Molecular marker of wheat scab resistance gene ta wrky57 and application thereof

By developing the molecular markers WGRB4579-F and WGRB4579-R for the wheat ergot resistance gene TaWRKY57, the problem of insufficient genetic resources in existing technologies was solved, and rapid and accurate screening of disease-resistant varieties and improved breeding efficiency were achieved.

CN119307647BActive Publication Date: 2025-10-14NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411696001.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-25
Publication Date
2025-10-14
Estimated Expiration
2044-11-25

AI Technical Summary

Technical Problem

The existing genetic resources for wheat resistance to ergot are limited, and there is a lack of tightly linked or diagnostic molecular markers, resulting in low breeding efficiency and difficulty in effectively screening and identifying disease-resistant varieties.

Method used

The molecular marker primer pair WGRB4579-F and WGRB4579-R was developed for detecting the candidate gene TaWRKY57 of the wheat ergot resistance gene Qfhi.nau-5B. Through PCR amplification and restriction enzyme digestion, diagnosis was performed using 126bp, 135bp and 182bp enzyme-digested fragments to achieve close linkage detection with Qfhi.nau-5B.

Benefits of technology

It provides a rapid and accurate method to identify plants carrying the Qfhi.nau-5B gene, improves breeding selection efficiency, reduces costs, and can screen out disease-resistant varieties at the seedling stage, reducing environmental impact and supporting the breeding of disease-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119307647B_ABST
    Figure CN119307647B_ABST
Patent Text Reader

Abstract

The application belongs to the field of crop breeding, and discloses a wheat scab resistance gene TaWRKY57 molecular marker and application thereof. The application discloses a CAPS marker primer pair of a wheat scab resistance gene Qfhi.nau-5B candidate gene TaWRKY57, including WGRB4579-F and WGRB4579-R. After PCR amplification and enzyme cutting of wheat variety genome DNA using the primer pair, if specific fragments with sizes of 126bp, 135bp and 182bp are obtained, it is proved that the material carries the scab resistance gene TaWRKY57. The marker involved in the application has the characteristics of rapidness, accuracy and high efficiency, can be used to determine the presence and state of Qfhi.nau-5B, predict the scab resistance of wheat, and provide a molecular marker assisted means for rapidly screening plants carrying Qfhi.nau-5B and breeding of disease resistant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of crop breeding, and relates to a molecular marker for detecting a wheat scab resistance gene Qfhi.nau-5B candidate gene TaWRKY57 and application thereof. BACKGROUND

[0002] Wheat scab caused by the facultative pathogen Fusarium graminearum is one of the most important diseases in wheat production, which not only causes severe yield loss, but also leads to grain quality decline and produces deoxynivalenol (DON) and other mycotoxins in the grain, which are harmful to human and animal health (Kazan et al. 2018). In recent years, with the effects of global warming and changes in farming practices, wheat scab has become more prevalent (Savary et al. 2019). In China, the area of wheat scab has increased from an average of about 60 million mu per year from 2001-2010 to an average of about 73 million mu per year from 2011-2020, an increase of 21.7% in ten years, causing annual direct economic losses of tens of billions of yuan, and has become the most serious disease affecting wheat production in China. Breeding varieties with stable and durable resistance to scab is the most economical and effective means to prevent and control scab and reduce the damage caused by scab.

[0003] Exploring and utilizing disease resistance genes to breed disease-resistant varieties can effectively reduce the damage of scab to wheat production. However, there are not many genes available at present, and only Fhb1, Fhb2, Fhb4, Fhb5, etc. have been applied in breeding in common wheat, and most of the QTLs lack closely linked or diagnostic molecular markers and have not been applied (Ma et al. 2020). Qfhi.nau-5B is a scab resistance QTL located in the WMC75-BARC142 interval of chromosome 5B, which can explain 8.8% of the phenotypic variation (Li et al. 2008). Cloning of the candidate gene of this QTL and developing molecular markers can provide important gene resources and technical support for scab resistance molecular breeding. SUMMARY

[0004] The purpose of the present application is to provide a diagnostic molecular marker for detecting the wheat scab resistance gene Qfhi.nau-5B candidate gene TaWRKY57 to overcome the shortcomings of the prior art.

