Preparation method and application of PEG (at) APSNDV-FAPApt liposome nanoparticles

Abstract

The invention discloses a PEG (at) APSamp and a preparation method of the PEG (at) APSamp; according to the preparation method and application of the NDV-FAPApt lipidosome nanoparticles, PEG lipidosome is adopted to load astragalus polysaccharide combined with oncolytic virus NDV, and the astragalus polysaccharide combined with oncolytic virus NDV is targeted to a tumor tissue through an FAPApt, so that the nanoparticles are accumulated in a tumor area, oncolytic and immunity enhancing effects are achieved, and the tumor treatment and anti-tumor effect enhancing effects are achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology and specifically relates to a PEG@APS&NDV-FAP Apt Preparation method and application of liposome nanoparticles. Background Art

[0002] Liver cancer is the sixth most common cancer and the third most common cause of cancer death worldwide. The early symptoms of hepatitis are mild and often ignored, and people infected with the virus lack the enthusiasm for examination and treatment, and have low compliance with long-term medication, resulting in low screening rates and low standardized treatment rates. After acute hepatitis subsides, liver tissue will regenerate and integrate, however, in most cases, liver damage remains chronic. Chronic liver damage can lead to chronic hepatitis and hepatocyte death, which may further promote liver fibrosis, cirrhosis, and liver cancer over time. Liver cancer occurs in the context of cirrhosis of almost any cause, including autoimmune cirrhosis and primary biliary cirrhosis. Risk factors for liver cancer include: hepatitis B virus, hepatitis C virus, fatty liver, alcohol-related cirrhosis, smoking, obesity, diabetes, iron overload, and various dietary exposures.

[0003] Due to the insidious onset of liver cancer and the lack of specific early markers, there is still no effective treatment for patients who are diagnosed with liver cancer before the advanced stage or who transition to advanced liver cancer after other treatment failures, and the survival time is generally only 6 months. Molecular research that can control the occurrence and development of tumors has made the development of targeted therapy possible, which aims to improve the anti-cancer efficacy of drugs and reduce side effects.

[0004] Nanomaterials can be designed for tissue- and cell-specific delivery of chemotherapeutic drugs. Therefore, the development of nano-delivery systems has great prospects in the targeted treatment of liver cancer and overcoming the barriers to chemotherapeutic drug delivery. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide a PEG@APS&NDV-FAP Apt Preparation method and application of liposome nanoparticles. The present invention uses PEG liposomes loaded with astragalus polysaccharide combined with oncolytic virus NDV, and FAP aptamer (FAP Apt ) are targeted to tumor tissues, causing the nanoparticles to accumulate in the tumor area, causing oncolytic and immune-enhancing effects, achieving tumor treatment and enhancing anti-tumor effects.

[0007] The specific technical solution adopted by the present invention is: A PEG@APS&NDV-FAP Apt The method for preparing liposome nanoparticles comprises the following steps: Ⅰ. Take HSPC, cholesterol, DSPE-mPEG 2000 Pour into a flask, add appropriate amount of ethanol-chloroform to dissolve, and stir; Ⅱ. Immerse the flask in a water bath and connect it to the rotary evaporator adapter. Rotate until the liposomes form a uniform film on the surface of the flask. Turn on the vacuum pump and let the round-bottom flask rotate in vacuum for 8-12 minutes. III. Take out the flask from the water bath and put it into a vacuum drying oven to dry it to remove the residual organic solvent and obtain pure liposome PEG; then add APS drug solution into the flask, hydrate and resuspend the liposome by ultrasound, and stir it magnetically to fully mix APS and liposome; IV. After the stirred liposome suspension with APS is ultrasonically treated again for 15-25 minutes, the obtained APS liposome suspension is put into a bottle, NDV is added, vortexed to mix thoroughly, and then allowed to stand at 4°C for 25-35 minutes; V. The liposome suspension was squeezed and pushed multiple times with a 200 nm extrusion membrane to obtain PEG@APS&NDV liposomes with uniform particle size; Ⅵ. Collect the PEG@APS&NDV liposomes into an ultrafiltration tube with a MWCO of 100 kDa and centrifuge for 8-12 minutes to remove free APS; VII. Take DSPE-mPEG 2000 -Mal and FAP aptamers were mixed and incubated on a shaker to accelerate the mixing reaction, and then distilled water was added to wash in an ultrafiltration tube with a MWCO of 3kDa, and unreacted compounds were removed by centrifugation to obtain DSPE-mPEG 2000 -FAP; the gene sequence of the FAP aptamer is: AGC AGC ACA GAG GTC AGA TGC CGC AGG CAG CTG CCA TTAGTC TCT ATC CGT GAC GGT ATG CCT ATG CGT GCT ACC GTG AA; VIII. Take DSPE-mPEG 2000 -FAP was co-incubated with liposome PEG@APS&NDV to form PEG@APS&NDV-FAP Apt Liposomal nanoparticles.

[0008] Furthermore, in step I, HSPC, cholesterol, DSPE-mPEG 2000 The molar ratio of ethanol to chloroform is 8:4:1, and the mass ratio of its total amount to ethanol-chloroform is 1:1.

[0009] Furthermore, in step II, the water temperature of the water bath is 37° C., and the rotation speed of the flask is 100 rpm / min.

[0010] Furthermore, the concentration of the APS drug solution in step III is 50 μg / mL.

[0011] Furthermore, the ultrasonic treatment power described in the preparation method is 100W.

[0012] Furthermore, the NDV added in step IV had a titer of 4.67×10 -13 PFU of NDV.

[0013] Furthermore, in step VII, the shaking incubation is carried out on a shaking table at 4°C and 70 rpm / min for 24 hours.

[0014] Furthermore, the PEG@APS&NDV liposomes obtained in step V were first tested by a hemagglutination inhibition (HI) test. According to the detected HI titer of the liposome PEG@APS&NDV, an appropriate amount of serum antibodies was added to the prepared PEG@APS&NDV liposomes to neutralize the NDV antigens not encapsulated in the liposomes, and then the antibody-neutralized liposomes were collected into an ultrafiltration tube with a MWCO of 100 kDa.

[0015] Furthermore, the centrifugation described in the preparation method is all 4000×g centrifugation.

[0016] Furthermore, in step VII, the concentration of the FAP aptamer is 100 mmol / L, and the DSPE-mPEG 2000 The mass volume ratio of -Mal and FAP aptamers was 5 mg:200 μL.

[0017] Further, the DSPE-mPEG 2000 -The mass ratio of FAP to liposome PEG@APS&NDV was 1:1.

[0018] Accordingly, the present invention also provides a PEG@APS&NDV-FAP Apt The liposome nanoparticles are prepared by the above preparation method.

[0019] Furthermore, the present invention also provides PEG@APS&NDV-FAP Apt The application of liposome nanoparticles in the preparation of anti-liver cancer drugs.

