Application of simultaneously destroying HBB competition and HBG apparent silencing in treatment of beta-hemoglobin disease

Abstract

The invention discloses an application of simultaneously destroying HBB competition and HBG apparent silencing in treatment of beta-hemoglobin disease, and finds for the first time that expression conversion of gamma-globin to beta-globin can be completely reversed by destroying interaction between HBB and LCR and simultaneously relieving apparent silencing on HBG. The discovery has an important clinical application prospect in the field of beta-hemoglobin disease gene therapy.

Description

Technical Field

[0001] The invention belongs to the field of biomedical technology, and particularly relates to the application of simultaneously destroying HBB competition and HBG epigenetic silencing in treating beta-hemoglobinopathy. Background Art

[0002] During human development, along with the migration of hematopoietic sites, the main type of hemoglobin in red blood cells changes from fetal hemoglobin (HbF, α2γ2) to adult hemoglobin (HbA, α2β2). This process of transcriptional change from γ-globin (HBG) to β-globin (HBB) is called the γ-to-β-globin expression switch. β-Hemoglobinopathies (mainly including β-thalassemia and sickle cell anemia) caused by mutations in HBB are recognized as the largest single gene genetic diseases in the world, which have brought a huge burden to public health. Activating HbF in adulthood can alleviate the clinical symptoms of β-hemoglobinopathies and become a potential treatment for the disease. Therefore, the epigenetic silencing of HBG, which is mainly mediated by BCL11A in the γ-to-β-globin expression switch, has been extensively studied. Previous studies have achieved partial reversal of the γ-to-β-globin expression switch, and theoretically, HbF can be increased to a maximum level of about 60%.

[0003] However, whether the switch from γ- to β-globin expression can be completely reversed remains unknown. Although gene competition and autonomous silencing have been found in the switch from γ- to β-globin expression, the regulatory mechanism remains unclear. The locus control region (LCR), as a super enhancer, enhances globin gene expression by forming a chromatin loop, which brings the LCR into physical proximity with the globin gene. During the switch of globin gene expression, changes in chromatin conformation occur, and the LCR can only interact with one globin gene promoter at a time. Competition between γ- and β-globin genes for binding to the LCR determines the expression pattern of globin genes. Many lines of evidence show that the enhancement of the interaction between HBG and LCR can weaken the interaction between HBB and LCR, accompanied by a decrease in β-globin expression.

[0004] The present invention achieves the first complete reversal of the γ-to-β-globin expression switch by disrupting the interaction between HBB and LCR while removing the epigenetic silencing on HBG. This discovery provides important insights into the γ-to-β-globin expression switch, provides new methods for manipulating this process, and provides a new treatment strategy for β-hemoglobin diseases. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a method for simultaneously destroying HBB competition and HBG epigenetic silencing in the treatment of β-hemoglobinopathies.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides the use of an agent that simultaneously disrupts HBB competition and HBG epigenetic silencing in the preparation of a drug for treating β-hemoglobinopathies;

[0008] The simultaneous disruption of HBB competition and HBG epigenetic silencing is achieved by disrupting the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter.

[0009] Furthermore, the simultaneous disruption of HBB competition and HBG apparent silencing is achieved by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter.

[0010] Further, the types of mutations include deletion, substitution, insertion, inversion, duplication and / or translocation mutations;

[0011] Preferably, the deletion mutation comprises removing one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0012] Preferably, the substitution mutation comprises replacing one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter with other bases;

[0013] Preferably, the insertion mutation comprises inserting one or more bases at any position in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0014] Preferably, the inversion mutation comprises the inversion of one or more base positions in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0015] Preferably, the repeat mutation comprises the repeat of one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0016] Preferably, the translocation mutation comprises one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter moving from one position to another.

[0017] Further, the deletion mutation is to mutate the CACCC element on the HBB promoter to any one of the complete deletions of CAC, CC, CACC, C, ACCC, CCC, CACCCc, CAaCCC, CACtCC, CACacattggCC, CACTC, CACT or CACCC elements, and to mutate the TGACCA element on the HBG promoter to any one of the complete deletions of TGACA, TGAA, TGAC, TGA, TG, CCA, T, CA, A, TGAtCCA, TGAcaaggctattgCCA, TGAaCCA, TGaA or TGACCA;

[0018] Preferably, the replacement mutation is to mutate the CACCC element on the HBB promoter into any one of TACCC, CATCC, CACTC, CACCT, TATCC, TACTC, TACCT, CATTC, CATCT, CACTT, TATTC, TATCT, TACTT, CATTT or TATTT, and to mutate the TGACCA element on the HBG promoter into any one of TAACCA, TGATCA, TGACTA or TGATTA.

[0019] Further, the deletion mutation can be achieved by applying CRISPR-Cas9 gene editing technology. CRISPR / Cas9 is a gene editing technology developed based on the natural immune mechanism of bacteria. The simplified and modified CRISPR system consists of two parts: nuclease Cas9 and gRNA (Guide RNA, gRNA). Cas9 can recognize and bind to the protospacer adjacent motif (PAM) on the genome and form a double-stranded DNA unwinding. At this time, the crRNA part of the gRNA can successfully complement the upstream sequence of the PAM, and Cas9 will activate its nuclease activity to form a double-stranded DNA break (DBS) at a specific position upstream of the PAM. DBS can activate the cell's DNA damage repair mechanism, non-homologous end joining (NHEJ) or homologous recombination-mediated repair (HDR). NHEJ, that is, error-prone repair, will cause random insertions or deletions at the repair site, causing frameshift mutations, so that the gene is no longer expressed, thereby forming a gene knockout. HDR, or precise repair, can mediate gene replacement or insertion with the help of exogenously introduced single-stranded or double-stranded DNA as a template. This method can precisely insert a DNA sequence into a specific genomic site, thereby completing gene knock-in or replacement.

[0020] Further, the replacement mutation is achieved by gene editing technology known to those skilled in the art, including but not limited to: single-base gene editing technology, CRISPR-Cas9 gene editing technology. In some embodiments, the replacement mutation is achieved by single-base gene editing technology, which refers to a gene editing technology that can cause a single base change in the genome, and its basic principle is to fuse cytosine deaminase (APOBEC) or adenosine deaminase with existing Cas9n (D10A) to form a gene editing technology that relies on the CRISPR principle to modify a single base at positions 4-7 away from the PAM end of the target. At present, single-base gene editing technology includes two types: pyrimidine base conversion technology (C / G to T / A) and purine base conversion technology (A / T to G / C).

[0021] Furthermore, the simultaneous disruption of HBB competition and HBG epigenetic silencing enables complete reversal of the switch from γ- to β-globin expression.

[0022] In a specific embodiment of the present invention, the competitive inhibition between HBB and HBG and the apparent silencing on HBG are simultaneously destroyed by mutating the CACCC element on HBB and the TGACCA element on HBG, thereby achieving a complete reversal of the conversion of γ- to β-globin expression. In addition, the combined editing of the CACCC element on HBB and the TGACCA element on HBG can increase HbF expression to nearly 100% of the total hemoglobin level, which is significantly higher than the highest level of HbF that can be theoretically increased in the art (60%). This method provides a precise and efficient treatment strategy for the clinical treatment of β-hemoglobinopathies.

[0023] In some embodiments, any method capable of destroying the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter is within the scope of protection of the present invention, including but not limited to mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter. In other embodiments, any mutation method of the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter is within the scope of protection of the present invention, as long as any mutation method capable of simultaneously destroying the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter falls within the scope of protection of the present invention, and it should be noted that it is not limited to the exemplary specific mutations performed in the embodiments.

[0024] A second aspect of the present invention provides a pharmaceutical composition for treating β-hemoglobinopathies.

[0025] Further, the pharmaceutical composition comprises the agent described in the first aspect of the present invention;

[0026] Preferably, the agent achieves complete reversal of the switch from γ- to β-globin expression by simultaneously disrupting HBB competition and HBG epigenetic silencing.

[0027] Furthermore, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0028] In some embodiments, the pharmaceutically acceptable carriers and / or excipients are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995). These substances are used to help the stability of the formulation or to help improve the biological effectiveness of the active substance, etc. The pharmaceutical composition thus formulated can be administered by any appropriate administration method known to those skilled in the art as needed.

[0029] In some embodiments, non-limiting examples of the pharmaceutically acceptable carrier and / or excipient include, but are not limited to, preservatives, chemical stabilizers, pH regulators, surfactants, adjuvants, and ionic strength enhancers. For example, preservatives include, but are not limited to, chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, vanillin, glycerol, carbolic acid, and parachlorophenol; chemical stabilizers include, but are not limited to, gelatin, albumin, citric acid, malic acid, and calcium bicarbonate; pH regulators include, but are not limited to, phosphate buffer, citrate buffer, and borate buffer; surfactants include, but are not limited to, cationic, anionic, and nonionic surfactants, such as Tween-80; and ionic strength enhancers include, but are not limited to, sodium chloride, potassium chloride, and calcium chloride.

[0030] A third aspect of the present invention provides a pharmaceutical preparation for treating β-hemoglobinopathies.

[0031] Furthermore, the pharmaceutical preparation comprises the pharmaceutical composition described in the second aspect of the present invention.

[0032] In some embodiments, the dosage form of the pharmaceutical preparation includes, but is not limited to, injection, tablet, capsule, pill, suppository, aerosol, oral liquid preparation, granule, powder, sustained-release preparation, nanoformulation, syrup, wine, tincture, dew.

[0033] In some embodiments, the pharmaceutical preparation of the present invention can be prepared by conventional preparation methods well known to those skilled in the art, such as mixing the active ingredients, or mixing the active ingredients with the corresponding excipients according to conventional preparation methods of various dosage forms. The pharmaceutical composition of the present invention can also be used together with other drugs or compounds that can be used for the treatment and / or adjuvant treatment of β-hemoglobinopathies.

