CAPS molecular marker for rapidly screening herbicide-resistant rice and application of CAPS molecular marker

Abstract

The invention relates to the technical field of rice screening molecular markers, in particular to a CAPS molecular marker for rapidly screening herbicide-resistant rice and application of the CAPS molecular marker. In an optional embodiment, the invention provides a CAPS molecular marker for rapidly screening herbicide-resistant rice. The CAPS molecular marker comprises an SNP (Single Nucleotide Polymorphism) site and a primer, wherein the SNP site is positioned at the 6155th site on a nucleotide sequence as shown in SEQ ID NO.3, and the basic group of the SNP site is T; the primer corresponds to the SNP site; the primer comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer from the 5'end to the 3 'end is as shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer from the 5' end to the 3 'end is as shown in SEQ ID NO.2. According to the primer, the herbicide-resistant rice germplasm can be identified and screened rapidly, efficiently and accurately, the whole screening process can be completed within one day, and the primer is short in time consumption, high in efficiency, low in cost and easy to operate.

Description

Technical Field

[0001] The invention relates to the technical field of rice screening molecular markers, and in particular to a CAPS molecular marker for rapid screening of herbicide-resistant rice and an application thereof. Background Art

[0002] Rice is an important food crop in my country and even in the world, and weeds are one of the key factors threatening the safe production of rice. Weeds and rice have long coexisted, seriously affecting the growth of rice. The annual loss of rice due to weed damage can reach 15%-20%. With the rapid development of mechanical direct seeding technology of rice in recent years, the harm of weeds to rice growth has been further aggravated. Weed control has become one of the main tasks in rice production.

[0003] Chemical control is the main method of weed control. Herbicides can quickly and efficiently disinfect weeds in rice fields. However, since the physiological metabolism of weeds is highly similar to that of rice, improper and excessive use of herbicides will inevitably have an adverse effect on the growth and development of rice, seriously affecting the safe production of rice. Therefore, cultivating herbicide-resistant rice is the most effective and economical means of weed control in rice fields.

[0004] However, the lack of rice herbicide resistance identification methods and herbicide-resistant rice germplasm resources has seriously restricted the breeding of herbicide-resistant rice, the simplified development of rice planting, and even the quality improvement and efficiency enhancement of the rice industry. Therefore, there is an urgent need to innovate and enrich rice herbicide resistance identification methods and accelerate the identification and utilization of herbicide-resistant rice germplasm resources, which is of great significance for ensuring my country's food security.

[0005] Molecular marker-assisted breeding utilizes the characteristics of molecular markers being closely linked to target trait genes, verifies the existence of target genes by detecting molecular markers, and ultimately achieves the purpose of selecting target traits. However, there is currently a severe shortage of molecular markers that can be used for rice herbicide resistance phenotypic identification and molecular marker-assisted breeding. CAPS markers are based on single nucleotide polymorphism (SNP) markers, and are combined with PCR technology and restriction endonucleases to visualize the results with the help of gel electrophoresis. They have the advantages of being fast, accurate, and not affected by environmental conditions. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a CAPS molecular marker for rapid screening of herbicide-resistant rice and its application. The present invention uses molecular markers significantly associated with rice herbicide resistance to quickly, efficiently and accurately identify and screen herbicide-resistant rice germplasm. The entire screening process can be completed within one day, which is time-saving, efficient, low-cost and easy to operate. The method can be applied to molecular marker-assisted breeding of rice herbicide resistance traits, reduce breeding workload, shorten breeding years, and accelerate the breeding process.

[0007] To this end, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a CAPS molecular marker for rapid screening of herbicide-resistant rice in an optional embodiment, wherein the CAPS molecular marker comprises a SNP site located at position 6155 of the nucleotide sequence shown in SEQ ID NO.3, the base of which is T, and a primer corresponding to the SNP site;

[0009] The primers include an upstream primer and a downstream primer;

[0010] The nucleotide sequence of the upstream primer from the 5' end to the 3' end is shown in SEQ ID NO.1;

[0011] The nucleotide sequence of the downstream primer from the 5' end to the 3' end is shown in SEQ ID NO.2.