[0020] The beneficial effect of the present invention is that the present invention encapsulates NDV and APS into liposomes and connects FAP aptamers to form PEG@NDV&APS-FAP Apt In the cell experiment, the results of cell proliferation and cytotoxicity, live cell and dead cell staining showed that PEG@NDV&APS-FAP AptIt has a strong anti-tumor effect in vitro and inhibits the proliferation of liver cancer cells. Immunofluorescence staining of cell lysosomes showed that PEG@NDV&APS-FAP Apt It can be engulfed by liver cancer cells and cause lysosomal function defects in liver cancer cells, increased lysosome membrane permeability (LMP), leading to cell dysfunction and death. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The display shows the hemagglutination test to verify the presence of virus and the hemagglutination titer; Figure 2-3 Shown are the results of each group infected with BSR cells under a fluorescence microscope (400×); Figure 4-5 Shown are the results of each group infected with HepG2 cells under fluorescence microscopy (400×); Figure 6 Shown is the killing effect of each group of materials on different cells; Figure 7 Shown are the activity and toxicity detection of HepG2 cells in different experimental groups under fluorescence microscopy (200×); Figure 8-10 Shown are the results of lysosome staining of HepG2 cells in different experimental groups under fluorescence microscope (200×); Fig.11 Shown are mouse animal models (A) Schematic diagram of tumor treatment with different nanomaterials; (B) Changes in average weight of mice in different treatment groups; (C) Changes in average mouse tumor volume in different treatment groups; (D) Changes in average tumor weight in different treatment groups; Fig.12 Shown are images of tumors in mice in different treatment groups after treatment. DETAILED DESCRIPTION

[0024] In order to explain the present invention more clearly, the present invention is further described below in conjunction with preferred embodiments and drawings. It should be understood by those skilled in the art that the content described below is illustrative rather than restrictive, and should not be used to limit the scope of protection of the present invention.

[0025] Unless otherwise specified, the materials in the following examples are commonly used materials in the art and can be obtained from commercial sources.

[0026] Example 1 A PEG@APS&NDV-FAP Apt The method for preparing liposome nanoparticles comprises the following steps: (1) Weigh HSPC, cholesterol, and DSPE-mPEG in a molar ratio of 8:4:1. 2000 , add an appropriate amount of ethanol-chloroform (1:1) to dissolve, and stir for 30 minutes. (If synthesizing liposomes with fluorescence or connected to FAP aptamers, add DID dye or FAP aptamer (FAP Apt )).

[0027] (2) Set the water temperature of the water bath to 37°C, turn on the condenser to make the temperature reach the set value, screw the round-bottom flask to the rotary evaporator adapter and immerse it in the water bath, turn on the rotary switch, and adjust the speed to 100 rpm / min to allow the liposomes to form a uniform film.

[0028] (3) Turn on the vacuum pump and allow the round-bottom flask to rotate in vacuum for about 10 minutes.

[0029] (4) The flask was placed in a vacuum drying oven for 2 h to remove the residual organic solvent and obtain pure liposomes (PEG).

[0030] (5) Add 50 μg / mL APS solution to the round-bottom flask, and resuspend the liposomes by ultrasonication. Then, magnetic stirring is performed at a constant temperature of 37°C for 30 min to allow the APS and liposomes to be fully mixed.

[0031] (6) The liposome suspension obtained in the previous step was sonicated again, with the power set to 100 W and the time set to 20 min.

[0032] (7) The obtained APS liposome suspension was placed in a bottle and a titer of 4.67×10 -13 PFU of NDV was vortexed for 5 minutes to mix thoroughly and allowed to stand at 4°C for 30 minutes.

[0033] (8) The obtained liposome suspension was squeezed 20 times using a 200 nm extrusion membrane to obtain PEG@APS&NDV liposomes with uniform particle size.

[0034] (9) Hemagglutination inhibition (HI) test for detection of Newcastle disease virus antibodies in liposome PEG@APS&NDV: Hemagglutination (HA) test operation method: 1) Add 25 μL PBS to each well of a V-shaped microplate. 2) Add 25 μL NDV to the first well, and then dilute 25 μL of each well horizontally to 11 wells. 3) Add 25 μL PBS to each well. 4) Add 25 μL 1% (V / V) chicken red blood cell suspension to each well. 5) Shake the reaction plate on a shaker for 1 to 2 minutes or tap the reaction plate to mix the reactants, let stand at room temperature (20 to 25°C) for 15 to 30 minutes or (2 to 8°C) for 45 to 60 minutes, and determine the result when the red blood cells in the control well are significantly button-shaped. 6) Result determination: Tilt the reaction plate 60° and observe whether the red blood cells flow in a teardrop-like manner. The highest dilution multiple with no teardrop-like flow (100% agglutination) is the hemagglutination titer, which represents 1 hemagglutination (HAU) unit.

[0035] Hemagglutination inhibition (HI) test operation method: 1) According to the titer of HA determination, calculate and prepare 4 hemagglutination units (4HAU) antigen. 2) In the reaction plate, add 25μL PBS to each well from the 1st to the 11th well; add 50μL PBS to the 12th well. 3) Add 25μL serum to the 1st well, and dilute the serum horizontally to the 10th well by 25μL on the reaction plate. 4) Add 25μL 4HAU antigen to each well from the 1st to the 11th well, and let it stand at room temperature (20-25℃) for 30min or (2-8℃) for 45-60min. 5) Add 25μL 1% (V / V) chicken red blood cell suspension to each well, shake gently to mix, and let it stand at room temperature (20-25℃) for 20-40min or (2-8℃) for 45-60min. When the red blood cells in the control well are obviously button-shaped, the result is determined. 6) Result determination: The highest serum dilution factor that completely inhibits 4HAU antigen is determined as the HI antibody titer of the serum.

[0036] (10) Based on the detected HI titer of liposome PEG@APS&NDV, an appropriate amount of serum antibody was added to the prepared PEG@APS&NDV liposomes to neutralize the NDV that was not encapsulated in the liposomes.

[0037] (11) The antibody-neutralized liposomes were collected into an ultrafiltration tube with a MWCO of 100 kDa and centrifuged at 4000 × g for 10 min to remove free APS.

[0038] (12) Weigh 5 mg DSPE-mPEG 2000 -Mal, take 200 μL of 100 mmol / L FAP AptMix well with it and incubate on a shaker at 70 rpm at 4°C for 24 h. Then add distilled water to wash in an ultrafiltration tube with MWCO 3 kDa, and centrifuge at 4000 × g for 10 min to remove unbound aptamers and collect DSPE-mPEG 2000 -FAP Apt The FAP Apt The gene sequence is: AGC AGC ACA GAG GTC AGA TGC CGC AGG CAG CTG CCA TTA GTC TCT ATC CGT GACGGT ATG CCT ATG CGT GCT ACC GTG AA.

[0039] (13) Take an equal amount of DSPE-mPEG 2000 -FAP Apt Co-incubated with liposome PEG@APS&NDV for 0.5 h to form PEG@APS&NDV-FAP Apt Liposomal nanoparticles.

[0040] The FAP aptamer with Cy5 fluorescent group was combined with PEG@APS&NDV to form PEG@APS&NDV-FAP Apt The liposome vaccine was targeted to HepG2 cells, free FAP was used as a positive control, and the number of fluorescent cells was detected by flow cytometry to calculate the connection rate between FAP and PEG@APS&NDV. The connection rate between PEG@APS&NDV and the aptamer was 87.4%.

[0041] PEG@APS&NDV-FAP was purified by sulfuric acid-phenol method Apt The capacity of APS in PEG@APS&NDV-FAP was identified. Its principle is to use the polysaccharide to hydrolyze into monosaccharide under the action of sulfuric acid, and then quickly dehydrate to form aldehyde derivatives, and then react with phenol to form orange-yellow compounds, and then use colorimetry to measure. The encapsulation efficiency and drug loading of polysaccharide were calculated by the displayed OD value. APS exists in PEG@APS&NDV-FAP Apt The encapsulation efficiency of APS was 46.52% and the drug loading was 8.21%.