[0005] Another purpose of the present application is to provide the application of the molecular marker of the Qfhi.nau-5B candidate gene TaWRKY57.

[0006] To solve the above technical problems, the technical solutions adopted by the present application are as follows:

[0007] In a first aspect, the present application protects a primer pair of a molecular marker for detecting a candidate gene TaWRKY57 of a wheat scab resistance gene Qfhi.nau-5B:

[0008] WGRB4579-F: CCCATGTCAAAGGAAACG, as shown in SEQ ID NO. 1, WGRB4579-R: TTCGGGGTATATGCATACG, as shown in SEQ ID NO. 2.

[0009] In a second aspect, the present application protects a molecular marker for detecting a candidate gene TaWRKY57 of a wheat scab resistance gene Qfhi.nau-5B:

[0010] The genomic DNA of a wheat variety is amplified by using the primer pair WGRB4579-F: SEQ ID NO. 1, WGRB4579-R: SEQ ID NO. 2, and the amplified product is digested by a restriction enzyme, if the digested fragments are 126 bp, 135 bp and 182 bp, it is a diagnostic molecular marker WGRB4579 for the candidate gene TaWRKY57 of the wheat scab resistance gene Qfhi.nau-5B, which is a co-dominant marker, tightly linked to Qfhi.nau-5B, and the genetic distance between the marker and the Qfhi.nau-5B gene is 0 cM, measured by Mapmaker Macintosh V 3.0.

[0011] In a third aspect, the present application further protects a reagent containing the primer pair described above, and / or the molecular marker described above.

[0012] In a fourth aspect, the present application further protects a kit containing the primer pair described above, and / or the molecular marker described above, and / or the reagent described above.

[0013] In a fifth aspect, the present application further protects the use of the primer pair described above, and / or the molecular marker described above, and / or the reagent described above, and / or the kit described above in the identification of the wheat scab resistance gene Qfhi.nau-5B in wheat germplasm resources.

[0014] In a sixth aspect, the present application further protects the use of the primer pair described above, and / or the molecular marker described above, and / or the reagent described above, and / or the kit described above in the preparation of a product for identifying the wheat scab resistance gene Qfhi.nau-5B in wheat germplasm resources.

[0015] In specific embodiments, the product is a system containing the primer pair of claim 1, and / or the molecular marker of claim 2, and / or the reagent of claim 3, and / or the kit of claim 4.

[0016] In a seventh aspect, the present application also protects a molecular marker method of the wheat scab resistance gene Qfhi.nau-5B, wherein the wheat genomic DNA to be detected is amplified by PCR using the primer pair WGRB4579-F and WGRB4579-R of the molecular marker WGRB4579, and the amplified product is digested by a restriction enzyme, and if the digested fragments are 126 bp, 135 bp and 182 bp, it indicates that the wheat to be detected has the wheat scab resistance gene Qfhi.nau-5B.

[0017] In an eighth aspect, the present application also protects the use of the primer pair described above, and / or the molecular marker described above, and / or the reagent described above, and / or the kit described above in screening wheat materials with resistance to scab.

[0018] In a specific embodiment, the wheat genomic DNA to be detected is amplified by PCR using the primer pair described above, and the amplified product is digested by a restriction enzyme, and if the digested fragments are 126 bp, 135 bp and 182 bp, it indicates that the wheat to be detected is a wheat with resistance to scab and having the wheat scab resistance gene Qfhi.nau-5B.

[0019] In a ninth aspect, the present application also protects the use of the primer pair described above in cloning the wheat scab resistance gene TaWRKY57.

