Application of tetrahydrocurcumin in preparation of product for regulating and / or treating intestinal flora disorder caused by non-alcoholic steatohepatitis

Abstract

The invention provides application of tetrahydrocurcumin in preparation of a product for regulating and / or treating intestinal flora disorder caused by non-alcoholic steatohepatitis, and belongs to the technical field of biological medicine. The invention finds that the tetrahydrocurcumin can be used for improving the relative abundance of Muracaceae, Lactobacillus and Alistipes, and reducing the relative abundance of Blauria (mucous eubacterium), [Ruminococcus] torquens group (ruminococcus), Escherichia-Shiga (Escherichia-Shigella) and Colidextribacter, and can be used for preparing the tetrahydrocurcumin, so that the relative abundance of the tetrahydrocurcumin, the relative abundance of the tetrahydrocurcumin and the relative abundance of the tetrahydrocurcumin and the relative abundance of the tetrahydrocurcumin and the relative abundance of the tetrahydrocurcumin and the relative abundance of the tetrahydrocurcumin and the relative abundance of the tetrahydrocurcumin and the relative abundance of the tetrahydrocurcumin are improved. The alpha diversity and beta diversity of intestinal flora can be improved, the safety is good, and reference is provided for clinical treatment of intestinal flora disorder.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of tetrahydrocurcumin in preparing a product for regulating and / or treating intestinal flora disorder caused by non-alcoholic fatty hepatitis. Background Art

[0002] The intestinal flora is a complex ecosystem, mainly composed of anaerobic bacteria, facultative anaerobic bacteria and aerobic bacteria, which can regulate host metabolism by producing active metabolites. It has been reported that the intestinal flora is closely related to many autoimmune diseases, metabolic diseases, tumors and complications of diabetes. Non-alcoholic steatohepatitis (NASH), also known as metabolic steatohepatitis, is a clinical syndrome with pathological changes similar to alcoholic hepatitis but without a history of excessive drinking. It is common in middle-aged people, especially overweight and obese individuals. Studies have reported that patients with steatohepatitis have intestinal flora imbalance, a significant increase in the number of Bacteroidetes, a significant decrease in the number of Firmicutes, and a significant increase in the ratio of the number of Bacteroidetes to the number of Firmicutes. At the same time, intestinal flora disorders can lead to an increase in endogenous ethanol, further damaging the liver; it can also lead to an increase in endotoxins, damage the intestinal mucosa, increase the permeability of the intestinal mucosa, increase the level of endotoxins in the blood, and aggravate the degree of steatohepatitis. The progression of steatohepatitis will further strengthen the imbalance of intestinal flora, ultimately leading to worsening liver disease, forming a vicious cycle.

[0003] Tetrahydrocurcumin (THC) is the most active and main metabolite of curcumin in the body. It has higher bioavailability and antioxidant activity than curcumin, and has pharmacological activities such as hypoglycemic, anti-inflammatory, anti-oxidant, lipid-lowering, anti-simple fatty liver, and cardiovascular damage reduction. At present, the use of tetrahydrocurcumin is mainly anti-obesity, anti-fatty liver, anti-diabetes, etc. Its functional activity is mainly analyzed from the aspects of lipid-lowering, antioxidant and anti-inflammatory effects. There is no literature report on whether tetrahydrocurcumin can regulate the intestinal flora disorder caused by non-alcoholic fatty liver disease. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the object of the present invention is to provide an application of tetrahydrocurcumin in the preparation of a product for regulating and / or treating intestinal flora disorder caused by non-alcoholic fatty hepatitis. Tetrahydrocurcumin can increase the diversity of intestinal flora and regulate the relative abundance of intestinal flora.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides the use of tetrahydrocurcumin in preparing a product for regulating and / or treating intestinal flora disorder caused by non-alcoholic fatty hepatitis.

[0007] Preferably, the tetrahydrocurcumin reduces the ratio of the abundance of Firmicutes to the abundance of Bacteroidetes.

[0008] Preferably, the tetrahydrocurcumin increases the relative abundance of Muribaculaceae, Lactobacillus and Alistipes.

[0009] Preferably, the tetrahydrocurcumin reduces the relative abundance of Blautia, [Ruminococcus]_torques_group, Escherichia-Shigella, and Colidextribacter.

[0010] Preferably, the tetrahydrocurcumin improves the Chao1 index, Shannon index, Simpson index and Ace index of the intestinal flora.