[0042] qPCR was used to determine the encapsulation of PEG@APS&NDV-FAP Apt First, the NDV sample with a known concentration of 822.6 ng / μL was diluted to four concentrations, and amplified using a one-step qPCR kit and NDV primers. The formula of the standard curve was Y=0.898X-12.072, R 2=0.9685; then the data was imported into Excel for data analysis, and the PEG@APS&NDV-FAP Apt The concentration of NDV in the medium is 849.5 ng / μL. The PEG@APS&NDV-FAP is calculated based on the known concentration. Apt The encapsulation efficiency was 52.75%.

[0043] Example 2 Experimental groups: PEG, PEG-FAP Apt ,APS,PEG@APS,PEG@APS-FAP Apt , wild-type Newcastle disease virus NDV, NDV+APS, PEG@NDV, PEG@NDV-FAP Apt ,PEG@APS&NDV, PEG@APS&NDV-FAP Apt , and a blank control group with only PBS was set up; PEG, PEG-FAP Apt , PEG@APS, PEG@APS-FAP Apt , NDV+APS, PEG@NDV, PEG@NDV-FAP Apt PEG@APS&NDV is prepared by adaptively adjusting the preparation method provided in Example 1.

[0044] 1. Hemagglutination assay to determine virus titer The preserved wild-type NDV was taken out and thawed under running water. After the SPF chicken embryos were disinfected with iodine tincture and 75% ethanol in a biosafety cabinet, a cone hole was made with an awl (a flashlight was used to illuminate the chicken embryo in a dark environment in advance, and the junction of the chicken embryo air chamber and the allantoic cavity was selected, avoiding the large blood vessels of the chicken embryo, as the puncture point for the needle). 4 TCID 50 Inoculate at a dilution ratio of 200 μL of allantoic fluid per chicken embryo, use a 1 mL syringe to inject into 9-day-old chicken embryos, use wax drops after melting the wax block to wax seal, and return to the incubator for incubation after inoculation. Perform chicken embryo testing for three consecutive days. Monitor the chicken embryos every day. If there are no blood vessels, they are considered dead embryos and are not harvested.

[0045] (1) Collect the allantoic fluid of live embryos on the third day after wild-type NDV virus inoculation, and place the live embryos in a 4°C display cabinet for cold embryo treatment in advance to shrink the blood vessels of the cold embryos and avoid hemolysis of the chicken embryos caused by subsequent operations.

[0046] (2) The chicken embryos were transferred into a biosafety cabinet and disinfected with iodine tincture and 75% ethanol. The air chamber was opened with tweezers, and 50 μL of allantoic fluid was drawn with a pipette for hemagglutination and the hemagglutination titer was tested.

[0047] (3) Prepare 1% chicken red blood cell suspension as described above, label the blood coagulation plate, and use a spray gun to add 50 μL PBS into the blood coagulation plate to set up a negative control.

[0048] (4) Add 50 μL of viral allantoic fluid to the first well of the first column, pipette and mix, then pipette 50 μL into the second well, and dilute in turn to the 12th well. After pipetting and mixing, discard 50 μL of liquid from the 12th well.

[0049] (5) Add 50 μL of 1% chicken red blood cell suspension to each well starting from the 12th column, mix thoroughly, and let stand for 20 minutes.

[0050] (6) Take a photo after 20 minutes to observe the results: Tilt the 96-well plate 90 degrees. If the red blood cells flow without agglutination, this well is negative. If the red blood cells settle to the bottom of the well and spread out in a net-like shape, this well is positive.

[0051] (7) The chicken embryos are harvested based on the hemagglutination results, packaged, and frozen in a -80°C refrigerator for further use.

[0052] Hemagglutination (HA) test results Figure 1 As shown, blank control group, PEG, PEG-FAP Apt ,APS,PEG@APS,PEG@APS-FAP Apt The hemagglutination titer was 2 0 , while the wild-type NDV hemagglutination titer is 2 -12 , NDV+APS hemagglutination titer is 2 -12 , PEG@NDV hemagglutination titer is 2 -9 PEG@NDV-FAP Apt The hemagglutination titer is 2 -9 , PEG@APS&NDV hemagglutination titer is 2 -9 、PEG@APS&NDV-FAP Apt The hemagglutination titer is 2 -9 .

[0053] 2.PEG@APS&NDV-FAP Apt Indirect immunofluorescence validation of targeting to HepG2 cells and BSR cells and toxicity (TCID 50 ) determination (1) HepG2 cells and BSR cells were cultured according to routine procedures, and cell recovery, cell passaging, and cell cryopreservation were performed.

[0054] (2) The two cells were routinely treated and plated in 96-well plates when the cells were in the logarithmic growth phase and the density reached 85%.

[0055] (3) Add 100 μL of cell suspension to each well to make the cell count reach 4000 cells / well, and transfer to a 37°C 5% CO2 constant temperature incubator for overnight culture.

[0056] (4) After the cells adhered, wild-type NDV, NDV+APS, PEG, and PEG-FAP were diluted with 2% serum-containing complete medium. Apt , PEG@APS, PEG@APS-FAP Apt , PEG@NDV, PEG@NDV-FAP Apt ,PEG@APS&NDV, PEG@APS&NDV-FAP Apt : Take 20 EP tubes, add 900 μL of 2% serum-containing complete medium to each tube, add 100 μL of the above group to the first tube, use a pipette to mix well and then add 10 μL of 2% serum-containing complete medium to each tube. -1 , aspirate 100 μL of the diluted solution and add it to the second tube, and then dilute it to 10 in the twelfth well. -12 .

[0057] (5) Add the diluted suspension to a 96-well microplate, inoculate a vertical row of 8 wells for each dilution, and inoculate 100 μL in each well.

[0058] (6) Set up a normal cell control, and make one plate with the normal cell control.

[0059] (7) Observe the cell status daily and perform indirect immunofluorescence after 72 hours.

[0060] (8) Take out the 96-well plate, discard the culture medium, and rinse with PBS three times. Discard the supernatant, add 100 μL of 4% tissue fixative and fix the cells at room temperature for 30 minutes. After discarding the fixative, add PBS to rinse, place the 96-well plate on a shaker at 60-70 rpm for 5 minutes, discard the PBS, and repeat this step three times.

[0061] (9) The ratio of primary antibody was NDV primary antibody: 1% BSA = 1:350.

[0062] (10) Add 20 μL of diluted primary antibody to each well and incubate at 37°C for 30 min. Discard the primary antibody dilution and add 100 μL of 0.05% PBST buffer to each well. Place the 96-well plate on a shaker at 140 rpm for 5 min, then discard the PBST. Repeat this step 3 times.

[0063] (11) The ratio of secondary antibody was goat anti-chicken secondary antibody: 1% BSA = 1:350.

[0064] (12) First, add 20 μL of secondary antibody to each well of the 96-well plate and incubate at 37°C for 30 min. Discard the secondary antibody dilution solution, add 100 μL of 0.05% PBST buffer to each well, place the 96-well plate on a shaker at 140 rpm for 5 min, and then discard the PBST. Repeat this step 3 times.

[0065] (13) Add 20 μL of DAPI working solution to each well of a 96-well plate and incubate at room temperature for 1.5-2 min.