[0020] In a tenth aspect, the present application also protects the use of the primer pair described above, and / or the molecular marker described above, and / or the reagent or kit described above in breeding wheat with resistance to scab.

[0021] The molecular marker of the wheat scab resistance gene TaWRKY57 described above is obtained by the following method:

[0022] (I) Wangshuibai and its recurrent parent PH691 BC3F 2:3 Creation of the population and screening of the Qfhi.nau-5B segment recombinants:

[0023] (1) Wangshuibai (♀) is crossed with wheat variety PH691 (♂) to obtain hybrid F1, F1 is backcrossed with PH691 for three generations, and selfing produces a BC3F2 population;

[0024] (2) The heterozygous single plants with recombination in the segment in the BC3F2 population are screened using the boundary markers of Qfhi.nau-5B, and the homozygous single plants with recombination in the segment in the BC3F3 generation are screened using the same markers.

[0025] (II) Identification of the disease resistance phenotype of the recombinants

[0026] (3) About ten days before flowering, the recombinant wheat kernels were sown in the field for inoculation, and the inoculation was repeated one week later. Fifteen days after inoculation, the diseased spikelet rate was investigated to evaluate the resistance of the recombinant wheat kernels.

[0027] (3) Molecular marker analysis

[0028] (4) The DNA of the disease-resistant parent Wangshuibai, the disease-susceptible parent PH691, and each individual plant in the F2 population was extracted using the SDS method; molecular markers were developed using sequences located on chromosome 5B of the Chinese Spring reference genome, and polymorphism analysis and specificity analysis were performed on Wangshuibai and PH691.

[0029] (5) Select molecular markers that are polymorphic between the parents, amplify them in the F2 generation population to obtain the genotype data of each individual plant in the population, and use these markers to detect the genotype of each individual plant in the F3 family of heterozygous recombinant offspring;

[0030] The PCR reaction system was 12.5 μl, including 10× buffer 1.25 μl, 25 mM MgCl2 0.75 μl, 2.5 mM dNTPs 1 μl, 0.2 μM each of the left and right primers, 0.1 μl of Taq enzyme (5 u / μl), 10 ng of template DNA, and water was added to 12.5 μl;

[0031] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 sec, annealing at 55°C for 40 min, extension at 72°C for 30 min, 36 cycles, and a final extension at 72°C for 10 min; PCR amplification was performed on a PE9600 thermal amplification instrument.

[0032] The enzyme digestion reaction system was 10 μl, including 1 μl of 10× buffer, 0.1 μl of NIalll restriction endonuclease (5u / μl), 4 μl of PCR product, and water was added to 10 μl.

[0033] The enzyme-digested products were separated by electrophoresis on 8% non-denaturing polyacrylamide gel, and then photographed on a UV transilluminator to record the results.

[0034] (4) Obtaining the positioning interval

[0035] (6) According to the law of linkage exchange, combined with the genotype data of each individual plant in the F2 generation population and the field disease resistance phenotype of the heterozygous recombinant F3 family, the genetic linkage map of Wangshuibai Qfhi.nau-5B was constructed using the software Mapmaker Macintosh V3.0, and the positioning interval of Qfhi.nau-5B was narrowed down to between the molecular markers WMC75 and WGRB4677.

[0036] (V) Development and validation of TaWRKY57-CAPS markers

[0037] (7) Through the prediction and sequence alignment analysis of disease resistance candidate genes in the positioning interval, combined with the RNA-seq data and resequencing data of Wangshuibai and PH691 spike-inoculated Gibberellic fungi, WRKY 57 was selected as the candidate gene of Qfhi.nau-5B.