[0034] In the present invention, there is no particular limitation on the administration method of the pharmaceutical composition or pharmaceutical preparation. In some embodiments, the administration method of the pharmaceutical composition or pharmaceutical preparation includes, but is not limited to, injection, infusion, drip or ingestion. Injection includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebral spinal and intrasternal injection and infusion.

[0035] A fourth aspect of the present invention provides an in vitro method for completely reversing the switch of γ- to β-globin expression for non-therapeutic purposes.

[0036] Furthermore, the method is to completely reverse the conversion of γ- to β-globin expression by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0037] Preferably, the mutation is as described in the first aspect of the present invention.

[0038] The fifth aspect of the present invention provides a method for promoting γ-globin expression and inhibiting β-globin expression for non-therapeutic purposes in vitro.

[0039] Further, the method is achieved by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter;

[0040] Preferably, the mutation is as described in the first aspect of the present invention.

[0041] In addition, the present invention also provides a method for treating β-hemoglobinopathies, which is achieved by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter in the hematopoietic stem cells of the bone marrow of a subject in need thereof, wherein the mutation is as described in the first aspect of the present invention.

[0042] In the present invention, the subject may be a mammal or a non-mammal. The mammal is preferably a rodent, an artiodactyl, a perissodactyl, a lagomorph, a primate, etc. The primate is preferably a monkey, an ape or a human. In a specific embodiment of the present invention, the subject is preferably a human.

[0043] In the present invention, the β-hemoglobinopathies refer to any disease or disorder associated with β-hemoglobinopathies, including but not limited to: β-thalassemia, sickle cell anemia, sickle cell trait, hemoglobin C disease, hemoglobin C trait, hemoglobin S / C disease, hemoglobin D disease, hemoglobin E disease, hemoglobin-related disorders with increased oxygen affinity, hemoglobin-related disorders with decreased oxygen affinity, unstable hemoglobinopathies, methemoglobinopathies, in addition, the β-hemoglobinopathies also include one or more symptoms associated with β-hemoglobinopathies, the symptoms include but are not limited to: anemia, tissue hypoxia, organ dysfunction, abnormal hematocrit values, inefficient erythropoiesis, abnormal reticulocyte (red blood cell) count, abnormal iron load, the presence of ring sideroblasts, splenomegaly, hepatomegaly, impaired peripheral blood flow, dyspnea, increased hemolysis, jaundice, anemic pain crisis (anemic pain crisis) crise), acute chest syndrome, splenic sequestration, stroke, hand-foot syndrome, and pain such as angina.

[0044] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0045] The present invention first discovered that disrupting the interaction between HBB and LCR while removing the apparent silencing on HBG can completely reverse the conversion of γ- to β-globin expression. This discovery provides a comprehensive description of globin expression conversion and a new treatment strategy for β-hemoglobinopathy, with good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1To destroy the CACCC element on the HBB promoter and induce HbF expression, Figure a: CRISPR-Cas9 screening for elements that can enhance HbF expression in HUDEP2 cells, the y-axis represents the log2 (FC) of gRNA, targeting HBB and HBD homologous sequences, the proximal CACCC element on HBB, and the distal CACCC element are highlighted with blue dots, red dots, and orange dots, respectively; Figure b: Mutation of the CACCC element on the HBB promoter in the population leads to high-level expression of HbF, editing the CACCC element and TGACCA element in HUDEP2 cells, PM-gRNA-1 , PM-gRNA-2, DM and GM editing efficiencies were 79.1%, 67.4%, 45.4% and 83.4%, respectively; c: HPLC was used to detect the HbF level in HUDEP2 after editing; d: Flow cytometry analysis of F cell ratio; e: The same editing was performed in CD34+HSPCs, and the editing efficiencies of PM-gRNA-1, DM and GM were 77.6%, 12.9% and 72.7%, respectively, and then the expression of β-globin relative to β-actin was detected; f: 3C analysis results; g: ChIP-qPCR analysis results;

[0047] Figure 2 To destroy the CACCC element and induce HbF expression, Figure a: Schematic diagram of the process of CRISPR-Cas9 screening in HUDEP2 cells; Figure b: Top 20 gRNAs enriched by CRISPR screening in HUDEP2 cells; Figure c: Editing CACCC elements and TGACCA elements in HUDEP2 cells, and then detecting the expression of β-globin relative to β-actin in the edited HUDEP2 cells; Figure d: Binding of KLF1 on HBB; Figure e: The same editing was performed in CD34+HSPCs, and ChIP-qPCR analysis was performed;

[0048] Figure 3 Disruption of the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter can completely reverse the conversion of γ- to β-globin expression, where: a: Combinatorial editing was performed in HUDEP2 cells to detect the expression of β-globin relative to β-actin; b: Detection of the expression of β-globin relative to β-actin in edited HUDEP2 monoclonal cells; c: HPLC detection of HbF expression in four of the monoclonal cells; d: ChIP-qPCR detection results; e: 3C detection results;

[0049] Figure 4In order to destroy the CACCC element on HBB and the TGACCA element on HBG, HbF expression was greatly improved. Figure a: Combinatorial editing was performed in HUDEP2 cells, and the level of HbF was detected by HPLC; Figure b: Flow cytometry analysis of the proportion of F cells; Figure c: Results of CRISPR screening in GM-Clone13 cells; Figure d: Analysis of the binding of KLF1 on HBB;

[0050] Figure 5 To achieve complete reversal of the switch from γ-globin to β-globin expression in β-BAC mice, Figure a: Establishment of β-BAC mouse strain and corresponding site-edited BAC mouse strain, Figure b: Detection of β-globin expression relative to β-actin in mice from embryonic day 10.5 to the newborn stage;

[0051] Figure 6 To enhance HbF expression in primary erythroid cells by combined disruption of CACCC and TGACCA elements, Figure a: Combined editing in CD34+ cells from normal human peripheral blood, and 12 days of in vitro erythroid differentiation, the HbF expression level was detected by HPLC; Figure b: Erythroid differentiation was detected by CD71 and CD235; Figure c: Combined editing in CD34+ cells from β-thalassemia patients (codon 17(A>T) / codon 41 / 42(–TTCT)), and 12 days of in vitro erythroid differentiation, the expression of γ-globin relative to β-actin was detected; Figure d: Benzidine combined with Giemsa staining was used to measure the accumulation of hemoglobin; Figure e: Flow cytometry analysis was used to detect the proportion of F cells;

[0052] Figure 7 To enhance the expression of γ-globin in primary human erythroid cells by combined disruption of CACCC elements and TGACCA elements, Figure a: Combination editing in CD34+ cells derived from normal human peripheral blood, and detection of the expression of β-globin relative to β-actin after 12 days of in vitro erythroid differentiation; Figure b: Flow cytometry analysis of the proportion of F cells; Figure c: ChIP-qPCR test results; Figure d: 3C test results;

[0053] Figure 8To enhance HbF expression in HSPCs from patients with β-thalassemia by combined disruption of CACCC and TGACCA elements, Figure a: Combinatorial editing was performed in CD34+ cells derived from patients with β-thalassemia (codon 17(A>T) / codon 41 / 42(–TTCT)), and HbF expression levels were detected by HPLC after 12 days of in vitro erythroid differentiation; Figure b: Detection of γ-globin relative to β-actin expression in the obtained monoclonal cells; Figure c: Detection of erythroid differentiation by flow cytometry analysis of CD71 and CD235. DETAILED DESCRIPTION

[0054] Through extensive and in-depth research, the inventors of the present invention discovered for the first time that disrupting the interaction between HBB and LCR while releasing the apparent silencing on HBG increased HbF expression to nearly 100% of the total hemoglobin level, achieving for the first time a complete reversal of the conversion of γ- to β-globin expression.

[0055] In a specific embodiment of the present invention, the present invention simultaneously destroys the competitive inhibition between HBB and HBG and the apparent silencing on HBG by mutating the CACCC element on HBB and the TGACCA element on HBG, thereby achieving a complete reversal of the conversion of γ- to β-globin expression. This discovery provides a comprehensive description of the conversion of globin expression and expands the understanding of the eukaryotic gene expression regulation mechanism by those skilled in the art. Moreover, the combined editing of the CACCC element on HBB and the TGACCA element on HBG can increase HbF expression to nearly 100% of the entire hemoglobin level, indicating that this method can be used as a more suitable strategy for gene therapy of β-hemoglobinopathy.

[0056] In order to further illustrate the present invention, the terms involved in the present invention are explained as follows:

[0057] The term "includes" or "comprising" is an open description, referring to the compositions, methods and one or more corresponding components thereof required by the present invention, but is not limited to the corresponding components listed, does not exclude other components, and may also include or contain unspecified elements, whether necessary or not.

[0058] The term "β-hemoglobinopathies" refers to hemolytic anemia of red blood cells caused by mutations in the β-globin gene. β-hemoglobinopathies are mainly divided into two categories. One is thalassemia caused by reduced or absent β-globin synthesis, called β-thalassemia, and the other is hemolytic anemia caused by mutations in the β-globin structure, called sickle cell anemia. β-hemoglobinopathies are the largest single gene genetic diseases, and approximately 7% of the world's population are carriers of β-globin pathogenic genes. Although its genetic molecular mechanism has been clearly elucidated, there is currently a lack of radical treatment strategies except for allogeneic bone marrow transplantation.

[0059] The term "β-thalassemia" refers to a genetic disease in which the patient's own adult hemoglobin (HbA) is abnormal due to a mutation in the β-globin subunit. It is one of the most common types of thalassemia and the most common single-gene genetic disease in the world. On average, 1.5 out of every 100 people carry the thalassemia gene. Its molecular mechanism is that defects in the globin gene encoding hemoglobin lead to impaired globin chain synthesis, causing red blood cell destruction and hemolytic anemia. Currently, the treatment of moderate to severe thalassemia faces great difficulties. With the emergence of gene editing technology, gene therapy for thalassemia has become a research hotspot in this field.