[0066] (14) Discard the DAPI working solution, add 100 μL of PBS buffer to each well, place the 96-well plate on a shaker at 140 rpm for 5 min, and then discard the PBS solution. Repeat this step three times.

[0067] (15) Observe and count the immunofluorescence results of the 96-well plate under an inverted fluorescence microscope and record the number of positive wells.

[0068] (16) Calculation of results: According to the Reed-Muench method.

[0069] Distance ratio = (percentage of lesions above 50% - 50%) / (percentage of lesions above 50% - percentage of lesions below 50%) lgTCID 50 = distance ratio × difference between dilution logarithms + logarithm of dilution with higher than 50% lesion rate.

[0070] The results are as follows Figure 2-5 As shown, obvious green fluorescence (NDV antibody) and syncytia can be seen in BSR cells and HepG2 cells; the cytopathic effect in each well was observed and the results were calculated. Table 1 The results show that the TCID of NDV in BSR cells 50 =4.67×10 -13 / 0.1mL, that is, the virus is diluted 4.67×10 -13 Inoculation of 100 μL can cause 50% of cells to become lesion; TCID of NDV+APS 50 =2.92×10 -12 / 0.1mL, which means the virus will be diluted by 2.92×10 -12 Inoculation of 100 μL can cause 50% of cells to become lesion; TCID 50 =3.08×10 -11 / 0.1mL, which means the virus will be diluted by 3.08×10 -11 Inoculation of 100 μL can cause 50% of cells to become lesional; PEG@NDV-FAP Apt TCID 50 =1.62×10-10 / 0.1mL, which means diluting the virus by 1.62×10 -10 Inoculation of 100 μL can cause 50% of cells to become lesion; TCID of PEG@APS&NDV 50 =4.44×10 -12 / 0.1mL, that is, the virus is diluted 4.44×10 -12 Inoculation of 100 μL can cause 50% of cells to become lesional; PEG@APS&NDV-FAP Apt TCID 50 =2.21×10 -11 / 0.1mL, which means the virus will be diluted by 2.21×10 -11 Inoculation of 100 μL can cause 50% of cells to become diseased. The half-infectious dose of NDV in HepG2 cells is somewhat weaker, but still has a certain degree of infectivity.

[0071] Table 15 TCID of NDV in each group 50 result 3.HepG2 cell phagocytosis experiment (1) If HepG2 cells are observed to have normal morphology and good growth under a microscope, the cells can be digested and used for plating.

[0072] (2) Prepare the consumables required for plating: six-well plates, six-well cell slides, 75% ethanol, cell counting plates, 10 μL pipette tips, 1 mL pipette tips, 15 mL centrifuge tubes, 50 mL centrifuge tubes, Pasteur tubes, and solid and liquid waste containers. First, wipe the table inside the biosafety cabinet with 75% ethanol, disinfect it, and put in the prepared consumables. Turn on the ultraviolet light for 30 minutes.

[0073] (3) After irradiation, open the clean bench and ventilate for 5 minutes. Transfer the HepG2 cells from the incubator to the clean bench, open the T75 bottle and discard the old culture medium in the bottle, wash twice with 1×PBS to remove the residual culture medium in the bottle. Add 1.5-2mL of trypsin to digest the cells. When the cells become round under the microscope, the intercellular gap becomes larger, and the cells fall off, use complete culture medium to stop the effect of trypsin on the cells. Gently and fully rinse the cell growth surface to blow the cells off the wall; use a Pasteur pipette to aspirate the cells and culture medium, centrifuge at 800-1000rpm for 3 minutes, discard the supernatant, and leave the cell pellet. Resuspend the cells with an appropriate amount of serum-free culture medium, centrifuge at 800-1000rpm for 3 minutes again, and repeat the above operation once to wash off the trypsin. Add 10mL of complete culture medium to resuspend the cells, blow and mix well, take 10μL of the cell suspension and 10μL of 0.4% trypan blue, take 10μL and add it to the cell counting plate, and count under an optical microscope. The cell resuspension with the calculated cell density was diluted with complete medium to reach the cell density required for plating (about 1.5×10 for a 6-well plate). 5 / mL) and mix thoroughly by pipetting.

[0074] (4) Open the six-well plate and add 20 μL PBS to the middle of each well. The purpose is to use the suction between PBS and the slide to fix the slide in the well plate and prevent it from moving, so as to prevent the slide from floating when the cell suspension is added. Use tweezers to take out the slide, soak it in 75% ethanol, and then pick it up and burn it on the outer flame of an alcohol lamp to make the slide clean and sterile. Then put the burned slide into the six-well plate, and the slide will be fixed in the well plate and will not move.

[0075] (5) Re-pump the cells to mix well, and add 2 mL to each well of the 6-well plate. After adding, gently shake to make the cell suspension completely cover the slide, mark it, and place it in a 5% CO2, 37°C constant temperature incubator for culture.

[0076] (6) After the plating is completed, the materials were prepared by weighing HSPC, cholesterol, and DSPE-mPEG in a molar ratio of 8:4:1:1:1. 2000 、DID、DSPE-mPEG 2000 -Mal, add appropriate amount of ethanol-chloroform (1:1) to dissolve, and stir for 30 min.

[0077] (7) Turn on the rotary evaporator in advance, turn on the water bath, set the water temperature to 37°C, turn on the condenser to allow the temperature to reach the set value, screw the round-bottom flask onto the rotary evaporator adapter, and close the valve.

[0078] (8) Immerse the round-bottom flask and turn on the rotation switch to start the flask rotating at a speed of 100 rpm / min, so that the liposomes form a uniform film on the surface of the flask. Turn on the vacuum pump and let the round-bottom flask rotate in the vacuum for about 10 minutes.

[0079] (9) Turn off the rotary switch, lift the round-bottom flask out of the water bath, open the condenser, turn off the vacuum, and take out the round-bottom flask.

[0080] (10) The round-bottom flask was placed in a vacuum drying oven and dried overnight to remove the residual organic solvent.

[0081] (11) On the next day, the round-bottom flask was removed, PBS was added to the flask to hydrate the liposomes, and the round-bottom flask was placed in a preheated 37°C ultrasonic cleaner to resuspend the liposomes. A PEG@APS liposome solution was prepared by adding 50 μL of astragalus polysaccharide per 1 mL of liposomes. The solution was magnetically stirred in a 37°C water bath for 30 min. The solution was then placed in a 37°C ultrasonic cleaner for 20 min to make the liposomes homogenous.

[0082] (12) Liposomes and NDV were mixed in appropriate proportions and vortexed at room temperature for 5 min. In order to reduce the size and form liposomes of uniform size, the resulting suspension was loaded into a small liposome squeezer, a 200 nm polycarbonate membrane was loaded into the squeezer, the squeezer was placed in a holder, and the squeezer was slowly pushed left and right for a total of 20 times to collect the PEG@APS&NDV into the corresponding container.

[0083] (13) Take an appropriate amount of serum antibody and add it to the prepared PEG@APS&NDV liposomes to neutralize the NDV antigen not encapsulated in the liposomes. Collect the antibody-neutralized liposomes into an ultrafiltration tube with a MWCO of 100 kDa and centrifuge at 4000×g for 10 min to separate free virus, APS, remaining unreacted antibody serum and PEG@APS&NDV liposomes encapsulating NDV and APS.