[0038] (VI) Development and verification of markers

[0039] Based on the difference in SNPs in the TaWRKY57 coding region, a CAPS marker was developed and named WGRB4579. The marker includes forward primers WGRB4579-F, as shown in SEQ ID NO.1, and WGRB4579-R, as shown in SEQ ID NO.2. Based on the linkage exchange rule, combined with the genotype data of each individual plant in the F2 generation population and the field disease resistance phenotype of the heterozygous recombinant F3 family (Table 1), a genetic linkage map of Wangshuibai Qfhi.nau-5B was constructed using the software Mapmaker Macintosh V3.0. It was confirmed that the molecular marker WGRB4579 co-segregates with the Qfhi.nau-5B gene. The band pattern amplified by the WGRB4579 molecular marker primers is shown in Figure 1. Figure 2 .

[0040] Beneficial effects

[0041] The present invention has developed a molecular marker, WGRB4579, for detecting the Qfhi.nau-5B candidate gene, TaWRKY57. Further experiments have demonstrated that the marker can be used for molecular marker-assisted selection breeding for Fusarium head blight resistance. This invention provides a valuable tool for accelerating the effective utilization of Qfhi.nau-5B in breeding.

[0042] 1. We obtained the diagnostic molecular marker WGRB4579 for the Qfhi.nau-5B candidate gene TaWRKY57, which can help transfer this gene to promoted varieties and aggregate it with other disease-resistant genes.

[0043] 2. Easy identification. This co-dominant marker offers advantages such as easy detection and stable amplification. Using marker WGRB4579, the presence and status of Qfhi.nau-5B can be determined, and wheat resistance to fusarium head blight can be predicted. This allows for rapid screening of plants carrying Qfhi.nau-5B and the breeding of disease-resistant varieties. Furthermore, laboratory testing using this molecular marker can mitigate environmental influences on varieties.

[0044] 3. Improve the selection efficiency of disease-resistant varieties and save costs. Traditional breeding of resistance to scab is time-consuming, difficult and costly. By detecting the diagnostic molecular marker of the Qfhi.nau-5B gene, single plants carrying the Qfhi.nau-5B gene can be identified at the seedling stage, and non-target plants can be eliminated, greatly reducing the phenotypic identification work, saving breeding costs, and improving the selection efficiency of disease-resistant varieties.

[0045] 4. Can be used for cloning of the Qfhi.nau-5B gene. The premise of map-based cloning of the Qfhi.nau-5B gene is the determination of the candidate gene. WRKY57 is the main candidate gene of Qfhi.nau-5B after expression analysis, sequence analysis, and natural population verification. BRIEF DESCRIPTION OF DRAWINGS

[0046] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the description of the specific embodiments will be briefly introduced.

[0047] Figure 1 Genetic linkage map of the position of the Qfhi.nau-5B QTL on the 5BL chromosome and the marker WGRB4579 of the present application. The right side of the figure is the marker, and the left side is the genetic distance between the markers.

[0048] Figure 2 WGRB4579 amplification band pattern. M is PUC19 / Mspl, and the left side is the molecular weight marker band size (bp). 1 is Wangshuibai, 2 is PH691, 1, 3, 4, 7, 8, 11 are disease-resistant genotypes, and 2, 5, 6, 9, 10, 12 are disease-susceptible genotypes. The arrow indicates the disease-resistant allele-specific cleavage band.

[0049] Figure 3 Qfhi.nau-5B near-isogenic lines and their recurrent parent PH691 in different environments. 5B-R35 and 5B-R37 are near-isogenic lines of Qfhi.nau-5B. *, ** represent significant differences at P = 0.01, 0.001 levels compared with the recurrent parent. DETAILED DESCRIPTION

[0050] The application will be further described in detail below with reference to the examples. The following examples are only used to more clearly illustrate the technical solutions of the application, and therefore are only examples, and cannot be used to limit the protection scope of the application. If the manufacturers of the reagents or apparatuses used are not indicated, the reagents or apparatuses are all regarded as conventional products that can be purchased in the market. As a professional agricultural research institution, the applicant has long-term preserved relevant germplasm materials, and the relevant wheat varieties are all publicly available in the market or in the existing germplasm library.