[0060] The term "sickle cell anemia" refers to a hereditary hemoglobinopathy, in which the 6th amino acid glutamic acid of the β-globin chain is replaced by valine, forming sickle hemoglobin, which replaces normal hemoglobin. It is also caused by a mutation in the β-globin encoding gene (HBB), which produces abnormal or inactive products, thereby interfering with the normal physiological function of red blood cells. The clinical manifestations are chronic hemolytic anemia, susceptibility to infection, and recurrent pain crises causing chronic ischemia and leading to organ and tissue damage. Reactivating γ-globin in sickle cell anemia and thalassemia is one of the effective means of treating these β-hemoglobinopathies.

[0061] The term "HBB" refers to the β-globin gene; the term "HBG" refers to the γ-globin gene; the term "HbF" refers to fetal hemoglobin. Hemoglobin composed of α-globin and γ-globin is called HbF. Before and after birth, when the hematopoietic site migrates from the fetal liver to the bone marrow, the α-globin gene cluster still expresses the α-globin gene, the expression of the γ-globin gene in the β-globin gene cluster gradually decreases, and the expression of the β-globin gene gradually increases. After birth, adult hemoglobin (HbA) composed of α-globin and β-globin accounts for more than 95% of the total hemoglobin, while HbF accounts for less than 1%.

[0062] The term "reversal of the γ- to β-globin expression conversion" refers to the reversal of the γ- globin to β-globin expression conversion. During human development, the β-like subunit of hemoglobin undergoes two conversions, from ε in the embryonic period to γ ​​in the fetal period, and finally to β after birth. The encoding genes are called ε-globin (embryonic period), γ-globin (neonatal period), and β-globin (adult period), respectively, and are located in the β-globin locus of chromosome 11. After a person is born, the process of converting γ-globin to β-globin in red blood cells is called globin switching. The conversion of γ- to β-globin expression is strictly and finely regulated during human individual development, and manipulation of this process can be used as a method to treat β-hemoglobin diseases. Many genetic factors have been found to epigenetically silence the expression of the γ-globin gene in adulthood. However, it remains unknown whether the γ- to β-globin expression conversion can be completely reversed.

[0063] The present invention is further described below in conjunction with specific examples, which are only used to explain the present invention and are not to be construed as limiting the present invention. It will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and purposes of the present invention, and that the scope of the present invention is defined by the claims and their equivalents. The experimental methods for which specific conditions are not specified in the following examples are usually tested under conventional conditions or under conditions recommended by the manufacturer.

[0064] Example 1 Disruption of HBB competition can induce γ-globin expression

[0065] 1. Experimental Methods

[0066] 1CRISPR screening experiment screens regulatory sequences that can enhance γ-globin expression

[0067] 1.1 Construction of CRISPR screening library

[0068] In order to screen the regulatory sequence that can enhance the expression of γ-globin in the downstream region of the HBG gene, gRNA was designed for this region. The design tool used was the CHOPCHOP tool, the website is http: / / chopchop.cbu.uib.no / , the Target is chr11:5204054-5248601, the reference genome is hg38 / GRCh38, Using is CRISPR / Cas9, For is Knock-out, and a total of 3784 gRNAs were designed. The exported results are two txt files, hbb_gRNA_1 and hbb_gRNA_2. The two exported txt files were then handed over to Nanjing GenScript for the synthesis and construction of the gRNA library. The library construction process is as follows: the first 20nt sequences of the 3784 synthesized gRNAs were cloned into the LentiGuide-Puro vector, and the transformed colonies with sufficient coverage were picked, and the plasmids were extracted. After extracting the plasmid, NGS sequencing was performed on the gRNA sequence on the plasmid. Analysis of the sequencing data showed that the library coverage was 100%, the maximum sequencing depth was 399, the average sequencing depth was 92.08, the average sequencing depth of the top 10% in ascending order of reads was 33, the average sequencing depth of the top 90% was 164, and the Skewness, i.e., the average sequencing depth of 90% / 10%, was 4.97. This information indicates that the CRISPR screening experiment library was successfully constructed.

[0069] 1.2 Packaging of lentivirus for CRISPR screening experiments

[0070] The day before virus packaging, 293T cells were inoculated in a 100mm culture dish, and transfection was performed when the cells grew to a confluence of about 70%. The plasmid used for packaging lentivirus is a three-plasmid packaging system. The lentiviral packaging and transfection operation of 293T cells in each 100mm culture dish is as follows: add 10μL VigoFect transfection reagent to 400μL saline, mix gently, and let stand for 5min; add 10μg CRISPR screening library plasmid, 5μg PLP1, 8μg PLP2, 4μg PLPVSVG to 400μL saline, and mix gently; then add the mixed solution of VigoFect transfection reagent and saline dropwise to the plasmid solution, mix gently, and leave at room temperature for 15min. Then add the mixed solution of the two dropwise to the 100mm culture dish, shake the culture dish gently, mix well, and place it in the incubator for culture. 8 h after transfection, the 293T cell culture medium was discarded, and 10 mL of DMEM complete medium supplemented with pyruvate was added and culture was continued.

[0071] Collect the culture supernatant of 36h and 72h, and mix the culture fluid collected at these two time points. Then centrifuge at 3000rpm for 15min at 4℃ and discard the cell debris. Filter the supernatant through a 0.45μm PVDF membrane into a new 50mL centrifuge tube. Transfer the virus supernatant in the 50mL centrifuge tube to an ultra-high-speed centrifuge tube, centrifuge at 50000g at 4℃ for 4h, carefully discard the supernatant, add 1mL HUDEP2 proliferation medium to resuspend the virus particles, and store in a -80℃ refrigerator after aliquoting.

[0072] 1.3 Determine the amount of lentivirus added when MOI = 0.3

[0073] In order to ensure that each HUDEP2 cell is infected with an average of 0.3 lentiviral particles in the subsequent CRISPR screening experiment infection experiment, it is necessary to determine the amount of lentivirus added when infecting HUDEP2 cells at MOI = 0.3.

[0074] First, 3 × 10 cells were cultured in each well of a 12-well cell culture plate. 6 HUDEP2 cells were plated, 1 mL of HUDEP2 proliferation medium was added to each well, and 1 μL of 8 mg / mL polybrene (final concentration was 8 μg / mL) was added; then 0, 0.5, 1, 2, and 4 μL of CRISPR screening experiment library lentivirus were added to each well of cells, and centrifuged at 1000g for 2 hours at 37°C to complete lentiviral infection; the culture supernatant was discarded, and the cells were resuspended with fresh HUDEP2 proliferation medium and placed in a new culture plate for culture; 12 hours after infection, the infected HUDEP2 cells in each well were divided into two parts, and placed in two culture plate wells, one of which was added with puromycine at a final concentration of 1 μg / mL, and the other was not added with puromycine; after three days of continuous culture, the cells in the two wells were counted, and the ratio of the number of cells in the drug-added group to the non-drug-added group was calculated. The virus addition amount with a ratio of 0.3 was selected for the virus addition amount for infecting HUDEP2 cells in the subsequent CRISPR screening experiment. The virus addition amount in this experiment was determined to be 1 μL.

[0075] 1.4 Infection and proliferation of lentivirus in CRISPR screening experiments

[0076] The HUDEP2 cells used in this CRISPR screening experiment are HUDEP2 cells that stably express Cas9 and carry a blasticidine resistance gene. Before the CRISPR screening experiment lentivirus infection of HUDEP2, blasticidine was added to the proliferation medium at a final concentration of 10 μg / mL. After 4 days of culture, blasticidine was removed and cultured for another day.

[0077] Then take 12×106 HUDEP2 cells (the average amount of gRNA per library corresponding to 713 HUDEP2 cells should be 9×10 6 10 cells) were plated in 4 wells of a 12-well plate, 1 mL of proliferation medium was added to each well, and polybrene was added at a final concentration of 8 μg / mL. After mixing, 1 μL of CRISPR screening experimental lentivirus was added to each well, and the cells were centrifuged at 1000 g for 2 h at 37°C to complete lentiviral infection. The culture medium was then discarded, and the cells were resuspended in fresh proliferation medium and placed in a new 100 mm culture dish for culture. The cell density was strictly controlled at 5×10 5 The cells were kept within 100 cells / mL and cultured for 6 days.

[0078] 1.5 Isolation of HbF-highly expressing cells

[0079] Before cell sorting, 1×10 7 HUDEP2 cells were used for subsequent genome extraction and marked as sortbefore as a control for subsequent CRISPR screening experiments.

[0080] The remaining HUDEP2 cells were then fixed and cross-linked with glutaraldehyde, permeabilized with Triton X-100, and intracellularly stained with HbF-APC (2.5×10 5 10 μL antibody was added to each cell). Then, the HUDEP2 cells with high expression of HbF were sorted using SONY MA900 fully automatic flow cytometry sorter. The HbF positive cell population was sorted and collected, accounting for about 2.03% of the total number of cells, and the HbF negative cell population was collected at the same time, accounting for about 50.58%.

[0081] 1.6 Extraction of positive cell genome and construction of sequencing library

[0082] The previously saved sort before group and the HbF positive cell group and HbF negative cell group sorted by flow cytometry were used for genome extraction. 6 Each cell has about 6.6 μg of genomic DNA, so for a gRNA library of about 4,000 gRNAs, 1.2×10 6 cells, i.e. 7.2 μg genomic DNA.

[0083] The extracted genomic DNA of each group was subjected to PCR amplification of the gRNA sequence to complete the sequencing library construction. The library construction was divided into two steps of PCR amplification, and the specific library construction process was as follows: the first round of PCR system was 50 μL, with 2.5 μg of genomic DNA as the template, and primers were designed for the region where the gRNA sequence was located. The forward primer was AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG, and the reverse primer was CT TTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC. The PCR conditions were 95°C pre-denaturation for 2 min, 95°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, a total of 20 cycles, and finally 72°C extension for 2 min.