[0084] (14) Add 10 μL of the previously prepared DSPE-mPEG per 500 μL of PEG@APS&NDV. 2000 -FAP Apt 10 μL, incubated for 0.5 h to form PEG@APS&NDV-FAP Apt Liposomal nanoparticles.

[0085] (15) After the liposomes are prepared, take out the 6-well plate and observe the density of HepG2 cells on the plate. When the cells grow to about 60% and are evenly distributed, you can add materials for the experiment. Discard the old culture medium in the 6-well plate, wash the cell growth surface with 1× PBS buffer, discard the PBS, and repeat this step twice. After the third wash, discard the PBS, add 950μL of complete culture medium containing 10% fetal bovine serum to each well, and add 50μL of DSPE-mPEG to each well except the blank control group. 2000 -FAP Apt .

[0086] (16) Fix the cells at 0, 2, 4, and 8 hours. Take the 6-well plate out of the incubator, disinfect it with alcohol, and place it in the clean bench. Use a 1 mL pipette to remove the original liquid in the well plate. Gently add PBS along the edge of the well wall to wash away the materials that have not entered the cells. Gently shake and then remove the PBS. Repeat 2-3 times to wash thoroughly. Add 100 μL of 4% paraformaldehyde to fix the cells and fix them at room temperature for 20 minutes. After the cells are fixed, use a 1 mL pipette to remove the 4% paraformaldehyde, add an appropriate amount of PBS for washing, shake on a shaker at 60 rpm for 5 minutes, and wash 3 times in total.

[0087] (17) Remove the slide from the well plate. Since the slide is tightly attached to the bottom of the well plate and the tension is relatively large, the tip of the 1 mL syringe needle can be gently bent to easily separate the slide from the bottom of the well plate. After hooking up the slide, use sterile tweezers to remove the slide from the well plate. Drop a drop of anti-fluorescence quenching agent containing DAPI on the slide, turn the removed slide upside down on the slide, and seal it with transparent nail polish.

[0088] (18) The slides were placed under an inverted fluorescence microscope for imaging. The 405 nm channel was used for DAPI and the 650 nm channel was used for DID.

[0089] The results are as follows Figure 6 As shown in the figure, since DID dye can quickly and stably bind to the phospholipid bilayer in liposomes during synthesis, it can be used to track liposomes. Therefore, when PEG@APS&NDV-FAP is stained with DID Apt After being engulfed by the cells, not only can red fluorescence be observed in the cytoplasm, but also the red fluorescence in the cells can be observed to increase with time.

[0090] 4. Cell proliferation and cytotoxicity experiments on L02 cells and HepG2 cells (1) Observe cell morphology under a microscope. Cells that are in good growth condition can be used for plating.

[0091] (2) Prepare the consumables required for plating: 96-well plates, cell counting plates, 10 μL pipette tips, 1 mL pipette tips, 15 mL centrifuge tubes, 50 mL centrifuge tubes, Pasteur tubes, and solid and liquid waste containers. First, wipe the table inside the biosafety cabinet with 75% ethanol, disinfect it, and put the prepared consumables in. Turn on the ultraviolet light for 30 min.

[0092] (3) After irradiation, open the clean bench and ventilate for 5 minutes. Transfer the HepG2 cells from the incubator to the clean bench, open the T75 bottle and discard the old culture medium in the bottle, wash twice with 1×PBS to remove the residual culture medium in the bottle. Add 1.5-2mL of trypsin to digest the cells. When the cells become round under the microscope, the cell gap becomes larger, and the cells fall off, use complete culture medium to stop the effect of trypsin on the cells. Gently and thoroughly rinse the cell growth surface to blow the cells off the wall; use a Pasteur pipette to aspirate the cells and culture medium, centrifuge at 800-1000rpm for 3 minutes, discard the supernatant after centrifugation, and leave the cell pellet. Resuspend the cells with an appropriate amount of serum-free culture medium, centrifuge at 800-1000rpm for 3 minutes again, and repeat the above operation once to wash away the trypsin. Add 10 mL of complete medium to resuspend the cells, pipette and mix well, take 10 μL of the cell suspension and 10 μL of 0.4% trypan blue, take 10 μL and add it to the cell counting plate, and count under an optical microscope. Dilute the cell resuspended solution with complete medium according to the calculated cell density to reach the cell density required for plating (about 3×10 for 96-well plate). 4 After mixing, pour the cell suspension into a 10 cm cell culture dish, use a spray gun to suck the cell suspension into a 96-well plate, and do not add cell suspension to the outer circle of the 96-well plate. Use PBS to block it to prevent the cell suspension from volatilizing. After disinfecting the 96-well plate with 75% ethanol, place it in a 37°C 5% CO2 constant temperature incubator for culture.

[0093] (4) After 24 hours, the 96-well plate was removed from the incubator, disinfected with alcohol, and placed in a clean bench. The original culture medium was removed using a spray gun. 100 μL of PBS was added to each well for washing, and the PBS was removed using a spray gun.

[0094] (5) NDV, APS, NDV+APS, PEG, PEG-FAP were added to the complete culture medium containing 2% fetal bovine serum. Apt , PEG@APS, PEG@APS-FAP Apt , PEG@NDV, PEG@NDV-FAP Apt ,PEG@APS&NDV, PEG@APS&NDV-FAP AptThe concentrations were adjusted to 10 μL / mL, 10 μL / mL, 20 μL / mL, 10 μL / mL, 10 μL / mL, 10 μL / mL, 10 μL / mL, 67 μL / mL, 67 μL / mL, 67 μL / mL, and 67 μL / mL.

[0095] (6) The experimental groups were set as control group, blank group, NDV, APS, NDV+APS, PEG, and PEG-FAP Apt , PEG@APS, PEG@APS-FAP Apt , PEG@NDV, PEG@NDV-FAP Apt ,PEG@APS&NDV, PEG@APS&NDV-FAP Apt The control group only contained complete culture medium and cells, and the blank group only contained complete culture medium without cells. The diluted drugs and materials were added into the 96-well plate according to the concentration gradient, and the 96-well culture plate was returned to the cell culture incubator for culture.

[0096] (7) Take out the 96-well cell culture plate at 24h, 48h, and 72h, and use a spray gun to suck away the cell culture medium. Prepare a CCK-8 detection solution with a ratio of 1:9 of CCK-8 solution and serum-free culture medium in the dark, and add 100μL of the prepared CCK-8 detection solution to each well with a spray gun, and avoid differences between parallel wells. Place in a cell culture incubator and continue incubation for 1h. You can use an ELISA reader to detect at 24h, 48h, and 72h, and finally select a time point with a more appropriate absorbance range.

[0097] (8) Turn on the microplate reader, add a step, select absorbance, select 450 nm to measure absorbance, and read the sample absorbance.

[0098] The results of HepG2 cells were Figure 6 As shown in A, the number of dead cells did not increase significantly with the increase of the virus infection multiplicity MOI value. Instead, at the same APS concentration, when the MOI value was 1, PEG@APS&NDV-FAP Apt The cell toxicity of PEG@APS&NDV-FAP was greater than that of other groups, which indicated that Apt Can effectively kill tumor cells. PEG, PEG-FAP Apt The killing effect on cells is negligible, which shows that liposomes have good biocompatibility and will not cause great impact on cells. Figure 6 As shown in B, the longer the time, the more obvious the killing effect of nanomaterials on cells.