[0011] Preferably, the tetrahydrocurcumin restores the β-diversity of intestinal flora.

[0012] Preferably, the non-alcoholic steatohepatitis is caused by a high-fat diet.

[0013] Preferably, the products include medicines and health products.

[0014] Preferably, the active ingredient of the product comprises an effective dose of tetrahydrocurcumin.

[0015] Preferably, the effective dose of tetrahydrocurcumin is 5.5 to 22.2 mg / kg.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention finds that tetrahydrocurcumin can regulate and / or treat intestinal flora disorder caused by non-alcoholic fatty liver disease. The tetrahydrocurcumin of the present invention can reduce the relative abundance of harmful bacteria, increase the relative abundance of beneficial bacteria, increase the Chao1 index, Shannon index, Simpson index and Ace index of intestinal flora α diversity, restore intestinal flora β diversity, and has good safety, providing a reference for clinical treatment of intestinal flora disorder.

[0018] The present invention further discovered that tetrahydrocurcumin can improve / regulate the intestinal flora disorder caused by non-alcoholic fatty liver disease, thereby improving the liver damage caused by non-alcoholic fatty liver disease, reducing the ALT and AST levels in the serum of mice, and regulating the mRNA expression levels of CYP7A1, CYP8B1, ACC, AMPK, FXR, and mTOR in the liver. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1: Species accumulation box plot;

[0020] Figure 2 : β diversity analysis among samples in each group;

[0021] Figure 3 :The effect of THC on the relative abundance of intestinal flora phylum levels in mice fed a high-fat diet;

[0022] Figure 4 :The effect of THC on the relative abundance of Firmicutes in mice fed a high-fat diet;

[0023] Figure 5 :The effect of THC on the relative abundance of Bacteroidetes in mice fed a high-fat diet;

[0024] Figure 6 :The effect of THC on the ratio of Firmicutes to Bacteroidetes in mice fed a high-fat diet;

[0025] Figure 7 :The effect of THC on the relative abundance of genus levels in the intestinal flora of mice fed a high-fat diet;

[0026] Figure 8 :The effect of THC on the relative abundance of Muribaculaceae in mice fed a high-fat diet;

[0027] Fig. 9 :The effect of THC on the relative abundance of [Ruminococcus]_torques_group in mice fed a high-fat diet;

[0028] Fig.10 :The effect of THC on the relative abundance of Escherichia-Shigella in mice fed a high-fat diet;

[0029] Fig.11 :KEGG function prediction results of intestinal flora in mice fed a high-fat diet;

[0030] Fig.12 : Liver index of mice;

[0031] Fig.13 :H&E staining results of mouse liver;

[0032] Fig.14 : ALT content in mouse serum;

[0033] Fig.15 : AST content in mouse serum;

[0034] Fig.16 : Relative expression of CYP7A1 mRNA in mouse liver;

[0035] Fig.17: Relative expression of CYP8B1 mRNA in mouse liver;

[0036] Fig.18 : Relative expression of ACC mRNA in mouse liver;

[0037] Fig.19 : Relative expression of AMPK mRNA in mouse liver;

[0038] Fig. 20 : Relative expression of FXR mRNA in mouse liver;

[0039] Fig.21 : Relative expression of mTOR mRNA in mouse liver. DETAILED DESCRIPTION

[0040] The present invention provides an application of tetrahydrocurcumin in preparing a product for regulating and / or treating intestinal flora disorder caused by non-alcoholic steatohepatitis. The non-alcoholic steatohepatitis described in the present invention is caused by a high-fat diet, which leads to an increase in harmful flora and a decrease in beneficial flora in the intestine, thereby causing intestinal flora disorder.

[0041] The tetrahydrocurcumin of the present invention can reduce the relative abundance of harmful bacteria and increase the relative abundance of beneficial bacteria. From the phylum level analysis, the tetrahydrocurcumin reduces the relative abundance of Firmicutes, increases the relative abundance of Bacteroidetes, and reduces the ratio of the abundance of Firmicutes to the abundance of Bacteroidetes. From the subordinate level analysis, the tetrahydrocurcumin increases the relative abundance of Muribaculaceae, Lactobacillus, and Alistipes, and reduces the relative abundance of Blautia, [Ruminococcus]_torques_group, Escherichia-Shigella, and Colidextribacter. From the perspective of bacterial diversity, tetrahydrocurcumin can improve the Chao1 index, Shannon index, Simpson index and Ace index of the α diversity of intestinal flora, and restore the β diversity of intestinal flora.

