems and large panicles; the fluorescence detection of the amplified sample on the TECAN INFINITE F NANO+ microplate reader shows a HEX fluorescence signal, and then the genotyping result obtained by the SNP automatic typing tool shows that the SNP site is base T, corresponding to Figure 2 If there is a green dot, the rice sample is considered to be homozygous for SCM3 YCN1Genotype, rice plants show strong stems and large panicles; the amplified samples detected FAM and HEX fluorescence signals simultaneously on the TECAN INFINITE FNANO+ microplate reader, and then the genotyping results obtained by the SNP automatic typing tool showed that the SNP site was a G / T heterozygous base, corresponding to Figure 2 If the red dots are present, the rice sample is considered to be heterozygous for SCM3 YCN1 / scm3 genotype, rice plants show strong stems and large panicles (such as Figure 2 shown).

[0068] S3, using the genomic DNA of Yangchannuo 1, Wuxiangjing 5245 and Nanjing 5718 as templates, using SCM3 YCN1 The indel site was detected by PCR and acrylamide gel electrophoresis using the indel-2 primer combination; molecular marker detection was performed using the conventional laboratory polymerase chain reaction (PCR) amplification technology. The 10 μL reaction system included template DNA (about 15 ng μL -1 ) 1 μL, forward and reverse primers (forward and reverse primers in Table 3) 0.4 μL each (10 μmol L -1 ), 2×NGPCR MasterMix 5μL (Shanghai Huiling Biotechnology Co., Ltd., NG001M), and sterile double distilled water 3.2μL. Amplification was performed on a PCR instrument under the following reaction conditions: (1) 95℃, pre-denaturation for 5min; (2) 95℃, 30sec; 55℃, 30sec; 72℃, 30sec; 35 cycles in total; (3) 72℃ for another 10min. 3μL of the amplified PCR product was aspirated and spotted into the wells of an 8% polyacrylamide gel. After electrophoresis separation of the bands, silver staining with silver nitrate solution was performed, and the color was developed with NaOH solution, and the band size information was read.

[0069] If SCM3 YCN1 The indel-2 primer detected a 114 bp band, which means that the rice sample was homozygous for SCM3 YCN1 Genotype, characterized by strong stems and large ears; if SCM3 YCN1 The indel-2 primer detected a 110 bp band, which indicated that the rice sample was a homozygous scm3 genotype, with non-strong stems and large panicles. YCN1 Indel-2 primers detected both 114 bp and 110 bp bands, and the rice sample was judged to be heterozygous for SCM3 YCN1 / scm3 genotype. (e.g. Figure 3 shown).

[0070] The above experimental results show that the KASP-type molecular marker SCM3 we developed YCN1_k_28430214 and indel-type molecular marker SCM3 YCN1 Indel-2 can quickly, accurately and efficiently detect the superior allele SCM3 of the strong stem and large panicle variety Yangchannuo No. 1 YCN1 .SCM3 YCN1 _k_28430214, as a KASP type molecular marker, can accurately, quickly and efficiently detect the genotype of rice samples on a large scale, and can provide an efficient genotype identification and analysis tool for molecular marker-assisted selection breeding of high-yield and lodging-resistant rice. YCN1 Indel-2, as an indel-type molecular marker, can be completed in a simple molecular laboratory and can be used to detect a small amount of samples.

[0071] Example 2 Variety Resource Evaluation

[0072] We used the two molecular markers SCM3 developed in Example 1 YCN1 indel-2 and SCM3 YCN1 _k_28430214 SCM3 genotype analysis was performed on 42 rice varieties in Jiangsu Province (Table 7), including Yangchannuo 1. YCN1 indel-2 and SCM3 YCN1 _k_28430214 molecular marker detection and analysis methods and steps refer to Example 1.

[0073] The results of molecular marker analysis showed that there were 4 rice variety resources, namely Yangchannuo 1, Lianjing 15 and Sidao 20, and SCM3 YCN1 The indel-2 molecular marker was detected as a 114 bp fragment, which was a genotype containing TGTG insertion. YCN1 The _k_28430214 molecular marker detected the base T genotype. The query of the rice variation data website showed that the SNP site in the 3'UTR region of the SCM3 gene, located at the 28430214th base on the 3rd chromosome of the rice reference genome MSU7.0, 1206bp downstream of the ATG, accounted for only 0.7% of the 4726 rice germplasm resources, 0.5% of the 2759 indica rice germplasm resources, and only 1.1% of the 1512 japonica rice germplasm resources (https: / / ricevarmap.ncpgr.cn / vars_info / ). SCM3 YCN1 The T variation at the 1206bp downstream of ATG of SCM3 gene in Yangchannuo 1 detected by _k_28430214 molecular marker is highly specific in natural rice populations.

[0074] We conducted lodging resistance and yield trait analysis on the 42 rice varieties in Jiangsu Province (Table 7). The results showed that the stem bending strength of Yangchannuo No. 1 was ( Figure 4 ) and the diameter of the second node of the stem is ( Figure 5 ) is significantly higher than other varieties. The number of grains per ear of main stem is as follows: Figure 6 ) is significantly higher than other varieties, and the fruiting rate ( Figure 7 ) had no significant difference.