[0099] The results of L02 cells are as follows Figure 6As shown in C, at the same APS concentration, when the MOI value is 1.25, PEG@APS&NDV-FAP Apt The cell toxicity of PEG@APS&NDV-FAP was greater than that of other groups, and when the MOI value was 1, Apt The killing effect on normal liver cells is minimal, and the survival rate of liver cells is greater than 50%. Figure 6 As shown in D, the longer the time, the more obvious the killing of cells by nanomaterials, but the survival rate of normal liver cells is still more than 50% at 72h. This shows that the killing effect of nanomaterials on normal liver cells is not great, and the killing effect is the lowest when the MOI value is 1.

[0100] It can be seen that when the MOI value is 1, PEG@APS&NDV-FAP Apt It has the most significant killing effect on liver cancer cells and the least killing effect on normal liver cells.

[0101] 5. Live and dead cell staining experiment on HepG2 cells (1) If HepG2 cells are observed to have normal morphology and good growth status under a microscope, the cells can be digested and used for live-dead staining.

[0102] (2) Prepare the consumables required for plating: six-well plates, cell counting plates, 10 μL pipette tips, 1 mL pipette tips, 15 mL centrifuge tubes, 50 mL centrifuge tubes, Pasteur tubes, and solid and liquid waste containers. First, wipe the surface of the biosafety cabinet with 75% ethanol, disinfect it, and place the prepared consumables in the cabinet. Turn on the ultraviolet light for 30 min.

[0103] (3) After irradiation, open the clean bench and ventilate for 5 minutes. Transfer the HepG2 cells from the incubator to the clean bench, open the T75 bottle and discard the old culture medium in the bottle, wash twice with 1×PBS to remove the residual culture medium in the bottle. Add 1.5-2mL of trypsin to digest the cells. When the cells become round under the microscope, the intercellular gap becomes larger, and the cells fall off, use complete culture medium to stop the effect of trypsin on the cells. Gently and fully rinse the cell growth surface to blow the cells off the wall; use a Pasteur pipette to aspirate the cells and culture medium, centrifuge at 800-1000rpm for 3 minutes, discard the supernatant, and leave the cell pellet. Resuspend the cells with an appropriate amount of serum-free culture medium, centrifuge at 800-1000rpm for 3 minutes again, and repeat the above operation once to wash off the trypsin. Add 10mL of complete culture medium to resuspend the cells, blow and mix well, take 10μL of the cell suspension and 10μL of 0.4% trypan blue, take 10μL and add it to the cell counting plate, and count under an optical microscope. The cell resuspension with the calculated cell density was diluted with complete medium to reach the cell density required for plating (about 1.5×10 for a 6-well plate). 52 mL of the cell suspension was added to each well of the 6-well plate, and gently shaken to make the cell suspension completely cover the slide. Mark it and place it in a 5% CO2, 37°C constant temperature incubator for culture.

[0104] (4) After 24 hours of cell attachment, prepare the following groups: NDV, APS, NDV+APS, PEG, PEG-FAP Apt , PEG@APS, PEG@APS-FAP Apt , PEG@NDV, PEG@NDV-FAP Apt ,PEG@APS&NDV, PEG@APS&NDV-FAP Apt Take two 6-well plates, add 900 μL of 2% complete medium containing serum to each well of the plate, add 100 μL of the above group of drugs or materials to each well, gently shake the two 6-well plates, and incubate them in a 37°C 5% CO2 incubator for 12 hours.

[0105] (5) After 12 hours, transfer the six-well plate from the incubator to the clean bench after disinfection with 75% ethanol. Use a 1mL pipette to remove the culture medium with materials and transfer it to the 50mL centrifuge tubes marked for each group. Gently add PBS along the edge of the well wall to wash away the materials that have not entered the cells. After gently shaking, remove the PBS and collect the PBS into the 50mL centrifuge tubes for each group. Repeat 2-3 times and wash thoroughly. Add 1.5-2mL of trypsin to digest the cells. When the cells become round under the microscope, the cell gap becomes larger, and the cells fall off, use complete culture medium to stop the effect of trypsin on the cells. Gently and fully rinse the cell growth surface to blow the cells off the wall; use a Pasteur pipette to remove the cells and culture medium and collect them into the 50mL centrifuge tubes for each group. Centrifuge at 800-1000rpm for 3 minutes. After centrifugation, discard the supernatant and leave the cell pellet.

[0106] (6) Take out 10× Assay Buffer from the -20℃ refrigerator, thaw it, take out an appropriate amount under sterile conditions according to the single dose, and dilute it 10 times with deionized water to obtain 1× Assay Buffer. Calcein-AM has been packaged into small aliquots upon receipt and stored at -20℃ in a sealed and dark place.

[0107] (7) Wash the cells with 1× Assay Buffer, centrifuge at 450g for 5 min, and repeat the 1× Assay Buffer washing operation twice to remove trypsin and esterase. Centrifuge again and resuspend the cell pellet with 1× Assay Buffer so that the number of cells in each group after resuspension is 1×10 5-6Add 1-2 μL of Calcein-AM to every 1 mL of cells, mix well by pipetting, and incubate at 37°C in the dark for 20 min-25 min.

[0108] (8) Take 3-5 μL of the PI provided by the kit and add it to the above-stained cells. Stain for 5 min at room temperature in the dark. Centrifuge the cells after fluorescence incubation at 450×g for 5 min and remove the staining solution.

[0109] (9) Wash the cells with 1× PBS and centrifuge again at 450×g for 5 min. Resuspend the pellet in about 20 μL of 1× PBS and add a trace amount of anti-fluorescence quencher. Take 3-5 μL and drop it on a clean glass slide. Press the slide with a clean coverslip and then examine it under a fluorescence microscope.

[0110] (10) The slide was placed under an inverted fluorescence microscope for imaging. Calcein-AM was imaged at 490 nm and PI was imaged at 535 nm, which represent the colors of the fluorescent markers for live cells and dead cells, respectively.

[0111] The results are as follows Figure 7 As shown, the cells were treated in different groups according to the experiment. There was almost no cell death in the control group, while in the PEG group and PEG-FAP group, the cells Apt Only a small number of cells in the group died, indicating that the liposomes have good biosafety. Apt , wild-type Newcastle disease virus NDV, NDV+APS, PEG@NDV, PEG@NDV-FAP Apt ,PEG@APS&NDV, PEG@APS&NDV-FAP Apt The cells in each group showed different degrees of death, and the number of dead cells PEG@APS&NDV-FAP Apt >PEG@APS&NDV>PEG@NDV-FAP Apt >PEG@NDV>NDV>NDV+APS>PEG@APS-FAP Apt >PEG@APS>APS>PEG-FAP Apt >PEG, description of PEG@APS&NDV-FAP Apt Can effectively kill tumor cells.

[0112] 6. Lysosome staining experiment on HepG2 cells (1) Observe cell morphology under a microscope. Cells that are in good growth condition can be used for plating.

[0113] (2) Prepare the consumables required for plating: six-well plates, six-well cell slides, 75% ethanol, cell counting plates, 10 μL pipette tips, 1 mL pipette tips, 15 mL centrifuge tubes, 50 mL centrifuge tubes, Pasteur tubes, and solid and liquid waste containers. First, wipe the table inside the biosafety cabinet with 75% ethanol, disinfect it, and put in the prepared consumables. Turn on the ultraviolet light for 30 minutes.