[0012] In a second aspect, the present invention provides, in an optional embodiment, a method for rapidly screening herbicide-resistant rice germplasm, comprising the following steps:

[0013] S1: Extract genomic DNA from the rice germplasm plants to be tested;

[0014] S2: using the genomic DNA as a template and the primers according to claim 1 to perform PCR amplification to obtain a PCR product;

[0015] S3: digesting the PCR product to obtain a digestion product;

[0016] S4: Detect whether the enzyme cleavage product contains bands of 92 bp, 175 bp and 267 bp. When the enzyme cleavage product contains only a band of 267 bp, the corresponding rice germplasm to be tested is herbicide-resistant rice. When the enzyme cleavage product contains two bands of 92 bp and 175 bp, the corresponding rice germplasm to be tested is non-herbicide-resistant rice.

[0017] Preferably, in step S2, the reaction system of the PCR amplification is: 1 μL of genomic DNA template, 1 μL of upstream primer and downstream primer, 10 μL of 2×PhantaMix Master Mix, and 7 μL of ddH2O. The reaction procedure of the PCR amplification is: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 5 min.

[0018] Preferably, in step S3, the enzyme digestion reaction system is: 6 μL of PCR product, 0.3 μL of endonuclease, 1.5 μL of 10×Buffer, 7.2 μL of ddH2O; and / or, the enzyme digestion reaction conditions are: digestion at 37° C. for 2 hours. The endonuclease used in the enzyme digestion is EcoR I.

[0019] Preferably, in step S4, the method for detecting whether the enzyme digestion product contains bands of 92 bp, 175 bp and 267 bp is: typing by 2% agarose gel electrophoresis.

[0020] Preferably, the herbicide is an acetyl-CoA carboxylase herbicide.

[0021] In the present invention, ddH2O refers to double distilled water.

[0022] In a third aspect, the present invention provides, in an optional embodiment, a kit for rapid screening of herbicide-resistant rice germplasm, comprising the above-mentioned primers.

[0023] Preferably, the kit further comprises 2×Phanta Mix Master Mix, ddH2O, EcoR I endonuclease, 10×Buffer and agarose gel electrophoresis.

[0024] The nucleotide sequence of SEQ ID NO.1 is as follows:

[0025] GACAAGTGTGGTTTCCAGATTC.

[0026] The nucleotide sequence of SEQ ID NO.2 is as follows:

[0027] AATGCGGTCTGGGTTTATCTT.

[0028] The nucleotide sequence of SEQ ID NO.3 is as follows:

[0029]

[0030] Compared with the prior art, the present invention has one of the following beneficial effects:

[0031] 1. The present invention utilizes molecular markers significantly associated with rice herbicide resistance to rapidly, efficiently and accurately identify and screen herbicide-resistant rice germplasm. The entire screening process can be completed within one day, which is time-saving, efficient, low-cost and easy to operate. The method can be applied to molecular marker-assisted breeding of rice herbicide resistance traits, and can reduce the workload of breeding, shorten the breeding period and accelerate the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The phenotype of the herbicide-resistant rice mutant in Example 1 of the present invention after being sprayed with 8 times the recommended field dose of Gaicaoneng, wherein WT is the wild type, the left side is the phenotype before spraying the herbicide, and the right side is the phenotype 7 days after spraying;

[0033] Figure 2 The CAPS marker design for rapid screening of herbicide-resistant rice germplasm in Example 2 of the present invention, wherein MT is the herbicide-resistant rice mutant GJ46, WT is the herbicide-sensitive rice, and the underline represents the recognition sequence of the restriction endonuclease EcoR I;

[0034] Figure 3 The electrophoresis diagram of the PCR products and enzyme digestion products of 32 rice materials amplified by CAPS marker primers in Example 2 of the present invention, wherein ZH is Zhonghua 11, MT is the herbicide-resistant mutant GJ64, S1-S15 are different herbicide-sensitive rice strains in the F2 population, R1-R15 are different herbicide-resistant rice strains in the F2 population, and M is Trans2KPlus DNA Marker, which are 500 bp, 250 bp, and 100 bp from top to bottom, respectively;