[0075] The above experimental results show that the SNP site in the 3' region of the SCM3 gene of Yangchannuo No. 1 (a single base variation, G / T, located at base 28430214 on chromosome 3 of the rice reference genome MSU7.0, 1206 bp downstream of ATG) is highly correlated with its strong stems and large panicles and has significant specificity. YCN1 _k_28430214 The detection and analysis of the offspring of the breeding population prepared with Yangchannuo No. 1 as the donor parent can efficiently, quickly and accurately identify the excellent allele type SCM3 YCN1 , accelerating the breeding of new high-yield and lodging-resistant rice varieties.

[0076] Table 7 Molecular marker information and lodging resistance and yield traits of 42 rice varieties

[0077]

[0078]

[0079] Example 3

[0080] Yangchannuo No. 1 (Gan Shen Rice 20190032) has the best comprehensive agronomic performance in terms of stem bending resistance, number of grains per panicle, number of panicles, etc., and is an excellent donor parent for hybrid breeding of high-yield and lodging-resistant varieties. We selected the high-quality and delicious fragrant rice variety Wuxiangjing 5245 (variety right number: CNA20191002045) as the male parent and combined it with Yangchannuo No. 1 to construct a breeding segregation population. In March 2021, the hybrid F1 of Yangchannuo No. 1 × Wuxiangjing 5245 was obtained through hybridization in Hainan. From June to October 2021, the F1 plants of the combination of Yangchannuo No. 1 × / Wuxiangjing 5245 were planted in Yangzhou, and the F2 seeds were harvested. In December 2021, the F2 seeds of the combination of Yangchannuo No. 1 × / Wuxiangjing 5245 were planted in Hainan to obtain individual plants of the F2 population. In the F2 population, we used SCM3 YCN1 The SCM3 genotypes of 300 plants were analyzed by molecular marker _k_28430214, and 32 homozygous SCM3 YCN1The genotyped individual plants were harvested and planted in Yangzhou from June to October 2022; 25 days after the plants reached full heading, 5 rice plants with uniform growth were selected for determination of stem bending resistance and stem diameter. The SCM3 genotype detection method and steps of Yangchannuo No. 1×Wuxiangjing 5245F2 plants refer to Example 1. The SCM3 genotype detection results of Yangchannuo No. 1×Wuxiangjing 5245F2 plants are shown in Figure 8 , Fig. 9 and Fig.10 As shown. Yangchannuo No. 1×Wuxiangjing 5245F2:3 SCM3 YCN1 The _k_28430214 molecular marker detected that the stem bending resistance of the strain with T base was significantly higher than that of the strain with G base. Figure 8 As shown. Yangchannuo No. 1×Wuxiangjing 5245F2:3 SCM3 YCN1 The diameter of the second internode of the stem of the strain with T base detected by _k_28430214 molecular marker was significantly larger than that of the strain with G base. Fig. 9 As shown. Yangchannuo No. 1×Wuxiangjing 5245F2:3 SCM3 YCN1 The number of grains per ear on the main stem of the strain with T base detected by _k_28430214 molecular marker was significantly higher than that of the strain with G base. Fig.10 shown.

[0081] The above results show that the molecular marker SCM3 provided by the present invention is used YCN1 _k_28430214 can effectively screen out rice lines with high stalk strength and large panicle shape from the offspring of Yangchannuo 1×Wuxiangjing 5245 segregating population ( Figure 8 , Fig. 9 and Fig.10 ), can be applied to molecular marker-assisted selection breeding of high-yield and lodging-resistant rice to improve breeding efficiency.

[0082] Example 4

[0083] Yangchannuo No. 1 (Gan Shen Rice 20190032) has the best comprehensive agronomic performance in terms of stem bending resistance and number of grains per panicle, and is an excellent donor parent for hybrid breeding of high-yield and lodging-resistant varieties. We selected the high-yield and high-quality taste variety Nanjing 5718 (variety right number: CNA20171721.3) as the male parent and combined it with Yangchannuo No. 1 to construct a breeding segregation population. In August 2021, the hybrid F1 of Yangchannuo No. 1 / Nanjing 5718 was obtained through hybridization in Yangzhou. From December 2022 to April 2023, the F1 plants of the combination of Yangchannuo No. 1 / Nanjing 5718 were planted in Hainan, and the F2 seeds were harvested. From June to October 2023, the F2 seeds of the combination of Yangchannuo No. 1 / Nanjing 5718 were planted in Yangzhou to obtain individual plants of the F2 population. In the F2 population, we used SCM3 YCN1The SCM3 genotype of 200 plants was detected by _k_28430214 molecular marker, and 30 SCM3 YCN1 Homozygous genotype individual plants were harvested and planted in Hainan from December 2023 to April 2024; 25 days after the plants headed, 5 rice plants with uniform growth were selected for stalk bending resistance and stalk diameter determination. The SCM3 genotype detection method and steps of the F2 generation plants of Yangchannuo No. 1 / Nanjing 5718 refer to Example 1.