[0042] The present invention further found that tetrahydrocurcumin can improve / regulate the intestinal flora disorder caused by non-alcoholic fatty liver disease, thereby improving the liver damage caused by non-alcoholic fatty liver disease, reducing the ALT and AST levels in the serum of mice, increasing the relative expression of CYP7A1, CYP8B1, AMPK, FXR and mTOR mRNA in the liver, and reducing the relative expression of ACC mRNA in the liver.

[0043] The present invention has no particular limitation on the specific source of the tetrahydrocurcumin, and any conventional commercially available product in the art may be used.

[0044] In the application of the present invention, the product includes medicines and health products, and the active ingredient of the product includes an effective dose of tetrahydrocurcumin. Preferably, the medicine or health product of the present invention also includes an acceptable carrier or excipient. The content of tetrahydrocurcumin in the medicine or health product of the present invention is 1 to 99.99wt%, preferably 50 to 90wt%.

[0045] The effective dosage of the tetrahydrocurcumin of the present invention is 5.5 to 22.2 mg / kg, preferably 11.1 to 22.2 mg / kg, and more preferably 15 to 20 mg / kg.

[0046] In the following examples, unless otherwise specified, all methods are conventional. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0047] The preparation method of tetrahydrocurcumin used in the specific embodiment of the present invention is as follows:

[0048] Feeding: Curcumin (purchased from Henan Zhongda Hengyuan Biotechnology Co., Ltd., batch number 20200302) was dissolved in 30 times (w / w) acetone, and 10% palladium carbon catalyst (6% of the total amount of curcumin) was added into a high-pressure reactor and stirred at 20 rpm.

[0049] Replacement: Draw the vacuum degree in the reactor to ≤-0.08MPa, replace it with 0.3MPa nitrogen for 3 times, increase the stirring speed to 45rpm, introduce nitrogen into the reactor to exhaust the air, close the vacuum valve, slowly introduce hydrogen into the reactor, and maintain the hydrogen pressure at 0.05MPa.

[0050] Reaction: Control the reaction temperature at 20°C and the hydrogen pressure at 0.05 MPa. After reacting for 4 hours, replace with nitrogen three times, take a sample and monitor it once by TLC, and then monitor it once every 2 hours until the raw material point disappears completely.

[0051] Filtration and concentration: After the reaction is completed, the reaction solution is filtered through a 1 μm filter cartridge, and the filter cake is washed with an appropriate amount (2 times the amount of curcumin fed) of acetone. The washing liquid is combined with the reaction solution and concentrated to dryness at below 60°C.

[0052] Ethanol dissolution: Dissolve the concentrated reaction product with 2 times the amount (w / w) of 70% ethanol at 65°C, keep warm and stir for 1 hour, and filter while hot.

[0053] Crystallization: Compressed air was passed through the jacket of the reactor, and the system was cooled to below 30°C. After the solid was precipitated, cold ethylene glycol was turned on, and the system was cooled to 0-5°C. Water was added to adjust the ethanol concentration to 50%. The mixture was stirred at 0-5°C for 20 hours, and the stirring speed was set to 20 rpm during the crystallization process.

[0054] Centrifugal drying: centrifuge the crystals at 800 rpm for 50 min, and dry the resulting material under reduced pressure at 60°C, ≤-0.08 MPa for 6 h.

[0055] Refining: (1) Pretreatment: Add 3 times (w / w) dichloromethane to dissolve the crude THC. (2) Loading: Load 200 mesh silica gel, level it, and remove the air in the silica gel. (3) Column conditioning: Open the bottom valve and add dichloromethane through the high-level tank until the liquid layer is close to the surface of the silica gel. (4) Loading: Sprinkle the material liquid evenly on the surface of the silica gel column, open the bottom valve outlet and empty the chromatography column, and when the upper liquid level flows to a height of nearly 30 cm, add 30 kg of anhydrous sodium sulfate and level it. (5) Elution: Add the eluent dichloromethane through the high-level tank to the chromatography for elution. Monitor the elution with TLC. (6) Concentration: Pass the eluate through a microporous filter (1.0 μm) and concentrate it to a small amount at normal pressure at 65°C. (7) Pre-drying: Dry the material under reduced pressure at 60°C and vacuum degree ≤-0.008MPa for 6 hours. (8) Crushing: The pre-dried sample was crushed twice with a high-speed crusher, D90 ≤ 50 μm. (9) Drying and mixing: The crushed material was kept at 60° C. and vacuum degree ≤ -0.008 MPa for 6 h to obtain tetrahydrocurcumin (the structure was analyzed by HPLC and nuclear magnetic resonance, and the prepared tetrahydrocurcumin was no different from the commercially available one).