[0035] Figure 4 The phenotypes of some different herbicide-resistant strains of the F2 population obtained by hybridizing the herbicide mutant and Zhonghua 11 in Example 2 of the present invention after spraying with Gaicaoneng are shown. S1-S7 are different herbicide-sensitive rice strains in the F2 population, and R1-R7 are different herbicide-resistant rice strains in the F2 population. M is Trans 2K Plus DNA Marker, which is 500bp, 250bp, and 100bp from top to bottom, respectively. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0038] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0039] Example 1

[0040] This embodiment provides a method for designing CAPS molecular markers for rapid screening of herbicide-resistant rice, comprising the following steps:

[0041] (1) Using ethyl methanesulfonate (EMS) mutagenesis, a highly herbicide-resistant rice mutant material GJ 46 was obtained, which can tolerate 8 times the recommended field dose of chloramphenicol. The results are shown in Figure 1 ;

[0042] (2) Compared with the wild type, the base T at position 6155 of the acetyl-CoA carboxylase gene ACC1 in the mutant GJ46 mutated to A, resulting in the production of herbicide resistance. The results are shown in Figure 1 ;

[0043] (3) Using the online enzyme recognition software dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html), the restriction endonuclease information of the sequence at the SNP site in step (1) was analyzed. It was found that there was an EcoR I enzyme recognition site sequence G↓AATTC (located at positions 6152-6157, ↓ indicates the enzyme site) at the SNP. However, in herbicide-resistant rice, the base T at position 6155 mutated to A, which made EcoR I unable to recognize the sequence for enzyme cleavage. The results are shown in Figure 1 ;

[0044] (4) The designed CAPS marker of the SNP site was named CAPs-I2139N-EcoR I molecular marker, and the primer sequences were designed as follows:

[0045] Upstream primer: The nucleotide sequence from the 5' end to the 3' end is shown in SEQ ID NO.1, SEQ ID NO.1 is G

[0046] ACAAGTGTGGTTTCCAGATTC;

[0047] Downstream primer: The nucleotide sequence from the 5' end to the 3' end is shown in SEQ ID NO.2, and SEQ ID NO.2 is AATGCGGTCTGGGTTTATCTT.

[0048] Example 2

[0049] This embodiment provides a method for rapidly screening herbicide-resistant rice germplasm, comprising the following steps:

[0050] S1: The herbicide-resistant mutant material GJ46 was hybridized with the herbicide-sensitive variety Zhonghua 11, and the obtained seeds were self-pollinated to obtain F2 plants. The F2 segregating population was sprayed with grass-covering agent at the seedling stage, and 15 herbicide-resistant strains and 15 herbicide-sensitive strains, as well as the parents GJ46 and Zhonghua 11, a total of 32 rice samples were selected for genotype analysis;

[0051] S2: extracting 32 rice genomic DNA samples to be tested in step S1;

[0052] S3: Using the genomic DNA of the rice plant to be tested as a template, PCR amplification reaction was performed using the CAPs-I2139N-EcoR I labeled primer;

[0053] The above PCR reaction was a 20 μL system, specifically: 1 μL of genomic DNA template, 1 μL of upstream and downstream primers, 10 μL of 2×PhantaMix Master Mix, and 7 μL of ddH2O.

[0054] The PCR amplification program of the above PCR reaction was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min;

[0055] S4: Perform EcoR I digestion reaction on the PCR product obtained in step S3.

[0056] The above enzyme digestion reaction is a 15 μL system, specifically: 6 μL of PCR product, 0.3 μL of EcoR I restriction enzyme, 1.5 μL of 10× Buffer, and 7.2 μL of ddH2O. The digestion is carried out at 37°C for 2 hours to obtain the digestion product;

[0057] S5: Perform 2% agarose gel electrophoresis typing test on the enzyme cleavage product obtained in step S4. If the enzyme cleavage product contains only one 267 bp fragment, the material to be tested is herbicide-resistant rice; if the enzyme cleavage product contains two bands of 92 bp and 175 bp, the material to be tested is non-herbicide-resistant rice. The results are shown in Figure 2 The results of this method are consistent with the rice herbicide resistance phenotype. The results are shown in Tables 1 and Figure 3 .