[0084] The PCR product was then purified by magnetic beads. The purification process was as follows: the purified magnetic bead liquid was taken out of the 4°C refrigerator 30 minutes in advance and returned to room temperature. The magnetic bead liquid was vortexed to mix thoroughly, and then 0.7 times the volume, i.e. 35 μL of magnetic beads, was added to the PCR product. After fully mixing, it was incubated at room temperature for 10 minutes to allow the DNA to bind to the magnetic beads. The PCR product was then placed on a magnetic rack for 5 minutes. After the solution was clarified, the supernatant was aspirated into a new centrifuge tube. After that, 0.2 times the volume, i.e. 10 μL of magnetic beads, was added again. After fully mixing, it was incubated at room temperature for 10 minutes. After placing it on a magnetic rack for 5 minutes, the supernatant was discarded, and 200 μL of freshly prepared 80% ethanol was added to wash the magnetic beads. The beads were washed twice in total. After discarding the supernatant, the magnetic beads were dried, and 20 μL of nuclease-free water was added to dissolve for 2 minutes. After that, it was placed on a magnetic rack and the supernatant was aspirated into a new nuclease-free PCR tube.

[0085] The purified PCR product was used as the template for the second round of PCR, and the NGS adapter primer was used as the PCR primer to complete the adapter and add the index. The primer at the TruSeq P5 end was AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGAC, and the primer at the TruSeq P7 end was CAAGCAGAAGAC GGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTC, where XXXXXX was the barcode sequence, and the PCR conditions were the same as the first round of PCR conditions. After the PCR was completed, the second round of PCR products were purified with magnetic beads, using the same purification method as in the previous step, and the amount of magnetic beads was 1.2 times the volume, i.e. 60 μL. The purified product was dissolved in TE buffer and sent to the company for second-generation sequencing.

[0086] 1.7 Analysis of CRISPR screening experiment sequencing data

[0087] The tool used for CRISPR screening experiment analysis is CRISPR-SURF. The specific operation process and instructions can be found at http: / / github.com / pinellolab / CRISPR-SURF.

[0088] 2. Electroporation of HUDEP2 cells and CD34+ hematopoietic stem and progenitor cells

[0089] Before electroporation, the density of HUDEP2 cells was controlled to ensure good cell growth. Fresh HUDEP2 proliferation medium was added to the well plate in advance and placed in an incubator at 37°C, 5% CO2 and saturated humidity for incubation. HUDEP2 cells were counted and 2.88×10 6 The cells were centrifuged at 300 g for 5 min, the supernatant was discarded, and the cells were washed twice with 1 mL of DPBS. After the residual DPBS was aspirated, 72 μL of Buffer T was added to resuspend the cells. The cell concentration was 4 × 10 7 / mL. The cell density of CD34+ hematopoietic stem and progenitor cells from normal human peripheral blood was controlled in the proliferation medium to ensure good cell growth. Before electroporation, 5×10 4 cells.

[0090] Preparation of CRISPR-Cas9 RNP for electroporation: Add 0.6 μL 10×Hifibuffer (100 mM HEPES, 1.5 M NaCl), 0.6 μL 62 μM (1081058 from IDT) Alt-R SpHiFi Cas9Nuclease V3 (about 32 pmol), and 1.8 μL 44 μM sgRNA synthesized by IDT (about 80 pmol) to an RNase-free centrifuge tube, add RNase-free water to 6 μL, and incubate at room temperature for 15 min. The sequence of sgRNA is mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAG CAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCCGGUGCU*mU*mU*mU. The gRNA target sequence is as follows: PM-gRNA1:ACCCTGTGGAGCCACA CCCT, PM-gRNA2: GGGTGTGGCTCCACAGGGTG, DM-gRNA: CTTGTCAAGG CTATTGGTCA, GM-gRNA: CTTG TCAAGGCTATTGGTCA.

[0091] Preparation of 49-3A-57EP single-base editing tool RNA for electroporation: Add 2 μL of 1 μg / mL (synthesized by Nearshore Protein) 49-3A-57EP mRNA and 1.8 μL of 44 μM sgRNA synthesized by IDT (about 80 pmol) into an RNase-free centrifuge tube and mix. The sequence of sgRNA is mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGU UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCU*mU*mU*mU, and the gRNA target sequence is as follows: BE-A: GCTATTGGTCAAGGCAAG GC, BE-B: CAAGGCTATTGGTCAAGGCA, BE-C: GTGGAGCCACACCCTA GGGT.

[0092] When electroporating HUDEP2 cells, mix 6 μL of CRISPR-Cas9 RNP incubation product with 6 μL of resuspended cells and place them in Neon TM Add 3 mL of E2 buffer to the tube and use Neon TM Pipette insert 10μL Neon TM Tip, and absorb the RNP and HUDEP2 mixture, insert it into Neon TM Tu be, set the electroporation parameters to 1200V, 40ms, 3plus, complete the electroporation, and quickly transfer the electroporation product into the incubated fresh HUDEP2 proliferation medium.

[0093] When electroporating CD34+ hematopoietic stem and progenitor cells, mix 6 μL of CRISPR-Cas9 RNP incubation product or 49-3A-57EP single-base editing tool RNA with 20 μL of resuspended cells and add them to the electroporation cup. Electroporate using the E0-100 program in the Lonza 4D-Nucleofector electroporation system. Finally, transfer the electroporation product into the incubated fresh CD34+ hematopoietic stem and progenitor cell proliferation medium.

[0094] 3. Determination and analysis of CRISPR editing efficiency

[0095] Collect the HUDEP2 cells edited by CRISPR-Cas9, wash them once with PBS, add 100μL lysis buffer, add 3μL proteinase K, and digest them at 65℃ overnight. Then return to room temperature, add 2μL RNase A, digest at 37℃ for 1h, and then add an equal volume of phenol chloroform isoamyl alcohol for extraction. Centrifuge at 12000rpm for 10min at room temperature, take the upper aqueous phase to a new 1.5mL centrifuge tube, extract it again, add 1 / 10 volume of 3M sodium acetate and 2.5 times volume of anhydrous ethanol, mix well, place at -80℃ for 2h, centrifuge at 4℃ 12000rpm for 15min, discard the supernatant, wash three times with 75% ethanol, dry the DNA precipitate and dissolve it in TE buffer.

[0096] In the first round of PCR, the extracted HUDEP2 cell genomic DNA was used as a template, and primers were designed to amplify the DNA region near the editing site. In order to avoid the influence of the same fragment on the subsequent second-generation sequencing, additional 1 to 3 bases were added to the primers. There were 4 forward and reverse primers, including NGS-P5-HBB F: T CTTTCCCTACACGACGCTCTTCCGATCTAGCCAGTGCCAGAAGAGC, NGS-P5-HBB F1: TCTTTCCCTACACGACGCTCTTCCGATCTTAGCCAGTGCCAGAA GAGC, NGS-P5-HBB F2: TCTTTCCCTACACGACGCTCTTCCGATCTGCAGC CAGTGCCAGAAGAGC, NGS-P5-HBB F3: TCTTTCCCTACACGACGCTCTTC CGATCTCTTAGCCAGTGCCAGAAGAGC, NGS-P7-HBB R: AGTTCAGACGT GTGCTCTTCCGATCCACCACCAACTTCATCCAC, NGS-P7-HBB R1: AGTTC AGACGTGTGCTCTTCCGATCACACCACCAACTTCATCCAC, NGS-P7-HBB R2: AGTTCAGACGTGTGCTCTTCCGATCGTCACCACCAACTTCATCCAC, NG S-P7-HBB R3: AGTTCAGACGTGGTGCTCTTCCGATCTGTCACCACCAACTTCATCCAC, NGS-P5-HBG F: TCTTTCCCTACACGACGCTCTTCCGATCTGGAA TGACTGAATCGGAACA, NGS-P5-HBG F1: TCTTTCCTACACGACGCTCTT CCGATCTAGGAATGACTGAATCGGAACA, NGS-P5-HBG F2: TCTTTCCCTA CACGACGCTCTTCCGATCTTCGGAATGACTGAATCGGAACA, NGS-P5-HBG F3: TCTTTCCCTACACGACGCTCTTCCGATCTCATGGAATGACTGAATCGGA ACA, NGS-P7-HBG R: AGTTCAGACGTGGTGCTCTTCCGATCTGGAACTGCT GAAGGGTG, NGS-P7-HBG R1: AGTTCAGACGTGTGCTCTTCCGATCATGGAACTGCTGAAGGGTG,NGS-P7-HBG R2: AGTTCAGACGTGTGCTCTTCCG ATCGCTGGAACTGCTGAAGGGTG, NGS-P7-HBG R3: AGTTCAGACGTGTG CTCTTCCGATCCACTGGAACTGCTGAAGGGTG. The PCR conditions were 95°C pre-denaturation for 2 min, 95°C denaturation for 30 s, 57°C annealing for 20 s, 72°C extension for 30 s, a total of 21 cycles, and finally 72°C extension for 2 min. After the PCR was completed, the PCR product was purified by magnetic beads. The primers used for the subsequent second round of PCR and the purification of the PCR product were the same as above. The PCR product near the editing site was dissolved in TE buffer and sent to the company for second-generation sequencing. ,

[0097] The next-generation sequencing results were downloaded to the server, and the editing efficiency and the type of Indel or base substitution generated were analyzed. The analysis software used was CRISPResso2, and the website was https: / / github.com / pinel lolab / crispresso2. The CRISPR-Cas9 editing efficiency and the type of Indel generated in HUDEP2 cells were analyzed, as well as the percentage of each Indel type. After editing the CACCC element on HBB, the sequences of base deletion include CAC, CC, CACC, C, ACCC, CCC and the complete deletion of CACCC, the sequences of base insertion include CACCCc, CAaCCC, CACtCC, CACacattggCC, and the sequences of base replacement include CACTC and CACT; after editing the TGACCA element on HBG, the sequences of base deletion include TGACA, TGAA, TGAC, TGA, TG, CCA, T, CA, A and the complete deletion of TGACCA, and the sequences of base insertion include TGAtCCA, TGAcaaggctattgCCA, TGAaCCA and TGa A. The single-base editing efficiency of 49-3A-57EP and the types of base substitutions produced in CD34+ hematopoietic stem and progenitor cells were analyzed. The base replacement sequences after editing of the CACCC element on HBB were TACCC, CATCC, CACTC, CACCT, TATCC, TACTC, TACCT, CATTC, CATCT, CACTT, TATTC, TATCT, TACTT, CATTT and TATTT; the base replacement sequence after editing of the TGACCA element on HBG was TAACCA.