[0051] Example 1: Obtaining of molecular marker of wheat scab resistance gene TaWRKY57

[0052] (I) Wengshuibai and its recurrent parent PH691 BC3F 2:3 Creation of population and screening of Qfhi.nau-5B segment recombinants:

[0053] (1) Wengshuibai (♀) and wheat variety PH691 (♂) were crossed to obtain hybrid F1, F1 was backcrossed with PH691 for three generations, and selfing produced a BC3F2 population comprising 461 single plants;

[0054] (2) 69 heterozygous single plants with recombination in the segment were screened by using boundary markers WMC75 and BARC42 of Qfhi.nau-5B, and 13 homozygous recombinants were further screened in the offspring of part of the heterozygous recombinants, and genotype analysis showed that the recombinants could be divided into 7 recombination types.

[0055] (II) Identification of disease resistance phenotype of recombinants

[0056] The homozygous recombinants were inoculated with diseased kernels in the field about ten days before flowering, and the inoculation was repeated once a week later. The rate of diseased spike was investigated 15 days after inoculation, and the rate of diseased kernels was investigated after harvesting. The identification results showed that the resistance of the recombinants was obviously separated, and the lines carrying Qfhi.nau-5B gene had significantly improved resistance compared with the susceptible parent (Table 1).

[0057] (III) Screening of polymorphic molecular markers and genotype analysis of recombinants

[0058] (1) The developed markers were screened for polymorphism in Wengshuibai and PH691, and finally two molecular markers with polymorphism in the parents, i.e., GWM408 and WGRB4677, were obtained.

[0059] (2) The homozygous recombinants were analyzed for genotype by using the molecular markers GWM408 and WGRB4677 with polymorphism in the parents.

[0060] The PCR reaction system was 12.5 μl, including 10× buffer 1.25 μl, 25 mM MgCl2 0.75 μl, 2.5 mM dNTPs 1 μl, 0.2 μM each of the left and right primers, 0.1 μl of Taq enzyme (5 u / μl), 10 ng of template DNA, and water was added to 12.5 μl;

[0061] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 30 sec, 36 cycles, and finally extension at 72°C for 10 min; PCR amplification was performed on a PE9600 thermal amplification instrument.

[0062] The enzyme digestion reaction system was 10 μl, including 1 μl of 10× buffer, 0.1 μl of NIalll restriction endonuclease (5u / μl), 4 μl of PCR product, and water was added to 10 μl.

[0063] The enzyme-digested products were separated by electrophoresis on 8% non-denaturing polyacrylamide gel, and then photographed on a UV transilluminator to record the results.

[0064] (IV) Qfhi.nau-5B positioning interval acquisition

[0065] A genetic linkage map of Wangshuibai Qfhi.nau-5B was constructed using Mapmaker Macintosh V3.0 software. According to the rules of linkage exchange, combined with the genotype data of each individual plant in the F2 generation population and the field disease resistance phenotype of the heterozygous recombinant F3 family (Table 1), Qfhi-nau-5B was precisely located between the markers WMC75 and WGRB4677.

[0066] (V) Prediction and sequence alignment of disease resistance candidate genes within the localization interval

[0067] Prediction and sequence alignment of candidate disease-resistance genes within the localization interval revealed the presence of a disease-resistance gene, WRKY57, in the region. Analysis of RNA-seq data from Wangshuibai and PH691 spikelets inoculated with Gibberella revealed upregulation in Wangshuibai at twice the level of PH691. Comparison of next-generation sequencing data from Wangshuibai and PH691 revealed variation in both the promoter and coding regions. WRKY57, a key transcription factor, participates in multiple resistance responses. It may contribute to Arabidopsis resistance to Botrytis cinerea by influencing the expression of genes with jasmonic acid ZIM domains. Therefore, WRKY57 was identified as the primary candidate gene for Qfhi.nau-5B, and the CAPS marker WGRB4579 was developed based on the coding region sequence variation (G / A at position 763).