[0058] Table 1 Molecular marker detection results and herbicide resistance of 32 tested rice samples

[0059]

[0060]

[0061] In Table 1, “+” represents the presence of the CAPs-I2139N-EcoRI molecular marker, “-” represents the absence of the CAPs-I2139N-EcoRI molecular marker, “ZH” represents the herbicide-sensitive rice variety Zhonghua 11, “MT” represents the herbicide-resistant mutant GJ46, “R” represents the rice with herbicide resistance, and “S” represents the rice without herbicide resistance. The herbicide resistance identification method is the herbicide-resistant spraying method at the rice seedling stage.

[0062] It can be seen from Table 1 that the method for rapid screening of herbicide-resistant rice germplasm provided by the present invention can quickly and efficiently detect the herbicide resistance of rice, the operation is simple and flexible, the results are accurate and reliable, and it is of great significance for accelerating the screening of herbicide-resistant rice germplasm and promoting herbicide-resistant rice breeding.

[0063] Although the principles of the present invention are described in detail above in conjunction with the preferred embodiments of the present invention, those skilled in the art should understand that the above embodiments are merely explanations of the exemplary implementations of the present invention, and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute limitations on the scope of the present invention, and any obvious changes such as equivalent transformations, simple replacements, etc. based on the technical solution of the present invention, without departing from the spirit and scope of the present invention, fall within the protection scope of the present invention.

Claims

1. A CAPS molecular marker for rapid screening of herbicide-resistant rice, characterized in that: The CAPS molecular marker includes a SNP site located at position 6155 of the nucleotide sequence shown in SEQ ID NO.3, the base of which is T, and a primer corresponding to the SNP site; The primers include an upstream primer and a downstream primer; The nucleotide sequence of the upstream primer from the 5' end to the 3' end is shown in SEQ ID NO.1; The nucleotide sequence of the downstream primer from the 5' end to the 3' end is shown in SEQ ID NO.

2.

2. A method for rapid screening of herbicide-resistant rice germplasm, characterized in that: The following steps are involved: S1: Extract genomic DNA from the rice germplasm plants to be tested; S2: using the genomic DNA as a template and the primers according to claim 1 to perform PCR amplification to obtain a PCR product; S3: digesting the PCR product to obtain a digestion product; S4: Detect whether the enzyme cleavage product contains bands of 92 bp, 175 bp and 267 bp. When the enzyme cleavage product contains only a band of 267 bp, the corresponding rice germplasm to be tested is herbicide-resistant rice. When the enzyme cleavage product contains two bands of 92 bp and 175 bp, the corresponding rice germplasm to be tested is non-herbicide-resistant rice.

3. The method for rapid screening of herbicide-resistant rice germplasm according to claim 2, characterized in that: In step S2, the reaction system of the PCR amplification is: 1 μL of genomic DNA template, 1 μL of upstream primer and downstream primer respectively, 10 μL of 2×PhantaMix MasterMix, and 7 μL of ddH2O.

4. The method for rapid screening of herbicide-resistant rice germplasm according to claim 2, characterized in that: In step S2, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

5. The method for rapid screening of herbicide-resistant rice germplasm according to claim 2, characterized in that: In step S3, the enzyme digestion reaction system is: 6 μL of PCR product, 0.3 μL of endonuclease, 1.5 μL of 10×Buffer, 7.2 μL of ddH2O; and / or, The reaction conditions of the enzyme digestion are: digestion at 37° C. for 2 hours.

6. The method for rapid screening of herbicide-resistant rice germplasm according to claim 2, characterized in that: In step S3, the enzyme digestion adopts the endonuclease EcoRI.

7. The method for rapid screening of herbicide-resistant rice germplasm according to claim 2, characterized in that: In step S4, the method for detecting whether the enzyme digestion product contains bands of 92 bp, 175 bp and 267 bp is: using 2% agarose gel electrophoresis for typing.

8. The method for rapid screening of herbicide-resistant rice germplasm according to claim 2, characterized in that: The herbicide is an acetyl-CoA carboxylase herbicide.

9. A kit for rapid screening of herbicide-resistant rice germplasm, characterized in that: Comprising the primer of claim 1.

10. The kit for rapid screening of herbicide-resistant rice germplasm according to claim 9, characterized in that: The kit also includes 2×Phanta Mix MasterMix, ddH2O, EcoR I endonuclease, 10×Buffer and agarose gel electrophoresis.

Images