[0056] In the specific embodiments of the present invention, all mice were purchased from Guangdong Weitonglihua Experimental Animal Technology Co., Ltd. (License No.: SCXK (Yue) 2022-0063) and silymarin was purchased from MADAUS GMBH in Germany, with approval number: National Medicine Standard HJ201811067.

[0057] Example 1

[0058] Animal grouping: 7-week-old C57BL / 6J male and female mice (weight 16-24g) were housed in a standard SPF barrier environment, maintaining constant temperature (20-24℃), constant humidity (55%), 12-hour day and night alternation, and free access to food and water. After one week of adaptive feeding, 54 mice were evenly divided into the control group (CON), model group (Mod), positive control group (Mod+Silymarin), THC low, medium, and high dose groups (Mod+THC50, Mod+THC100, Mod+THC200), and mice in each group were free to drink water.

[0059] Establishment of NASH mouse model: A high-fat diet (D12492, 60% fat) was used to induce a non-alcoholic fatty liver disease model in mice. The control group was fed with a mouse maintenance diet, and the other groups were fed with a high-fat diet for 16 consecutive weeks.

[0060] Administration method: 12 weeks after modeling, the positive control group was gavaged with silymarin suspension at a dose of 200 mg / kg, and silymarin was suspended in 0.5% CMC-Na solution before use. The low, medium and high dose groups of THC were gavaged with tetrahydrocurcumin at doses of 50 mg / kg (equivalent to a human dose of 5.5 mg / kg), 100 mg / kg (equivalent to a human dose of 11.1 mg / kg), and 200 mg / kg (equivalent to a human dose of 22.2 mg / kg), respectively, and tetrahydrocurcumin was suspended in 0.5% CMC-Na solution before use. The drug was administered continuously for 4 weeks, with gavage once a day. The control group and the model group were gavaged with an equal volume of 0.5% CMC-Na solution.

[0061] Sample processing: During the experiment, the weight of mice was recorded every week. At the end of the 16th week, the feces of mice were obtained by grasping and stimulating defecation. A sufficient amount of feces was put into cryopreservation tubes and immediately placed in liquid nitrogen, and then placed in a -80℃ refrigerator overnight for later use.

[0062] Sequencing analysis: The fecal samples of each group of mice were subjected to high-throughput sequencing to generate the original sequencing sequence. The original double-end sequence was generated by Illumina MiSeq sequencing, the primer sequence was cut off, and the quality control analysis such as quality filtering, noise reduction, splicing and chimera removal was performed using the default parameters of Qiime2 to obtain the representative sequence and ASV abundance. After noise reduction and chimera removal by DADA2, the sequence was deduplicated, and each deduplicated sequence was called ASVs. The samples were subjected to intestinal flora diversity, abundance, community analysis and functional prediction.

[0063] (1) Effect of THC on the diversity of intestinal flora in NASH mice

[0064] A total of 4164 characteristic sequences (ASVs) were generated after denoising and splicing of 54 mouse fecal samples using the DADA2 method, of which 456 ASVs, 91 genera, and 12 phyla were found to be differentially expressed among the samples.

[0065] Species accumulation box plot Figure 1 As shown. Figure 1 It can be seen that as the sample size increases, the position of the early box plot shows a sharp rise, and as the sample size continues to increase, the curve tends to be flat, indicating that the sequencing sample size is sufficient and the sampling is sufficient, and the next step of data analysis can be carried out. The effect of THC on the α diversity of the intestinal flora of each group of mice is shown in Table 1.