[0114] (3) After irradiation, open the clean bench and ventilate for 5 minutes. Transfer the HepG2 cells from the incubator to the clean bench, open the T75 bottle and discard the old culture medium in the bottle, wash twice with 1×PBS to remove the residual culture medium in the bottle. Add 1.5-2mL of trypsin to digest the cells. When the cells become round under the microscope, the cell gap becomes larger, and the cells fall off, use complete culture medium to stop the effect of trypsin on the cells. Gently and thoroughly rinse the cell growth surface to blow the cells off the wall; use a Pasteur pipette to aspirate the cells and culture medium, centrifuge at 800-1000rpm for 3 minutes, discard the supernatant after centrifugation, and leave the cell pellet. Resuspend the cells with an appropriate amount of serum-free culture medium, centrifuge at 800-1000rpm for 3 minutes again, and repeat the above operation once to wash away the trypsin. Add 10 mL of complete medium to resuspend the cells, pipette and mix well, take 10 μL of the cell suspension and 10 μL of 0.4% trypan blue, take 10 μL and add it to the cell counting plate, and count under an optical microscope. Dilute the cell resuspended solution with complete medium according to the calculated cell density to reach the cell density required for plating (about 1.5×10 for 6-well plate). 5 / mL), and mix thoroughly by pipetting.

[0115] (4) Open the six-well plate and add 20 μL PBS to the middle of each well. The purpose is to use the suction between PBS and the slide to fix the slide in the well plate and prevent it from moving, so as to prevent the slide from floating when the cell suspension is added. Use tweezers to take out the slide, soak it in 75% ethanol, and then pick it up and burn it on the outer flame of an alcohol lamp to make the slide clean and sterile. Then put the burned slide into the six-well plate, and the slide will be fixed in the well plate and will not move.

[0116] (5) Take out the 6-well plate and observe the density of HepG2 cells on the slide. When the cells grow to about 60% and are evenly distributed, you can add materials for the experiment. Mix the cells again by pipetting, and add 2 mL to each well of the 6-well plate. After adding, gently shake to make the cell suspension completely cover the slide, write a mark, and place it in a 5% CO2, 37°C constant temperature incubator for culture.

[0117] (6) After 24 hours of cell attachment, prepare the following groups: NDV, APS, NDV+APS, PEG, PEG-FAP Apt , PEG@APS, PEG@APS-FAPApt , PEG@NDV, PEG@NDV-FAP Apt ,PEG@APS&NDV, PEG@APS&NDV-FAP Apt Take two 6-well plates, add 900 μL of 2% complete medium containing serum to each well of the plate, add 100 μL of the above group of drugs or materials to each well, gently shake the two 6-well plates, and incubate them in a 37°C 5% CO2 incubator for 8 hours.

[0118] (7) Take the Lyso-Tracker Green dye solution out of the 4°C refrigerator and incubate it in a 20-25°C water bath for 20 minutes. After the dye is completely dissolved, centrifuge for a few seconds to allow the dye solution to fully settle to the bottom of the tube. After 20 minutes, take a small amount of Lyso-Tracker Green and add it to the complete culture medium at a ratio of 1:20,000, so that its final concentration is 75nM. For example, take 1μL Lyso-Tracker Green and add it to 13.33mL culture medium. After mixing, it is the Lyso-Tracker Green working solution. The Lyso-Tracker Green working solution needs to be pre-incubated at 37°C before use.

[0119] (8) After incubation for 8 hours, take out the six-well plate, disinfect it with alcohol and put it in the clean bench, use a 1mL pipette tip to suck out the original liquid in the well plate, gently add PBS along the edge of the well wall, wash off the culture medium mixed with materials or drugs, shake gently and suck out PBS, repeat 2-3 times, and wash gently. Add the Lyso-Tracker Green staining working solution prepared in step 7 and pre-incubated at 37°C, incubate with the cells in the six-well plate for 60 minutes, and put it in a 37°C 5% CO2 incubator. After 60 minutes, take out the six-well plate, disinfect it with 75% ethanol and put it in the clean bench, use a 1mL pipette tip to suck out the staining working solution, gently add fresh cell culture medium along the edge of the well wall for washing, shake on a shaker at 60rpm for 5 minutes, and wash 3 times in total. For the third time, add 10μL Hoechst 33342 live cell staining solution to 1mL of culture medium in each well. Put the six-well plate in a 37°C 5% CO2 incubator and incubate for 10 minutes. After 10 minutes, the six-well plate was taken out, disinfected with 75% ethanol and placed in a clean bench, the culture medium containing Hoechst 33342 live cell staining solution was removed, and the plate was rinsed twice with PBS.

[0120] (9) Remove the slide from the well plate. Since the slide is tightly attached to the bottom of the well plate and the tension is relatively large, the tip of the 1mL syringe needle can be gently bent to easily separate the slide from the bottom of the well plate. After hooking up the slide, use sterile tweezers to remove the slide from the well plate. Drop a drop of anti-fluorescence quenching agent on the slide, turn the removed slide upside down on the slide, and seal it with transparent nail polish.

[0121] (10) Place the slide under an inverted fluorescence microscope for imaging. Use the 346 nm channel for Hoechst and the 504 nm channel for Lyso-Tracker Green, which represent the staining of the cell nucleus and lysosome, respectively.

[0122] The results are as follows Figure 8-10 As shown, cells were treated in different groups according to the experiment, control group, PEG group, PEG-FAP group Apt group, APS group, PEG@APS group, PEG@APS-FAP Apt The lysosomes in the group showed strong green fluorescence, indicating that the liposomes had good biosafety. Liposomes and APS had no effect on the intracellular lysosomes, while wild-type Newcastle disease virus NDV, NDV+APS, PEG@NDV, and PEG@NDV-FAP Apt ,PEG@APS&NDV, PEG@APS&NDV-FAP Apt The cells in each group showed different degrees of fluorescence brightness reduction, among which PEG@APS&NDV-FAP Apt The green fluorescence is the weakest. Lyso-Tracker Green is used to label the acidic components in the cell lysosomes. The nanoparticles loaded with NDV include PEG@APS&NDV-FAP Apt Both can lead to the loss of acidic components in lysosomes of liver cancer cells in immunofluorescence, and the fluorescence intensity of Lysotracker Green decreases. When the acidic components in lysosomes leak out and acidification decreases, it will cause acute death of liver cancer cells. Apt The acute degree of death is the most obvious.

[0123] The above test results fully prove that PEG@APS&NDV-FAP Apt The excellent performance in inhibiting the growth of liver cancer cells and revealing its possible mechanism of action, namely, inducing lysosomal membrane permeabilization of liver cancer cells, thereby triggering acute cell death Example 3 PEG@APS&NDV-FAP Apt In vivo tumor cell killing experiment method: 1. Construction of small animal model (1) Five-week-old nude mice were selected and housed in an SPF-grade animal room at the animal center. Tumor-bearing experiments were performed after 3-7 days of feeding.

[0124] (2) Cultivate HepG2 cells, digest and collect cells in the logarithmic growth phase, resuspend the cells in PBS, and adjust the cell density to a concentration of 10 7 After the cells were collected, they were kept on ice to maintain the cells in a low metabolic state.

[0125] (3) Use an alcohol cotton ball to wipe the left armpit of the mouse for disinfection, empty the air in the syringe, insert the needle, and inject the cell suspension subcutaneously, about 100 μL. After the injection is completed, gently rotate the needle and slowly withdraw the needle to prevent the cell suspension from overflowing.