[0098] 4. Cultivation of Monoclonal Cells

[0099] CRISPR-Cas9 edited HUDEP2 cells or CD34+ hematopoietic stem cells were cultured for proliferation, and the cells were counted when they were in good condition. 900 μL of proliferation medium was added to multiple 1.5 mL centrifuge tubes, and the cell culture medium was re-pumped and mixed, and 100 μL of cell culture medium was added to 900 μL of culture medium. This tube was marked as -1. After mixing the cell culture medium in this tube, 100 μL of cell culture medium was added to the next tube of 900 μL culture medium and marked as -2. This was repeated 10 times dilution until the number of cells in the last tube of culture medium was at the same order of magnitude as the number of pre-separated monoclonal clones.

[0100] Calculate the volume of the culture medium according to the number of pre-divided monoclones, calculate the number of cells per 96-well plate as 100 wells, and calculate the amount of culture medium added to each well as 150 μL. Finally, calculate the volume of the proliferation medium used, measure it and put it into a 50mL centrifuge tube, and add a certain volume of the last tube of diluted cell culture fluid (calculated based on 0.5 cells in each well of the culture fluid), turn it upside down and mix it thoroughly. Then pour the mixed cell culture fluid into a sterile sample tank, and use a spray gun to add 150 μL of cell culture fluid to each well of the 96-well plate.

[0101] The 96-well cell culture plate containing cells was cultured at 37°C, 5% CO2 and saturated humidity. After culturing the monoclonal cells for one week, the number of colonies formed by the cells in the well plate and the number of cells in each colony were observed under a microscope. Whether each well contained a monoclonal cell was determined based on the formation of one colony in each well and the number of cells in each colony not exceeding 128. After adding 100 μL of proliferation medium to the well containing the monoclonal cells and continuing to culture for one week, the monoclonal cells were moved from the 96-well plate to the 24-well plate. After about 5 days of culture, the monoclonal cells were moved from the 24-well plate to the 6-well plate. In this way, the monoclonal cells were amplified, and a portion of the cells were separated for genome extraction and genotype identification.

[0102] 5. Extraction, reverse transcription and quantitative PCR of total RNA from cells

[0103] 2×10 HUDEP2 cells were taken after 5 days of erythroid differentiation or CD34+ hematopoietic stem and progenitor cells were differentiated in vitro for 12 days. 6 After centrifugation at 300 g for 5 min, remove the supernatant and add 1 mL of TRIzol TMThe reagent (15596026 from Invitrogen) was thoroughly pipetted and mixed until there was no cell precipitation and the liquid was uniform and non-viscous. The HUDEP2 cell lysate treated with TRIzol was taken out of the -80℃ refrigerator, and after it was completely melted, 200μL of chloroform was added. After vigorous shaking for 30s, it was allowed to stand at room temperature for 5min, and centrifuged at 4℃12000g for 15min. 500μL of the upper aqueous phase was transferred to a new 1.5mL centrifuge tube, and an equal volume of isopropanol was added to precipitate RNA. After mixing upside down, it was placed for 10min, and centrifuged again at 4℃12000g for 15min, and RNA precipitation was visible. After that, the supernatant was discarded, and after washing with 70% ethanol (DEPC water preparation) 2 to 3 times, the supernatant was discarded and the RNA precipitate was dried at room temperature. After that, an appropriate amount of RNase-free water was added to dissolve the precipitate, and the concentration and purity of RNA were determined by spectrophotometer. The extracted RNA was stored in a -80℃ refrigerator.

[0104] The kit used to reverse transcribe total cell RNA to synthesize the first chain of cDNA was PrimeScript from Takara TM 1st Strand cDNA Synthesis Kit (6110A). The specific operation process is as follows: the reverse transcription system is 20μL, the reverse transcribed RNA amount is 2μg, first dilute 2μg RNA to 10.5μL with RNase free dH2O, then add 1μL dNTP Mixture (10mM each), 1μL Oligo dT Primer (50μM), 2μL Random 6mers (50μM), mix well, and incubate at 72℃ for 5min, and quickly put it on ice to cool down quickly to open the RNA secondary structure. After about 5min on ice, add 1μL PrimeScript RTase (200U / μL), 4μL 5× PrimeScript Buffer, 0.5μL RNase Inhibitor (40U / μL), mix well, and run the reverse transcription program. The reverse transcription conditions are 30℃ for 10min, 42℃ for 60min, and 95℃ for 5min. After the reverse transcription is completed, store it in a -20℃ refrigerator.

[0105] 180 μL dH2O was added to 20 μL of the reverse transcription product of 2 μg of total cell RNA for dilution as a template for subsequent real-time fluorescence quantitative PCR. When configuring the real-time fluorescence quantitative PCR system, if the expression of globin gene is detected, the amount of diluted template added is 0.5 μL, and if the expression of the main regulatory factor of globin is detected, the amount of diluted template added is 1 μL. The PCR reaction system is 20 μL, containing 10 μL 2×SYBRGreen Mix, 1 μL forward and reverse primers (10 μM each), and 0.5 μL or 1 μL cDNA template. At least three replicate wells are set for each sample and each gene. After adding the PCR reaction solution, the 96-well plate is sealed and put into the machine. The real-time fluorescence quantitative PCR instrument used is CFX96 from BioRad. The PCR reaction program is 94℃ pre-denaturation for 1 min; 94℃10s, 60℃20s, 72℃30s, and amplification for 40 cycles. In each cycle, a program for detecting fluorescence signals is added after the 72℃ amplification is completed. After 40 PCR cycles, a melting curve program was added as follows: 95°C for 1 min, 60°C for 1 min, and then from 60°C to 95°C at a rate of 0.5°C per 10 s. The fluorescence signal was detected at each step of the whole process. The primers used for real-time fluorescence quantitative PCR were designed by conventional methods.

[0106] 6HPLC determination of hemoglobin expression

[0107] The chromatographic column used for the HPLC determination of hemoglobin was PolyCAT A from Poly LC. TM Chromatographic column (3μm, 35×4.6mm, 3.54CT0315). The A solution used for HPLC determination of hemoglobin was 20mM Bis-Tris solution at pH 6.8, and the B solution was 20mM Bis-Tris and 200mM NaCl solution at pH 6.9. 3×10 6 cells, washed with PBS, removed the supernatant, and frozen in a -80°C refrigerator. When hemoglobin is to be determined, the HUDEP2 sample is taken out, restored to room temperature, and 30 μL 0.01% SDS is added and placed on ice for 10 minutes for cell lysis. After that, the lysate is filtered through an ultrafiltration-MC centrifugal filter (UFC30HV00) with a 0.45 μm pore size PVDF membrane from Millipore, and 20 μL of the filtered lysate is added to 80 μL of solution A and incubated on ice for 30 minutes. After that, the incubation product is transferred to the HPLC sample tube and waits for loading. The high performance liquid chromatograph used for the determination of hemoglobin is the Ultimate 3000 high performance liquid chromatograph from ThermoFisher.

[0108] 7. Determination of F cell ratio by flow cytometry analysis

[0109] Take 1×10 6 HUDEP2 cells with good proliferation status were centrifuged at 300g for 5 minutes, and the supernatant was removed. After resuspending with 1mL PBS-0.1% BSA, the supernatant was removed again, and then 1mL pre-cooled 0.05% glutaraldehyde solution was added for cross-linking, and the cells were placed at room temperature for 10 minutes. After washing 3 times with 1mL PBS-0.1% BSA, 0.5ml 0.1% Triton X-100 was added for membrane permeabilization, and the cells were placed at room temperature for 3-5 minutes, and 0.5mL PBS-0.1% BSA was added. After centrifugation at 300g for 5 minutes, the supernatant was discarded, and the cells were washed 3 times with 1mL PBS-0.1% BSA. Take 2×10 5 The cells were placed in a new 1.5 mL centrifuge tube, filled with PBS-0.1% BSA to a total volume of 100 μL, and 2 μL HbF-APC (MHFH00 from ThermoFisher) or 2 μL Mouse IgG1-APC (MHFH05 from ThermoFisher) were added as isotype controls. After incubation at room temperature in the dark for 15 min, the tubes were washed three times with 1 mL PBS-0.1% BSA and analyzed on a C6 Plus cell flow cytometer.

[0110] 8Chromosome conformation capture (3C)

[0111] 8.1 Cell Fixation

[0112] After inducing erythroid differentiation for 5 days, the number of HUDEP2 cells was counted and 1×10 7 Cells were centrifuged at 300g for 5min, washed once with PBS, resuspended with 10mL PBS, added with 278μL 37% formaldehyde solution (final concentration of 1%), immediately shaken, and cross-linked on a shaker at room temperature for 10min. Then 894μL 2.5M glycine solution (final concentration of 0.2M) was added, immediately mixed, the cross-linking reaction was terminated, and the mixture was placed on a shaker at room temperature for 5min and then placed in a 4℃ refrigerator for 20min. Centrifuged at 500g for 10min at 4℃, discarded the supernatant, washed once with PBS, centrifuged again, and discarded the supernatant.