[0066] Table 1 Effect of THC on the α diversity of intestinal flora in each group of mice

[0067] Chao1 Index Shannon Index Simpson Index Ace Index CON Group 291.72±11.84 6.59±0.19 0.98±0.00 279.33±9.45 Mod Group <![CDATA[207.71±40.02 ## ]]> <![CDATA[5.23±0.38 ## ]]> <![CDATA[0.92±0.05 ## ]]> <![CDATA[208.48±40.36 ## ]]> Mod+Silymarin Group 238.69±32.50 <![CDATA[6.22±0.60 ** ]]> 0.96±0.01 238.40±33.28 Mod+THC50 group 201.80±21.23 5.55±0.21 0.92±0.04 200.91±21.55 Mod+THC100 group 215.51±50.34 5.62±0.30 0.93±0.03 233.09±47.23 Mod+THC200 group 247.02±21.28 <![CDATA[5.78±0.39 * ]]> 0.96±0.02 <![CDATA[247.36±20.87 * ]]>

[0068] Chao1 and Ace index were used to evaluate the number of ASVs (characteristic sequences) in the community, where Chao1 used the chao1 algorithm to estimate the number of ASVs contained in the sample, and the Ace index evaluated the number of ASVs in the community. Shannon and Simpson index were used to estimate the microbial diversity in the sample, where the Shannon index reflected the microbial diversity by calculating the information entropy, and the Simpson index evaluated the diversity by calculating the concentration of species richness. ##, compared with the control group, P < 0.01; *, compared with the model group, P < 0.05; **, compared with the model group, P < 0.01.

[0069] As shown in Table 1, compared with the control group, the high-fat diet significantly reduced the richness and diversity of the intestinal flora of mice. Under the intervention of THC, the richness and diversity of the intestinal flora of mice tended to increase.

[0070] The β diversity analysis among the samples in each group was as follows Figure 2 As shown. Figure 2 It can be seen that the contribution rate of PCoA1 on the horizontal axis is 16.57%, and the contribution rate of PCoA2 on the vertical axis is 10.25%. The results show that the β diversity of the intestinal flora of the model group mice is different from that of the normal group, and there is no cross-mixing. The THC group has a tendency to move closer to the normal group, suggesting that THC can restore the β diversity of the intestinal flora.

[0071] (2) Analysis of bacterial community composition and differences at the phylum and genus levels

[0072] Effects of THC on relative abundance of intestinal flora phyla in mice fed a high-fat diet Figure 3 As shown. At the phylum level, the main bacterial flora included Firmicutes, Bacteroidota, Desulfobacterota, Proteobacteria, Campilobacterota, etc. Among them, compared with the control group, the relative abundance of Firmicutes in the model group increased significantly (P < 0.01); compared with the model group, the relative abundance of Firmicutes in the positive control group (Mod + Silymarin) and the high-dose THC group (Mod + THC200) decreased significantly (P < 0.05), indicating that under the intervention of THC, the content of Firmicutes in mice fed a high-fat diet can be significantly reduced (such as Figure 4Compared with the control group, the relative abundance of Bacteroidetes in the model group decreased significantly (P < 0.01); compared with the model group, the positive control group (Mod + Silymarin) and THC intervention group could increase the content of Bacteroidetes in mice fed a high-fat diet (as shown in Figure 2A). Figure 5 Compared with the control group, the ratio of Firmicutes to Bacteroidetes in the model group increased significantly (P < 0.01), and decreased significantly under the intervention of THC (as shown in Figure 6 shown).

[0073] Effects of THC on relative abundance of gut microbiota in mice fed a high-fat diet Figure 7 As shown. At the genus level, the main bacterial flora included Muribaculaceae, [Eubacterium]_coprostanoligenes_group (Eubacterium), Blautia (Eubacterium), Lactobacillus (Lactobacillus), [Ruminococcus]_torques_group (Ruminococcus), Escherichia-Shigella (Escherichia-Shigella), etc. Among them, compared with the control group, the relative abundance of the beneficial bacteria genus Muribaculaceae in the model group decreased significantly (P < 0.01), and there was an upward trend under the intervention of THC (such as Figure 8 The relative abundance of harmful bacteria Ruminococcus in the model group increased significantly (P < 0.01), and showed a downward trend under the intervention of THC, and the high-dose THC group (Mod + THC200) decreased significantly (P < 0.05) (as shown in Fig. 9 The harmful bacteria Escherichia-Shigella in the model group increased significantly (P < 0.01), and showed a downward trend under the intervention of THC, and the high-dose THC group (Mod + THC200) decreased significantly (P < 0.05) (as shown in Fig.10 shown).