[0126] 2. Tumor Volume Measurement (1) Tumor-bearing mice were randomly divided into 12 groups: PBS group, PEG group, PEG-FAP group Apt group, APS group, PEG@APS group, PEG@APS-FAP Apt group, wild-type NDV group, NDV+APS group, PEG@NDV group, PEG@NDV-FAP group Apt Group, PEG@APS&NDV group, PEG@APS&NDV-FAP Apt Group.

[0127] (2) The length and width of the mouse tumor were measured with a vernier caliper on days 7, 9, 11, 13, 15, 17, 19, and 21 after tumor loading. Mouse tumor volume = (length * width 2 ) / 2 3. Mouse Weight Measurement (1) Tumor-bearing mice were randomly divided into 12 groups: PBS group, PEG group, PEG-FAP group Apt group, APS group, PEG@APS group, PEG@APS-FAP Apt group, wild-type NDV group, NDV+APS group, PEG@NDV group, PEG@NDV-FAP group Apt Group, PEG@APS&NDV group, PEG@APS&NDV-FAP Apt Group.

[0128] (2) The body weight of mice was measured and recorded on days 7, 9, 11, 13, 15, 17, 19, and 21 after tumor loading.

[0129] 4. Measurement of Mouse Tumor Weight (1) Tumor-bearing mice were randomly divided into 12 groups: PBS group, PEG group, PEG-FAP group Aptgroup, APS group, PEG@APS group, PEG@APS-FAP Apt group, wild-type NDV group, NDV+APS group, PEG@NDV group, PEG@NDV-FAP group Apt Group, PEG@APS&NDV group, PEG@APS&NDV-FAP Apt Group.

[0130] (2) On the 21st day of tumor bearing, the mice were killed, the tumors were removed, and the weight of the tumors was recorded.

[0131] like Fig.11 As shown in A, we first injected HepG2 cells subcutaneously into mice, then treated the mice differently, and finally observed the changes in tumor volume, mouse body weight, etc. in each group of mice.

[0132] The weight changes of mice Fig.11 As shown in B, the mice in each group showed a trend of increasing body weight. Fig.11 As shown in C, the tumor growth rate of mice in the PBS group was greater than that of mice in other groups during treatment, among which PEG@APS&NDV-FAP Apt The growth of tumor volume in mice of the 1:1 group was the smallest.

[0133] After the treatment, we removed the tumors from each group of mice and weighed the weight of each tumor using a balance. Fig.11 As shown in D, the tumor weight of mice in the PBS group was the largest, and PEG@APS&NDV-FAP Apt The tumor weight of mice in the group was the smallest, which proved that PEG@APS&NDV-FAP Apt It has excellent anti-tumor effect. Visually compare the changes in tumor size before and after treatment in mice, such as Fig.12 As shown, the tumors in the PBS group were significantly larger than those in the other groups, and the tumors in the PEG@APS&NDV-FAP group were significantly larger than those in the other groups. Apt The tumors in the PEG@APS&NDV-FAP group were significantly smaller than those in any other group. Apt It can obviously kill tumors and has a good inhibitory effect on tumor growth.

[0134] Although the above embodiments have been described, once those skilled in the art know the basic creative concepts, they can make additional changes and modifications to these embodiments. Therefore, the above description is only an embodiment of the present invention and does not limit the patent protection scope of the present invention. Any equivalent structure or equivalent process transformation made by using the contents of the specification and drawings of the present invention, or directly or indirectly used in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A method for preparing PEG@APS&NDV-FAPApt liposome nanoparticles, characterized in that: The following steps are involved: Ⅰ. Pour HSPC, cholesterol and DSPE-mPEG2000 into a flask, add appropriate amount of ethanol-chloroform to dissolve, and stir; Ⅱ. Immerse the flask in a water bath and connect it to the rotary evaporator adapter. After rotating until the liposomes form a uniform film on the surface of the flask, turn on the vacuum pump and let the round-bottom flask rotate in a vacuum for 8-12 minutes; Ⅲ. Take out the flask from the water bath and put it in a vacuum drying oven to dry, remove the residual organic solvent, and obtain pure liposome PEG; then add APS drug solution to the flask, ultrasonically hydrate and resuspend the liposomes, and magnetically stir to fully mix APS and liposomes; Ⅳ. After the stirred liposome suspension with APS is ultrasonically treated again for 15-25 minutes, the obtained APS liposome suspension is put into a bottle, NDV is added, vortexed to mix thoroughly, and then allowed to stand at 4°C for 25-35 minutes; Ⅴ. Use a 200nm extrusion membrane to squeeze and push multiple times to obtain liposome suspension to obtain PEG@APS&NDV liposomes with uniform particle size; VI. Collect the PEG@APS&NDV liposomes into an ultrafiltration tube with a MWCO of 100 kDa, centrifuge for 8-12 minutes, and remove free APS; VII. Mix DSPE-mPEG2000-Mal and FAP aptamer, incubate on a shaking table to accelerate the mixing reaction, then add distilled water to wash in an ultrafiltration tube with a MWCO of 3 kDa, and centrifuge to remove unreacted compounds to obtain DSPE-mPEG2000-FAP; the gene sequence of the FAP aptamer is: AGCAGCAGAGTCAGATGCCGCAGGCAGCTGCCATTAGTCTCTATCCGTGACGGTAT GCCTATGCGTGCTACCGTGAA; VIII. Co-incubate DSPE-mPEG2000-FAP with liposome PEG@APS&NDV to form PEG@APS&NDV-FAPApt liposome nanoparticles.

2. The preparation method according to claim 1, characterized in that: In step I, the molar ratio of HSPC, cholesterol, and DSPE-mPEG2000 is 8:4:1, and the mass ratio of their total amount to ethanol-chloroform is 1:1; and / or, in step II, the water temperature of the water bath is 37°C, and the rotation rate of the flask is 100 rpm / min; and / or, the concentration of the APS drug solution described in step III is 50 μg / mL; and / or, the ultrasonic treatment power described in the preparation method is 100 W; and / or, the NDV added in step IV is NDV with a titer of 4.67×10-13 PFU; and / or, in step VII, the shaking incubation is incubated on a shaking table at 70 rpm / min at 4°C for 24 hours; and / or, the centrifugation described in the preparation method is 4000×g centrifugation.

3. The preparation method according to claim 1, characterized in that: The PEG@APS&NDV liposomes obtained in step V were first tested by hemagglutination inhibition (HI) test. According to the HI titer of the detected liposome PEG@APS&NDV, an appropriate amount of serum antibodies was added to the prepared PEG@APS&NDV liposomes to neutralize the NDV antigens not encapsulated in the liposomes. The antibody-neutralized liposomes were then collected into an ultrafiltration tube with a MWCO of 100 kDa.

4. The preparation method according to claim 1, characterized in that: The concentration of the FAP aptamer in step VII is 100 mmol / L, and the mass volume ratio of the DSPE-mPEG2000-Mal and the FAP aptamer is 5 mg:200 μL.

5. The preparation method according to claim 1, characterized in that: The mass ratio of DSPE-mPEG2000-FAP to liposome PEG@APS&NDV described in step VIII is 1:

1.

6. A PEG@APS&NDV-FAPApt liposome nanoparticle prepared by the preparation method described in any one of claims 1-3.

7. The use of the PEG@APS&NDV-FAPApt liposome nanoparticles according to claim 6, characterized in that: Application in the preparation of anti-liver cancer drugs.

Images