[0068] Table 1 Wangshuibai-PH691 BC3F 2:3Genotypes and phenotypes of homozygous recombinants in the population

[0069]

[0070] *Indicates significant difference compared with other recombinant types at the 0.05 level

[0071] Example 2 Verification of molecular markers of wheat scab resistance gene TaWRKY57 in wheat variety populations

[0072] Genotyping of 279 wheat germplasm accessions from different wheat regions in my country using the WGRB4579 molecular marker revealed 125 accessions carrying the TaWRKY57 resistance haplotype, while 154 accessions did not. Phenotypic analysis of resistance in 2016 and 2024 revealed that the average diseased spikelet rates for accessions without the TaWRKY57 resistance haplotype were 43.1% and 22.3%, respectively, while those carrying the TaWRKY57 resistance haplotype had average diseased spikelet rates of 32.3% and 16.0%, respectively, indicating significant differences in resistance between the two groups. Compared with accessions without the TaWRKY57 resistance haplotype, accessions carrying the TaWRKY57 resistance haplotype had diseased spikelet rates reduced by 25.1% and 28.3%, respectively. This confirms a significant correlation between the WGRB4579 marker and Fusarium head blight resistance.

[0073] Example 3 Application of molecular markers in wheat breeding for resistance to scab

[0074] Using the WGRB4579 molecular marker, Qfhi.nau-5B was foreground selected from a BC3F2 population of 19 individuals derived from a cross between Wangshuibai (♀) and PH691 (♂). Four individuals homozygous for the Wangshuibai genotype in the Qfhi.nau-5B region were selected for background reversion. A total of 96 pairs of SSR markers distributed across 21 chromosomes were selected to test the background reversion of these individuals. Ultimately, two individuals with background reversion rates of 97% and 98%, respectively, were selected for self-pollination to obtain the near-isogenic lines 5B-R-3 and 5B-R-5. The constructed near-isogenic lines were evaluated for resistance to ergot infection under two environments (see Example 1). The results showed that the constructed near-isogenic lines had significantly improved disease resistance. Compared with the susceptible control PH691, the near-isogenic lines could reduce the diseased spikelet rate by 25.3-41.7%. This indicates that the WGRB4579 molecular marker can be effectively used to select the ergot resistance gene Qfhi.nau-5B, and has great application value in breeding applications.

[0075] The primer sequences involved in the experiment are as follows:

[0076] The left primer of WGRB4579, WGRB4579-F, is CCCATGTCAAAGGAAACG, as shown in SEQ ID NO: 1. The right primer of WGRB4579, WGRB4579-R, is TTCGGGGTATATGCATACG, as shown in SEQ ID NO: 2. The left primer of WMC75, WMC75-F, is GTCCGCCGCACACATCTTACTA, as shown in SEQ ID NO: 3. The right primer of WMC75, WMC75-R, is GTTTGATCCTGCGACTCCCTTG, as shown in SEQ ID NO: 4. The left primer of GWM408, GWM408-F, is TCGATTTATTTGGGCCACTG, as shown in SEQ ID NO: 5. The right primer of GWM408, GWM408-R, is GTATAATTCGTTCACAGCACGC, as shown in SEQ ID NO: 6. The left primer of WGRB4677, WGRB4677-F: CCAAACCCCAAGGTCTCG, as shown in SEQ ID NO: 7. The right primer of WGRB4677, WGRB4677-R: TGGTGACATAGGGGGAAAAT, as shown in SEQ ID NO: 8.

[0077] The left primer of BARC142, BARC142-F, is: CCGGTGAGAGGACTAAAA, as shown in SEQ ID NO: 9. The right primer of BARC142, BARC142-R, is: GGCCTGTCAATTATGAGC, as shown in SEQ ID NO: 10.

[0078] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the appended claims.