[0113] 8.2 Cell nuclear extraction and membrane perforation

[0114] Add 1 mL of pre-cooled 3C lysis buffer (10 mM Tris-HCl, 10 Mm NaCl, 0.2% NP-40) with protease inhibitors to the cell pellet, mix well by pipetting, resuspend the cells and place on ice to lyse the cells for 30 min. Centrifuge at 800 g for 5 min at 4°C and wash twice with 1 mL PBS. 7 Place the permeabilized cells in a 1.5mL centrifuge tube, discard the supernatant, and store in a -80℃ refrigerator for subsequent 3C operations. After the frozen 3C sample is restored to room temperature, add 392μL 1×NEB CutSmart Buffer, resuspend the cell nuclei, add 8μL 10% SDS (final concentration is 0.2%), mix thoroughly, incubate in a 62℃ metal bath at 950rpm for 1h, and then immediately place on ice. Then add 40.82μL 20% Triton X-100 (final concentration is 2%) to the sample to neutralize the effect of SDS, mix thoroughly and avoid bubbles, and incubate in a 37℃ metal bath at 950rpm for 1h. Take 10μL of the sample as the uncut control group (UD C).

[0115] 8.3 3C sample digestion

[0116] After the sample was centrifuged at 800g for 5min at 4℃, the supernatant was discarded, and the nuclei were resuspended with 300μL 1×NEB CutSmart Buffer. After thorough mixing, the sample was centrifuged again at 800g for 5min at 4℃, and the supernatant was discarded. Then, 250μL of enzyme digestion system was prepared, 220μL of water, 25μL of 10×NEB CutSmart Buffer and 300U of EcoRⅠ-HF endonuclease were added to the sample, and after thorough mixing, the sample was placed in a 37℃ metal bath at 950rpm for at least 20h, and then 200U of EcoRⅠ-HF endonuclease was added and incubated for another 3h. After that, the endonuclease was inactivated by incubating at 950rpm in a 65℃ metal bath for 30min, and then quickly placed on ice. Take out 10 μL of sample as the control group (DC) after enzyme digestion, add 40 μL proteinase K buffer and 5 μL proteinase K together with the previous UDC group, digest at 65 °C for 2 h, add 1 μL RNase A, digest at 37 °C for 30 min, extract with phenol chloroform, extract genomic DNA, and detect enzyme digestion efficiency.

[0117] 8.4 3C Sample Connection

[0118] After the digested 3C sample was restored to room temperature, it was centrifuged at 800g for 5 min at 4°C and the supernatant was discarded. 200μL 1×T4 DNA ligase Buffer was added to resuspend it and centrifuged again at 800g for 5 min at 4°C and the supernatant was discarded. Then 221μL water, 25μL 10×T4 DNA ligase Buffer, 2.5μL 10mg / mL BSA and 2000U T4 DNA ligase were added to the sample, mixed thoroughly, and connected overnight at 4°C with a windmill at low speed.

[0119] 8.5 Decrosslinking and purification of ligation products

[0120] After centrifuging the ligation product at 800g for 5min at 4℃, discard 200μL of supernatant and add 200μL of water to resuspend the nuclei. Then add 25μL 10% SDS, 25μL 20mg / mL proteinase K, incubate at 55℃ for 30min, add 30μL 5M NaCl, and place in a 65℃ metal bath to decrosslink overnight. After the sample is restored to room temperature, add 2μL 10mg / mL RNase A and incubate at 37℃ for 30min; then add an equal volume of phenol chloroform for extraction, centrifuge at 12000g for 10min at room temperature, transfer the upper aqueous phase to a new 1.5mL centrifuge tube, extract three times in total, and then add chloroform for extraction once. Add 0.1 times the volume of 3M sodium acetate and 2.5 times the volume of anhydrous ethanol to the upper aqueous phase, mix thoroughly, and place in a -80℃ refrigerator for at least 2h. The sample was then centrifuged at 12000g for 15 min at 4°C, the supernatant was discarded, and the pellet was washed three times with 75% ethanol. 100 μL of water was added to dissolve the pellet, and it was placed at 37°C for 30 min to help dissolve the DNA.

[0121] 8.6 Quantitative PCR to determine the strength of the interaction

[0122] βD-BAC was digested with EcoRI-HF, ligated, and the ligation product was recovered as a template for amplification primer correction. The template amount of BAC purified product per well was 0.04ng for real-time fluorescence quantitative PCR, and the template amount of 3C purified product per well in each group was 70ng. The PCR reaction conditions were 95℃30s; 95℃8s, 57℃20s, 72℃25s, for a total of 40 cycles; 3C PCR primers were designed using conventional methods.

[0123] 9Chromatin immunoprecipitation (ChIP)

[0124] 9.1 Cell Fixation

[0125] After 5 days of HUDEP2-induced erythroid differentiation and 12 days of in vitro differentiation of CD34+ hematopoietic stem and progenitor cells, the cells were collected and fixed by cross-linking using the same method as the cell fixation method in the 3C experiment.

[0126] 9.2 Lysis and ultrasonication of cell nuclei

[0127] Add 1 mL of pre-cooled 3C lysis buffer (10 mM Tris-HCl, 10 Mm NaCl, 0.2% NP-40) with protease inhibitors to the cell pellet, mix well by pipetting, resuspend the cells and place them on ice for 30 min to lyse the cells. Centrifuge at 800 g for 5 min at 4°C and wash twice with 1 mL PBS. 7 The cells after membrane rupture were placed in a 1.5 mL centrifuge tube, the supernatant was discarded, and the cells were stored in a -80 °C refrigerator. After that, the frozen cells were taken out and restored to room temperature, and then 1 mL of pre-cooled NCP buffer I was added to resuspend, placed on ice for 10 minutes, and then centrifuged at 3000g for 5 minutes at 4 °C, and the supernatant was discarded. Then 600 μL of ChIP lysis buffer was added to resuspend, and placed on ice for 30 minutes to lyse the cell nuclear membrane. After that, the ChIP sample was sonicated for 10 cycles using a Bio-uptor non-contact sonicator in the High mode, 30s on, 30s off, and 20 μL of the sonicated sample was taken, and 30 μL of water, 2 μL of 5M NaCl and 20 μg of proteinase K were added to digest overnight, and then the size of the sonicated band was detected by electrophoresis after phenol-chloroform extraction. The size of the sonicated band was between 200 bp and 1 kb.

[0128] 9.3 Immunoprecipitation

[0129] The ultrasonic samples were divided into 1.5mL centrifuge tubes, and 5μL of the samples were placed in one tube as the input group, and the remaining samples were reserved as IgG group and target antibody group with 300μL samples in each tube. The input group was placed in a 4℃ refrigerator for use. IP buffer was added to the IgG group and the target antibody group to make up to 1.2mL. The IgG group and the target antibody group were precleared, and the corresponding normal IgG was added to the IgG group and the target antibody group, respectively, and then 20μL of the corresponding Invitrogen Dynabeads protein A or G (antibodies from rabbit were added to Dynabeads protein A, and antibodies from mouse, goat, and sheep were added to Dynabeads protein G). After thorough mixing, shake slowly at 4℃ for 2.5h to remove non-specific binding impurity molecules.

[0130] Place the pretreated centrifuge tube on the magnetic rack, let it stand for 1 minute, then transfer the supernatant to a new 1.5mL centrifuge tube. Add the corresponding normal IgG to the IgG group and the corresponding target antibody to the target antibody group. The amount of antibody added is based on the amount in the instructions provided by the antibody. After fully mixing, shake slowly at 4℃ windmill for 3h, then add 30μL of the corresponding Dynabeads protein A or G. After fully mixing, shake slowly at 4℃ windmill for at least 12h. Place the ChIP sample on the magnetic rack, let it stand for 1min, discard the supernatant, and wash from low salt wash solution to high salt wash solution to remove the bound impurity molecules.

[0131] 9.4 Isolation and purification of ChIP DNA

[0132] Add 220μL Extraction buffer to the ChIP sample centrifuge tube, place it in a 25℃ metal bath, shake at 1000rpm for 30min, place the centrifuge tube on a magnetic rack for 1min, and aspirate the supernatant into a new 1.5mL centrifuge tube. Then add 200μL Extraction buffer to the ChIP sample centrifuge tube, place it in a 25℃ metal bath, shake at 1000rpm for 30min, place the centrifuge tube on a magnetic rack for 1min, aspirate the supernatant and mix it with the supernatant recovered last time into the same centrifuge tube.

[0133] These ChIP samples were digested together with the Input group samples stored at 4°C. 1 μL proteinase K and 4 μL 5M NaCl were added to each 100 μL sample, mixed and digested at 65°C overnight. After that, each group of samples was returned to room temperature, 20 μL RNase A was added, and digested at 37°C for 45 min. Then, an equal volume of phenol chloroform isoamyl alcohol was added, and after oscillation for 1 min, centrifuged at 12000 rpm for 10 min, and the upper aqueous phase was aspirated into a new 1.5 mL centrifuge tube, and then extracted with phenol chloroform isoamyl alcohol twice and then extracted with chloroform once to remove the residual phenol in the solution. Then, 0.1 times the volume of 3M sodium acetate and 2.5 times the volume of anhydrous ethanol were added to the upper aqueous phase, and the mixture was placed at -80°C for at least 3 h, and then centrifuged at 4°C 12000 rpm for 15 min, the supernatant was removed, and the supernatant was discarded after washing with 75% ethanol 3 times, the DNA precipitate was dried, and 100 μL water was added to dissolve the DNA.

[0134] 9.5 Various solutions used in ChIP experiments

[0135] 3C lysis buffer, NCP bufferⅠ, ChIP lysis buffer, IP buffer, Wash bufferⅠ, Wash buffer II, Wash buffer III, Wash buffer IV, and Extraction buffer were prepared by conventional methods.

[0136] 9.6 Quantitative PCR reaction

[0137] The purified and recovered ChIP products were subjected to quantitative PCR. The Input group, IgG group and target antibody group were all subjected to PCR in the same 96-well PCR plate. Each well of PCR was a 20 μL system. The PCR reaction conditions were: 95°C pre-denaturation for 30 s; 95°C denaturation for 10 s, 57°C annealing for 20 s, 72°C extension for 30 s, for a total of 40 cycles. The qPCR primers used in the ChIP experiment were designed using conventional methods.