[0074] (3) KEGG function prediction

[0075] Function prediction was performed in the KEGG database, and the results were as follows Fig.11 As shown. Fig.11It can be seen that the signal pathways with the highest relative abundance are: Metabolic pathways, ABC transporters, fatty acid biosynthesis, AMPK signaling pathway, PPAR signaling pathway, non-alcoholic fatty liver disease, etc. The results indicate that the role of intestinal flora in the body may be related to these signal pathways.

[0076] Example 2

[0077] Animal grouping: 7-week-old C57BL / 6J male and female mice (weight 16-24g) were housed in a standard SPF barrier environment, maintaining constant temperature (20-24℃), constant humidity (55%), 12-hour day and night alternation, and free access to food and water. After one week of adaptive feeding, 54 mice were evenly divided into the control group (CON), model group (Mod), positive control group (Mod+Silymarin), THC low, medium, and high dose groups (Mod+THC50, Mod+THC100, Mod+THC200), and mice in each group were free to drink water.

[0078] Establishment of NASH mouse model: A high-fat diet (D12492, 60% fat) was used to induce a non-alcoholic fatty liver disease model in mice. The control group was fed with a mouse maintenance diet, and the other groups were fed with a high-fat diet for 16 consecutive weeks.

[0079] Administration method: 12 weeks after modeling, the positive control group was gavaged with silymarin suspension at a dose of 200 mg / kg, and silymarin was suspended in 0.5% CMC-Na solution before use. The low, medium and high dose groups of THC were gavaged with tetrahydrocurcumin at doses of 50 mg / kg (equivalent to a human dose of 5.5 mg / kg), 100 mg / kg (equivalent to a human dose of 11.1 mg / kg), and 200 mg / kg (equivalent to a human dose of 22.2 mg / kg), respectively, and tetrahydrocurcumin was suspended in 0.5% CMC-Na solution before use. The drug was administered continuously for 4 weeks, with gavage once a day. The control group and the model group were gavaged with an equal volume of 0.5% CMC-Na solution.

[0080] Tissue processing: At the end of week 16, mice were bled and dissected.

[0081] Fresh mouse livers were collected, weighed, liver morphology observed, and liver index calculated. The liver index results of 54 mice were as follows: Fig.12As shown. Fig.12 It can be seen that compared with the control group, the liver index of mice in the model group was greater than that of the control group, but it was not statistically significant. Under the intervention of THC, the liver index of mice decreased, and the low and high dose groups of THC were statistically significant (P < 0.05), while the medium dose group was not statistically significant.

[0082] Part of the liver tissue was immersed in 4% paraformaldehyde and stained with H&E to observe and analyze the liver of the mouse. Fig.13 shown. Fig.13 A is the control group, B is the model group, C is the positive control group, D is the THC low-dose group, E is the THC medium-dose group, and F is the THC high-dose group. Fig.13 It can be seen that the endothelium of the central vein of the liver in the control group was intact, and the hepatocytes were arranged radially around the central vein, without fatty degeneration and inflammatory cell infiltration. Compared with the control group, the liver of the model group showed vacuolar degeneration of hepatocytes, severe fatty degeneration of hepatocytes, varying degrees of necrosis, and accompanied by inflammatory cell infiltration. Compared with the model group, the positive control group and the THC administration group alleviated the above-mentioned lesions to varying degrees, among which the high-dose THC group had the best alleviating effect.

[0083] The serum of mice was collected and the ALT and AST in the serum of mice in each group were detected by ELISA. Figures 14-15 As shown. Figures 14-15 It can be seen that the levels of ALT and AST in the serum of model mice increased significantly (P < 0.01). Under the intervention of THC, the levels of ALT and AST in the serum of mice decreased significantly (P < 0.01) and showed a dose-dependent manner.