Claims

1. A wheat scab-resistance gene Qfhi.nau-5B The invention relates to a primer pair for molecular marker of candidate gene TaWRKY57 for screening wheat resistance to scab, characterized in that: The primer pair is as follows: WGRB4579-F: as shown in SEQ ID NO.1, WGRB4579-R: as shown in SEQ ID NO.2, the primer pair is used to PCR amplify the wheat genomic DNA to be tested, and the amplified product is digested with restriction endonuclease NIalll. The digested fragments are 126bp, 135bp and 182bp, indicating that the wheat to be tested has the scab resistance gene Qfhi.nau-5B The enzyme-cut fragments of the wheat resistant to scab are 182bp and 261bp, which indicates that the wheat to be tested does not have the scab-resistant gene. Qfhi.nau-5B of wheat resistant to ergot.

2. The use of a reagent containing the primer pair described in claim 1 in screening wheat for resistance to scab, wherein the primer pair is used to PCR amplify the genomic DNA of the wheat to be tested, and the amplified product is digested with the restriction endonuclease NIal11. The digested fragments are 126 bp, 135 bp and 182 bp, indicating that the wheat to be tested has the scab resistance gene Qfhi.nau-5B The enzyme-cut fragments of the wheat resistant to scab are 182bp and 261bp, which indicates that the wheat to be tested does not have the scab-resistant gene. Qfhi.nau-5B of wheat resistant to ergot.

3. The use of a kit containing the primer pair described in claim 1 in screening wheat for resistance to scab, wherein the primer pair is used to PCR amplify the genomic DNA of the wheat to be tested, and the amplified product is digested with the restriction endonuclease NIal11. The digested fragments are 126 bp, 135 bp and 182 bp, indicating that the wheat to be tested has the scab resistance gene. Qfhi.nau-5B The enzyme-cut fragments of the wheat resistant to scab are 182bp and 261bp, which indicates that the wheat to be tested does not have the scab-resistant gene. Qfhi.nau-5B of wheat resistant to ergot.

4. The use of the primer pair described in claim 1 in wheat breeding for resistance to scab, characterized in that: The genomic DNA of wheat to be tested was amplified by PCR using the primers, and the amplified product was digested with restriction endonuclease NIalll. The digested fragments were 126bp, 135bp and 182bp, indicating that the wheat to be tested had the scab resistance gene. Qfhi.nau-5B The enzyme-cut fragments of the wheat resistant to scab are 182bp and 261bp, which indicates that the wheat to be tested does not have the scab-resistant gene. Qfhi.nau-5B of wheat resistant to ergot.

5. Use of a reagent containing the primer pair described in claim 1 in wheat breeding for resistance to scab, wherein the primer pair is used to PCR amplify the genomic DNA of the wheat to be tested, and the amplified product is digested with the restriction endonuclease NIal11. The digested fragments are 126 bp, 135 bp and 182 bp, indicating that the wheat to be tested has the scab-resistant gene. Qfhi.nau-5B The enzyme-cut fragments of the wheat resistant to scab are 182bp and 261bp, which indicates that the wheat to be tested does not have the scab-resistant gene. Qfhi.nau-5B of wheat resistant to ergot.

6. Use of a kit containing the primer pair described in claim 1 in wheat breeding for resistance to scab, wherein the primer pair is used to PCR amplify the genomic DNA of the wheat to be tested, and the amplified product is digested with the restriction endonuclease NIal11. The digested fragments are 126 bp, 135 bp, and 182 bp, indicating that the wheat to be tested has the scab-resistant gene. Qfhi.nau-5B The enzyme-cut fragments of the wheat resistant to scab are 182bp and 261bp, which indicates that the wheat to be tested does not have the scab-resistant gene. Qfhi.nau-5B of wheat resistant to ergot.

Citation Information

Patent Citations

  • Molecular marker of wheat gibberellic disease resistance gene Fhb8 and application of molecular marker

    CN116144825A

  • DCAPS molecular marker co-separated with wheat gibberellic disease resistance gene Fhb5 and application thereof

    CN117660684A