[0138] 2. Experimental Results

[0139] In order to identify the elements that regulate γ-globin expression on HBB, this example performed a CRISPR-Cas9 screening experiment in HUDEP2 cells (human umbilical cord-derived erythroid progenitor cells). The lentiviral library in the screening experiment included 3761 gRNAs targeting the HBG downstream gene region (hg38 / GRCh38, chr11:5204054-5248601), of which 24 gRNAs targeted the homologous sequences of HBB and HBD. Cells infected with the lentiviral library were sorted according to the HbF expression level, and the gRNA sequences in the cells were sequenced and analyzed ( Figure 2 a) HbF highly expressed in HbF high Among the gRNAs enriched in cells, the top seven are targeting homologous sequences of HBB and HBD (the middle region of which includes the HBB promoter), followed by the proximal CACCC element of KLF1 on the HBB promoter ( Figure 1 a. Figure 1 b). This is consistent with previous studies that found that KLF1 is the main transcription factor that activates HBB expression in adulthood and plays a very important role in the formation of active chromatin hubs on the β-globin gene cluster and the establishment of chromatin conformation for the interaction between HBB and LCR. KLF1 has proximal CACCC elements and distal CACCC elements on HBB (also enriched in CRISPR screening experiments, Figure 2 b) Mutations in these elements in the human population increase HbF to 1.3-65% of total hemoglobin levels ( Figure 1b). In this example, PM-gRNA-1 and PM-gRNA-2 were designed to target the proximal CACCC element on HBB, DM was designed to target the distal CACCC element on HBB, and GM was designed to target the TGACCA element of BCL11A on HBG as a positive control. Electroporation of these gRNAs in HUDEP2 cells can increase HbF expression by approximately 11 times, 7 times, 5 times, and 83 times, respectively ( Figure 1 c. Figure 2 c). The level of F cells can also be increased from 3% of the control to 35%, 21%, 15% and 60% respectively ( Figure 1 d). After that, the RNP complex containing these gRNAs was electroporated into normal human peripheral blood CD34+ hematopoietic stem cells (HSPCs). It was found that editing the CACCC element on HBB could increase γ-globin expression, but the increase was weaker than that of editing the TGACCA element on HBG ( Figure 1 e). Consistent with previous studies, mutation of the CACCC element can weaken the binding of KLF1 to HBB ( Figure 2 d). In order to confirm whether the mutation of the CACCC element on HBB would change the interaction between HBB and LCR and the subsequent chromatin conformation, this example conducted a 3C experiment and found that editing the CACCC element would weaken the interaction between HBB and LCR, while enhancing the interaction between HBG and LCR ( Figure 1 f). It was also found that the binding of RNAP on HBG, H3K4me3 and H3K9Ac active transcriptional epigenetic modification signals increased after editing the CACCC element, but the increase was weaker than that of the editing of the TGACCA element on HBG ( Figure 1 g. Figure 2 e). This indicates that HBG is still in an apparent inhibitory state after the CACCC element mutation.

[0140] Example 2 Simultaneous disruption of HBB competition and HBG apparent inhibition can completely reverse the switch from γ- to β-globin expression

[0141] 1. Experimental Methods

[0142] 1HUDEP2 cell electroporation

[0143] Preparation before electroporation and preparation of CRISPR-Cas9 RNP for electroporation were the same as described in Example 1. Then, 6 μL of CRISPR-Cas9 RNP incubation product containing GM-gRNA was mixed with 6 μL of resuspended cells and then incubated in Neon TM Add 3 mL of E2 buffer to the tube and use Neon TM Pipette Insert 10μL Neon TMTip, and absorb the RNP and HUDEP2 mixture, insert it into Neon TM Tube, set the electroporation parameters to 1200V, 40ms, 3plus, complete the electroporation, and quickly transfer the electroporation products into the incubated fresh HUDEP2 proliferation medium. After two days of culture, these cells were electroporated for the second time with the CRISPR-Cas9 RNP incubation products containing PM-gRNA1 or DM-gRNA to complete the simultaneous mutation of the CACCC element on HBB and the TGACCA element on HBG.

[0144] 2 Determination and analysis of CRISPR editing efficiency

[0145] The method for determining CRISPR editing efficiency is the same as described in Example 1. The second-generation sequencing results were downloaded to the server, and the editing efficiency and the type of Indel generated were analyzed. The analysis software used was CRISPR Resso2, and the website was https: / / github.com / pinellolab / crispresso2. The CRISPR-Cas9 editing efficiency and the type of Indel generated in HUDEP2 cells were analyzed, as well as the percentage corresponding to each Indel type. After editing the CACCC element on HBB, the sequences of base deletion include CAC, CC, CACC, C, ACCC, CCC and the complete deletion of CACCC, the sequences of base insertion include CACCCc, CAaCCC, CACtCC, CACacattggCC, and the sequences of base replacement include CACTC and CACT; after editing the TGACCA element on HBG, the sequences of base deletion include TGACA, TGAA, TGAC, TGA, TG, CCA, T, CA, A and the complete deletion of TGACCA, and the sequences of base insertion include TGAtCCA, TGAcaaggctattgCCA, TGAaCCA and TGaA.

[0146] 3. Cultivation of Monoclonal Cells

[0147] The specific method for culturing monoclonal cells is the same as described in Example 1.

[0148] 4. Extraction, reverse transcription and quantitative PCR of total cell RNA

[0149] The specific methods of total cell RNA extraction, reverse transcription and quantitative PCR were the same as those described in Example 1.

[0150] 5HPLC determination of hemoglobin expression

[0151] The specific HPLC method for determining hemoglobin expression is the same as described in Example 1.

[0152] 6. Determination of F cell ratio by flow cytometry analysis

[0153] The specific method for determining the F cell ratio by flow cytometry is the same as described in Example 1.

[0154] 7Chromosome conformation capture (3C)

[0155] The specific chromatin conformation capture technology detection method is the same as described in Example 1.

[0156] 8Chromatin immunoprecipitation (ChIP)

[0157] The specific chromatin immunoprecipitation method is the same as described in Example 1.

[0158] 2. Experimental Results

[0159] After the CACCC element on HBB is mutated, HBG is still in a state of apparent inhibition. Therefore, the present invention assumes that relieving this inhibition of HBG may further increase γ-globin expression. The silencing of HBG in adulthood is involved in many inhibitory factors, especially BCL11A, the main inhibitor of HbF, which can recruit epigenetic inhibitors such as the NuRD complex to epigenetically silence HBG expression. The epigenetic inhibition of HBG can be relieved by destroying the distal TGACCA element of BCL11A. Therefore, this example simultaneously edited the CACCC element on HBB and the TGACCA element on HBG in HUDEP2 cells and found that compared with editing the TGACCA element alone, the combined editing can increase γ-globin expression by about 1.9 times (PG) and 1.8 times (DG) ( Figure 3 a). HbF levels can be increased from 8.6mAU*min to 18.2mAU*min and 16.8mAU*min ( Figure 4 a). The proportion of F cells also increased in the same way ( Figure 4 b). The CRISPR screening experiment described above was performed in the HUDEP2 monoclonal cell GM-Clone13 homozygous for the TGACCA element, and gRNAs targeting the CACCC element on the HBB promoter were also enriched ( Figure 4 c). In HUDEP2 monoclonal cells edited with both CACCC and TGACCA elements, γ-globin was almost exclusively expressed, while β-globin was almost not expressed, achieving a complete reversal of the switch from γ-globin to β-globin expression ( Figure 3 b, c). Moreover, after mutating both elements, the modifications of H3K4me3 and H3K9Ac on HBG were further increased ( Figure 3d), the interaction between HBG and LCR is further enhanced, while the interaction between HBB and LCR is weakened ( Figure 3 e), and the binding of KLF1 to HBB was further weakened ( Figure 4 d).

[0160] Example 3 Complete reversal of γ- to β-globin expression conversion in vivo

[0161] 1. Experimental Methods

[0162] Construction of 1β-BAC mice and gene editing of the locus

[0163] The BAC vector containing approximately 97kb of the human β-globin gene cluster was microinjected into C57 mouse fertilized eggs and transplanted into surrogate mothers to produce offspring transgenic mice. The integrity, copy number, and globin expression of the transgene in the offspring mice were identified to complete the construction of β-BAC mice.

[0164] Then, CRISPR-Cas9 RNP was used to construct site-edited mice for the CACCC element on the HBB gene and the TGACCA element on the HBG. 0.6 μL 62 μM (IDT's 1081058) Alt-R SpHiFi Cas9 Nuclease V3 (about 32 pmol) and 1.8 μL 44 μM sgRNA synthesized by IDT (about 80 pmol) were added to an RNase-free centrifuge tube, and RNase-free water was added to 60 μL. After incubation at room temperature for 15 minutes, centrifugation was performed, and the supernatant was dispensed into centrifuge tubes for later use. The sequence of sgRNA is mN*mN*mN*NNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAG CAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU, and the gRNA target sequences are as follows: PM-gRNA1: ACCCTGTGGAGCCACA CCCT, PM-gRNA2: GGGTGTGGCTCCACAGGGTG, DM-gRNA: CTTGTCAAGG CTATTGGTCA, GM-gRNA: CTTGTCAAGGCTATTGGTCA. The prepared RNPs were then microinjected into β-BAC mouse fertilized eggs, and offspring mice were produced by surrogate mothers. The mice were genotyped to obtain mouse GM-BAC with mutations in the TGACCA element on HBG, and mouse PG-BAC and DG-BAC with mutations in both the TGACCA element on HBG and the CACCC element on HBB.

[0165] 2. Detection of β-globin expression in β-BAC mice and site-edited mice at different developmental stages

[0166] The yolk sac of β-BAC, GM-BAC, PG-BAC and DG-BAC mice at embryonic day 10.5, the liver of fetal day 12.5, 14.5 and 16.5, and the spleen of newborn mice were respectively obtained, and the Ter119-positive terminally differentiated erythroid cells in these tissues and organs were enriched using anti-Ter119 magnetic beads (according to the instructions of Miltenyi's product number 130-049-901), and the RNA was extracted and reverse transcribed, and the expression of β-globin gene was detected by fluorescent quantitative PCR. The qPCR primers used were designed by conventional methods.