[0084] The results of SCM3 genotype detection of Yangchannuo 1 / Nanjing 5718 F2 plants are as follows Fig.11 , Fig.12 and Fig.13 As shown. Yangchannuo No. 1 / Nanjing 5718F2:3 SCM3 YCN1 The _k_28430214 molecular marker detected that the stem bending resistance of the strain with T base was significantly higher than that of the strain with G base. Fig.10 As shown. Yangchannuo No. 1 / Nanjing 5718F2:3 SCM3 YCN1 The diameter of the second internode of the stem of the strain with T base detected by _k_28430214 molecular marker was significantly larger than that of the strain with G base. Fig.12 As shown. Yangchannuo No. 1 / Nanjing 5718F2:3 SCM3 YCN1 The number of grains per ear on the main stem of the strain with T base detected by _k_28430214 molecular marker was significantly higher than that of the strain with G base. Fig.13 shown.

[0085] The above results show that the molecular marker SCM3 provided by the present invention is used YCN1 _k_28430214 can effectively screen out rice lines with high stalk strength and large panicle type in the offspring of Yangchannuo 1 / Nanjing 5718 segregating population ( Fig.11 , Fig.12 and Fig.13 ), can be applied to molecular marker-assisted selection breeding of high-yield and lodging-resistant rice to improve breeding efficiency.

Claims

1. A rice genotype SCM3 with strong stems and large panicles YCN1 A molecular marker characterized in that The molecular marker is SCM3 YCN1 _k_28430214, SCM3 YCN1 The nucleic acid variation site detected by _k_28430214 is located at the 28430214th base on chromosome 3 of the rice reference genome MSU7.0, and the base is T or G.

2. Detection of the rice strong stem and large panicle superior genotype SCM3 according to claim 1 YCN1 A primer set for molecular labeling, characterized in that: The primer set includes specific primer pairs as follows: SCM3 YCN1 _k_28430214Rc X:GGAGTTCGATCTTAGTGCCGTAC; SCM3 YCN1 _k_28430214Ra Y:GGAGTTCGATCTTAGTGCCGTAA。 3. The primer set according to claim 2, characterized in that The primer set also includes a universal primer as follows: AGGATCAGTGGGAGCTCGG.

4. The primer set according to claim 2, characterized in that The specific primers are connected to different fluorescent linker sequences respectively, and the fluorescent linker sequences are FAM or HEX fluorescent linker sequences.

5. A kit for detecting SNP molecular markers of the strong stem and large panicle gene SCM3, characterized in that: The kit comprises the primer set according to any one of claims 2 to 4.

6. Use of the primer set according to any one of claims 3 to 4 or the kit according to claim 5 in identifying, screening or breeding rice with strong stems and large panicles.

7. A method for obtaining a rice variety with strong stems and large panicles, characterized in that: The method comprises making the base at the 28430214th base on the third chromosome of the rice reference genome MSU7.0 of the rice be T.

8. A method for detecting the rice strong stem and large panicle gene SCM3, characterized in that: The following steps are involved: 1) Extracting genomic DNA from rice samples; 2) Using rice genomic DNA as a template, using the primer set described in any one of claims 3 to 4 or the primer set described in the kit described in claim 5 to PCR amplify SCM3 YCN1 _k_28430214 molecular marker was used to perform KASP reaction; 3) The samples after the reaction were subjected to fluorescence detection on an ELISA instrument, and the genotyping results were obtained by the SNP automatic typing tool. The fluorescence detection of the amplified samples on the ELISA instrument was a FAM fluorescence signal, and the genotyping results obtained by the SNP automatic typing tool subsequently showed that the SNP site was base G, and the rice sample was judged to be a homozygous scm3 genotype, and the rice plants showed non-strong stems and large panicles; the fluorescence detection of the amplified samples on the ELISA instrument was a HEX fluorescence signal, and the genotyping results obtained by the SNP automatic typing tool subsequently showed that the SNP site was base T, and the rice sample was judged to be a homozygous SCM3 YCN1 Genotype, rice plants show strong stems and large panicles; the amplified sample detected FAM and HEX fluorescence signals on the microplate reader at the same time, and then the genotyping result obtained by the SNP automatic typing tool showed that the SNP site was heterozygous for base G / T, so the rice sample was judged to be heterozygous SCM3 YCN1 / scm3 genotype, the rice plants show strong stems and large panicles.

9. The method for detecting the rice strong stem and large panicle gene SCM3 according to claim 8, characterized in that: The amplification reaction system of the KASP reaction in step 2) comprises: a DNA template, a PARMS master mix, the primer set according to claim 2 or 3, ddH2O and mineral oil.

10. The method for detecting the rice strong stem and large panicle gene SCM3 according to claim 8, characterized in that: The PCR amplification reaction conditions are as follows:

Images