[0084] The mRNA expression levels of CYP7A1, CYP8B1, ACC, AMPK, FXR, and mTOR in the liver were detected respectively. The detection steps involved a cDNA first-strand synthesis kit (purchased from Chengdu Rongwei Gene Biotechnology Co., Ltd., batch number 230304-A5); 2×SYBR Green PCR Mastermix (purchased from Chengdu Rongwei Gene Biotechnology Co., Ltd., batch number 230304-A4); and an RNA extraction kit (purchased from Chengdu Fuji Biotechnology Co., Ltd., batch number R230101). The upstream primer of CYP7A1: GCTGTGGTAGTGAGCTGTTG (SEQ ID NO: 1); the downstream primer: GTTGTCC AAAGGAGGTTCACC (SEQ ID NO: 2); the upstream primer of CYP8B1: CCTCTGGA CAAGGGTTTTGTG (SEQ ID NO: 3); the downstream primer: GCACCGTGAAGACATCC CC (SEQ ID NO: 4); the upstream primer of ACC: ATGGGCGGAATGGTCTCTTTC (SEQ ID NO: 5); the downstream primer: TGGGGACCTTGTCTTCATCAT (SEQ ID NO: 6); the upstream primer of AMPK: TTCGGGAAAGTGAAGGTGGG (SEQ ID NO: 7); the downstream primer: TCTTCTGCCGGTTGAGTATCT (SEQ ID NO: 8); the upstream primer of FXR: G CTTGATGTGCTACAAAAGCTG (SEQ ID NO: 9); the downstream primer of FXR: G CTTGATGTGCTACAAAAGCTG (SEQ ID NO: 10); the downstream primer of FXR: G CTTGATGTGCTACAAAAGCTG (SEQ ID NO: 11); the downstream primer of FXR: G CTTGATGTGCTACAAAAGCTG (SEQ ID NO: 12); the upstream primer of FXR: G CTTGATGTGCTACAAAAGCTG (SEQ ID NO: 13); the downstream primer of FXR: G CTTGATGTGCTACAAAAGCTG (SEQ ID NO: 14); the upstream primer of FXR: G CTTGATGTGCTACAAAAGCTG (SEQ ID NO: 15); the downstream primer of ACC: ATGGGCGGAATGGTCTCTTTC (SEQ ID NO: 16); the downstream primer of ACC: ATGGGCGGAATGGTCTCTTTC NO:9); downstream primer: CGTGGTGATGGTTGAATGTCC (SEQ ID NO:10); upstream primer of mTOR: ACCGGCACACA TTTGAAGAAG (SEQ ID NO:11); downstream primer: TCTTCTGCCGGTTGAGTATC T (SEQ ID NO:12). The results are as follows Figures 16 to 21 shown.

[0085] The results showed that THC could significantly increase the relative expression of CYP7A1 and CYP8B1 mRNA in the liver (P < 0.05). Compared with the control group, the expression of ACC mRNA in the liver of the model group mice showed an upward trend, while the expression of AMPK mRNA decreased significantly (P < 0.05). The expression of AMPK mRNA increased significantly under the intervention of high-dose THC (P < 0.05). The detection of FXR and mTOR found that high-fat diet led to a decrease in the relative expression of FXR and mTOR mRNA in the liver of mice (P < 0.05), while THC intervention improved this situation, and low-dose THC significantly increased the relative expression of FXR and mTOR mRNA (P < 0.01).

[0086] The above results confirmed that tetrahydrocurcumin can improve / regulate the intestinal flora disorder caused by non-alcoholic steatohepatitis, thereby improving the liver damage caused by non-alcoholic steatohepatitis, reducing the ALT and AST levels in the serum of mice, and regulating the mRNA expression levels of CYP7A1, CYP8B1, ACC, AMPK, FXR, and mTOR in the liver.

[0087] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of tetrahydrocurcumin in the preparation of products for regulating and / or treating intestinal flora disturbance caused by non-alcoholic fatty hepatitis.

2. The use according to claim 1, characterized in that: The tetrahydrocurcumin reduces the ratio of the abundance of Firmicutes to the abundance of Bacteroidetes.

3. The use according to claim 1, characterized in that: The tetrahydrocurcumin increases the relative abundance of Murib aculaceae, Lactobacillus, and Alistipes.

4. The use according to claim 1, characterized in that: The tetrahydrocurcumin reduces the relative abundance of Blautia, [Ruminococcus]_torques_group, Escherichia-Shigella, and Colidextribacter.

5. The use according to claim 1, characterized in that: The tetrahydrocurcumin improves the Chao1 index, Shannon index, Simpson index and Ace index of the intestinal flora.

6. The use according to claim 1, characterized in that: The tetrahydrocurcumin restores the beta diversity of intestinal flora.

7. The use according to claim 1, characterized in that: The nonalcoholic steatohepatitis is caused by a high-fat diet.

8. The use according to claim 1, characterized in that: The products include medicines and health products.

9. The use according to claim 8, characterized in that: The active ingredient of the product includes an effective dose of tetrahydrocurcumin.

10. The use according to claim 1, characterized in that: The effective dosage of the tetrahydrocurcumin is 5.5 to 22.2 mg / kg.

Images