[0167] 2. Experimental Results

[0168] In order to confirm the effect of simultaneous mutation of CACCC and TGACCA elements on the switch of globin expression in vivo, this example established a single copy transgenic mouse β-BAC carrying a ~97 kb human β-globin gene cluster, and established a mouse GM-BAC with mutation of TGACCA element, as well as a mouse PG-BAC and a mouse DG-BAC with mutation of TGACCA and CACCC elements ( Figure 5 a). The present invention detected the expression of β-globin gene in these hemizygous mice from embryonic day 10.5 to newborn, and found that wild-type β-BAC showed normal γ-to-β-globin expression conversion, while GM-BAC mice delayed the γ-to-β-globin expression conversion, and γ-globin was still inhibited at birth, but in PG-BAC and DG-BAC mice, γ-globin was always exclusively expressed from embryonic day 12.5 to birth, while β-globin was almost not expressed, indicating that the simultaneous mutation of the CACCC element on HBB and the TGACCA element on HBG achieved a complete reversal of the γ-to-β-globin expression conversion in mice ( Figure 5 b).

[0169] Example 4 Combination editing of CACCC elements and TGACCA elements to enhance HbF expression in primary human erythroid cells

[0170] 1. Experimental Methods

[0171] 1CD34+ hematopoietic stem and progenitor cells electroporated

[0172] Before electroporation, control the density of CD34+ hematopoietic stem cells from normal peripheral blood or β-thalassemia patients (codon 17 (A>T) / codon41 / 42 (–TTCT)) to ensure good cell growth. Add fresh proliferation medium to the well plate in advance and place it in an incubator at 37°C, 5% CO2 and saturated humidity to incubate in advance to provide good culture conditions for cells after electroporation. Count the cells and resuspend 5×10 in 20μL solution P3 before electroporation. 4 cells.

[0173] The preparation of CRISPR-Cas9 RNP for electroporation is the same as described in Example 1. Then, 6 μL of CRISPR-Cas9 RNP incubation product containing GM-gRNA was mixed with 20 μL of resuspended cells and added to the electroporation cup. The electroporation was performed using the E0-100 program in the Lonza4D-Nucleofector electroporation system. Finally, the electroporation product was transferred into the incubated fresh CD34+ hematopoietic stem cell proliferation medium to complete the electroporation, and the electroporation product was quickly transferred into the incubated fresh proliferation medium. After two days of culture, these cells were electroporated for the second time with CRISPR-Cas9 RNP incubation products containing PM-gRNA1 or DM-gRNA to complete the simultaneous mutation of the CACCC element on HBB and the TGACCA element on HBG.

[0174] 2 Determination and analysis of CRISPR editing efficiency

[0175] The specific CRISPR editing efficiency determination and analysis method is the same as described in Example 1.

[0176] 3. Cultivation of Monoclonal Cells

[0177] The specific culture method is the same as that described in Example 1. The 96-well cell culture plate containing cells was cultured at 37°C, 5% CO2 and saturated humidity, and the wells containing monoclonal cells were replaced with erythroid in vitro differentiation medium when the cells were cultured for 7 days of in vitro proliferation and continued to be cultured. At the end of differentiation, the cells were collected and genotype identification and globin expression detection were performed.

[0178] 4. Extraction, reverse transcription and quantitative PCR of total cell RNA

[0179] After induction of erythroid differentiation of CD34+ hematopoietic stem and progenitor cells for 12 days, 2×10 6 The specific method described in Example 1 was used to extract total RNA from each cell, perform reverse transcription and perform quantitative PCR detection.

[0180] 5HPLC determination of hemoglobin expression

[0181] The specific HPLC method for determining hemoglobin expression is the same as described in Example 1.

[0182] 6. Determination of F cell ratio by flow cytometry analysis

[0183] The specific method for determining the F cell ratio by flow cytometry is the same as described in Example 1.

[0184] 7Chromosome conformation capture (3C)

[0185] The specific method of chromatin conformation capture technology is the same as described in Example 1.

[0186] 8Chromatin immunoprecipitation (ChIP)

[0187] The specific method of chromatin immunoprecipitation is the same as described in Example 1.

[0188] 9-Benzidine-Giemsa staining

[0189] CD34+ hematopoietic stem and progenitor cells were smeared on a glass slide after 12 days of in vitro erythroid differentiation, fixed with methanol for 4 minutes, stained with benzidine staining solution for 2 minutes, and stained with hydrogen peroxide solution for 1 minute and 30 seconds. After washing with deionized water for 30 seconds, they were stained with Giemsa staining solution for 10 minutes, rinsed with PBS, dried at room temperature, and observed and photographed under a microscope.

[0190] 2. Experimental Results

[0191] Increasing the HbF expression level can reduce the polymerization of hemoglobin and thus alleviate the disease manifestations of β-hemoglobinopathy. In order to verify whether CACCC elements and TGACCA elements can increase HbF expression in primary human erythroid cells, this example edited the target in CD34+HSPCs derived from normal human mobilized peripheral blood and performed in vitro erythroid differentiation. It was found that compared with editing the TGACCA element alone, combined editing of CACCC elements and TGACCA elements can increase γ-globin expression by 1.5 times (PG) or 1.2 times (DG) ( Figure 7 a). HbF level can be increased from 79.3mAU*min to 120.2mAU*min and 91.2mAU*min respectively ( Figure 6 a). The proportion of F cells also increased in the same way. Moreover, editing in HSPC did not affect erythroid differentiation ( Figure 7 b). Consistent with the results obtained in HUDEP2 cells, after the combined mutation of these two elements, the apparent modification signal of H3K9Ac on HBG increased, the interaction between HBG and LCR was enhanced, and the interaction between HBB and LCR was weakened ( Figure 7 c, d). The present invention was then verified in CD34+ cells of patients with β-thalassemia, and it was found that combined editing of these two elements can enhance γ-globin expression and F cell ratio ( Figure 6 c, d, e and Figure 8 a). In CD34+ monoclonal cells, it can be seen that combined editing of these two elements can increase γ-globin expression by 1.5 times compared to editing the TGACCA element alone ( Figure 8 b). Editing did not affect erythroid differentiation in CD34+ cells from β-thalassemia patients ( Figure 8 c) Therefore, combinatorial editing of CACCC elements and TGACCA elements can enhance HbF expression in human hematopoietic stem cells.

[0192] In summary, the present invention destroys the interaction between HBB and LCR by mutating the CACCC element on HBB, and relieves the apparent inhibition of HBG by mutating the TGACCA element on HBG, thereby increasing HbF expression to nearly 100% of the total hemoglobin level, and for the first time achieves complete reversal of the conversion of γ- to β-globin expression, providing a new treatment strategy and direction for β-hemoglobinopathy.

Claims

1. Use of agents that simultaneously disrupt HBB competition and HBG epigenetic silencing in the preparation of drugs for treating β-hemoglobinopathies; The simultaneous disruption of HBB competition and HBG epigenetic silencing is achieved by disrupting the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter.

2. The use according to claim 1, characterized in that: The simultaneous disruption of HBB competition and HBG epigenetic silencing is achieved by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter.

3. The use according to claim 2, characterized in that: The types of mutations include deletion, substitution, insertion, inversion, duplication and / or translocation mutations; Preferably, the deletion mutation comprises removing one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; Preferably, the substitution mutation comprises replacing one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter with other bases; Preferably, the insertion mutation comprises inserting one or more bases at any position in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; Preferably, the inversion mutation comprises the inversion of one or more base positions in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; Preferably, the repeat mutation comprises the repeat of one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; Preferably, the translocation mutation comprises one or more bases in the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter moving from one position to another.

4. The use according to claim 3, characterized in that: The deletion mutation is to mutate the CACCC element on the HBB promoter to any one of the deletions of CAC, CC, CACC, C, ACCC, CCC, CACCCc, CAaCCC, CACtCC, CACacattggCC, CACTC, CACT or all of the CACCC elements, and to mutate the TGACCA element on the HBG promoter to any one of the deletions of TGACA, TGAA, TGAC, TGA, TG, CCA, T, CA, A, TGAtCCA, TGAcaaggctattgCCA, TGAaCCA, TGaA or all of the TGACCA elements; Preferably, the replacement mutation is to mutate the CACCC element on the HBB promoter to any one of TACCC, CATCC, CACTC, CACCT, TATCC, TACTC, TACCT, CATTC, CATCT, CACTT, TATTC, TATCT, TACTT, CATTT or TATTT, and to mutate the TGACCA element on the HBG promoter to any one of TAACCA, TGATCA, TGACTA or TGATTA; Preferably, the technology used for the replacement mutation is selected from any one of single-base gene editing technology and CRISPR-Cas9 gene editing technology.

5. The use according to claim 4, characterized in that: The simultaneous disruption of HBB competition and HBG epigenetic silencing enables complete reversal of the switch from γ- to β-globin expression.

6. A pharmaceutical composition for treating β-hemoglobinopathies, characterized in that: The pharmaceutical composition comprises the agent according to any one of claims 1 to 5; Preferably, the agent achieves complete reversal of the switch from γ- to β-globin expression by simultaneously disrupting HBB competition and HBG epigenetic silencing.

7. The pharmaceutical composition according to claim 6, characterized in that The pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

8. A pharmaceutical preparation for treating β-hemoglobinopathies, characterized in that: The pharmaceutical preparation comprises the pharmaceutical composition according to claim 6 or 7.

9. A method for completely reversing the conversion of γ-globin to β-globin expression in vitro for non-therapeutic purposes, characterized in that: The method is to completely reverse the conversion of γ-globin expression to β-globin expression by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; Preferably, the mutation is as described in claim 3 or 4.

10. A method for promoting γ-globin expression and inhibiting β-globin expression in vitro for non-therapeutic purposes, characterized in that: The method is achieved by mutating the CACCC element on the HBB promoter and the TGACCA element on the HBG promoter; Preferably, the mutation is as described in claim 3 or 4.

Images