Multi-antigen epitope fusion protein of yak-derived B-type pasteurella multocida, outer membrane vesicle vaccine and preparation method of multi-antigen epitope fusion protein and outer membrane vesicle vaccine

Abstract

The invention discloses a multi-antigen epitope fusion protein of yak-derived B-type pasteurella multocida, an outer membrane vesicle vaccine and a preparation method of the outer membrane vesicle vaccine, and relates to the technical field of genetic engineering and immunology. The amino acid sequence of the multi-epitope fusion protein is as shown in SEQ ID NO. 2. The multi-antigen epitope fusion protein provided by the invention can stimulate yaks to generate specific antibodies and protect the yaks from resisting yak-derived B-type pasteurella multocida infection. Therefore, the multi-antigen epitope fusion protein provided by the invention can be prepared into a subunit vaccine for preventing yak source type B pasteurella multocida infection. The invention further provides an outer membrane vesicle vaccine of the yak-derived B-type pasteurella multocida, and the vaccine can effectively activate humoral immune response of a tested yak and generate a high-level specific antibody, so that the vaccine can be applied to prevention of yak-derived B-type pasteurella multocida infection.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering technology and immunology technology, and in particular to a yak-derived B-type Pasteurella multocida multi-epitope fusion protein, an outer membrane vesicle vaccine and a preparation method thereof. Background Art

[0002] Pasteurella multocida (Pm) can infect a variety of livestock, poultry and wild animals, and there are differences in host preference and pathogenicity between strains of different serotypes. Among them, the hemorrhagic septicemia of cattle caused by capsular type B Pm has caused serious harm to my country's yak breeding industry due to its rapid onset and high mortality rate.

[0003] At present, the use of inactivated Pasteurella multocida vaccine is the main means of preventing and treating bovine hemorrhagic sepsis. This inactivated vaccine is made by amplifying the epidemic strain of Pasteurella multocida in a bacterial culture system, inactivating it, emulsifying it, and other processes, and has played an important role in controlling the prevalence of Pasteurella multocida in cattle in my country. However, traditional inactivated vaccines have the disadvantages of high production cost, large injection dose, slow induction of humoral immune response, short immunity duration, and poor cellular immune response. There is also a risk of spreading the virus due to incomplete bacterial inactivation during the production and preparation process.

[0004] Bacterial outer membrane vesicles (OMV) are spherical nanovesicles secreted by Gram-negative bacteria with a diameter of 20nm-250nm. The outer membrane proteins, lipoproteins, LPS, etc. contained in OMV can be recognized by a series of pattern recognition receptors (PRR) and induce innate immune responses, and OMV can be recognized by antigen presenting cells and activate acquired immune responses. At present, there are mature Neisseria vaccines abroad, and there are also related studies on OMV vaccines in China, but the vaccine for bovine hemorrhagic septicemia is still only an inactivated vaccine, and the corresponding outer membrane vesicle vaccine development field is still blank. Summary of the invention

[0005] The purpose of the present invention is to provide a multi-antigen epitope fusion protein of yak-derived type B Pasteurella multocida, an outer membrane vesicle vaccine and a preparation method thereof, so as to solve the problems existing in the above-mentioned prior art. The multi-antigen epitope fusion protein can stimulate yaks to produce specific antibodies and protect yaks against yak-derived type B Pasteurella multocida infection. Therefore, the antigen provided by the present invention can be made into a subunit vaccine for preventing yak-derived type B Pasteurella multocida infection.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a multi-antigen epitope fusion protein of yak-derived B-type Pasteurella multocida. The amino acid sequence of the multi-antigen epitope fusion protein is shown in SEQ ID NO.2.

[0008] The present invention also provides a gene encoding the above-mentioned multi-antigen epitope fusion protein.

[0009] Furthermore, the nucleotide sequence of the encoding gene is shown in SEQ ID NO.3.

[0010] The present invention also provides a recombinant plasmid, comprising the above coding gene.

[0011] The present invention also provides a recombinant host cell, comprising the above-mentioned recombinant plasmid.

[0012] The present invention also provides the use of the above-mentioned encoding gene, recombinant plasmid or recombinant host cell in the preparation of a subunit vaccine of yak-derived type B Pasteurella multocida.

[0013] Furthermore, the subunit vaccine is an outer membrane vesicle vaccine.

[0014] The present invention also provides a method for preparing an outer membrane vesicle vaccine of yak-derived Pasteurella multocida type B, comprising the following steps: fermenting and culturing the above-mentioned recombinant host cells and inducing the expression of multi-antigen epitope fusion proteins, and then isolating and obtaining cell outer membrane vesicles, namely the outer membrane vesicle vaccine.

[0015] The present invention also provides an outer membrane vesicle vaccine prepared according to the above preparation method.

[0016] Furthermore, the outer membrane vesicle vaccine also includes a vaccine adjuvant.

[0017] The present invention discloses the following technical effects:

[0018] The multi-antigen epitope fusion protein provided by the present invention can stimulate yaks to produce specific antibodies and protect yaks against yak-derived Pasteurella multocida type B infection. Therefore, the multi-antigen epitope fusion protein provided by the present invention can be made into a subunit vaccine for preventing yak-derived Pasteurella multocida type B infection.

[0019] The present invention also provides an outer membrane vesicle vaccine of yak-derived type B Pasteurella multocida, which can effectively activate the humoral immune response of the tested yaks and produce a high level of specific antibodies, and thus can be used to prevent yak-derived type B Pasteurella multocida infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 Schematic diagram of the construction strategy of the recombinant plasmid pBAD24(CmR)-ClyA-P;

[0022] Figure 2 The results of Western Blot identification of protein expression; Lane M is a marker, Lane 1 is a control bacterial solution, and Lane 2 is an induced bacterial solution;

[0023] Figure 3 This is a transmission electron microscope observation image of OMV; the scale bar is 100 nm;

[0024] Figure 4 This is the NTA detection diagram of OMV;

[0025] Figure 5 The results of proteinase K detection of recombinant fusion protein expressed on the outside of OMV membrane; Lane 1 is the marker, Lane 2 is the OMV with SDS but no proteinase K, Lane 3 is the OMV with proteinase K but no SDS, and Lane 4 is the OMV with both SDS and proteinase K added;

[0026] Figure 6 This is the test result of yak serum antibodies after vaccination. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] The instruments used in the present invention are all common commercial products and can be purchased in the market.

[0033] Example 1 Recombinant expression of yak-derived Pasteurella multocida fusion antigen

[0034] The present invention analyzes the ompH, ompA, PlpE, VacJ, and P6 genes of yak-derived type B Pasteurella, and selects sequence fragments with high signal peptide, highly conserved region, and antigen epitope scores. The specific prediction method is as follows: the amino acid sequences encoding ompH, ompA, PlpE, VacJ, and P6 are uploaded to ABCpred (https: / / webs.iiitd.edu.in / raghava / abcpred / index.), the Threshold value is set to 0.8, the epitope length is 16aa, 18aa, and 2 0aa; upload the encoded amino acid sequence to BCPred (http: / / ailab-projects2.ist.psu.edu / bcpred / predict.html), set the epitope length to 16aa, 18aa, 20aa, 22aa, and the classification specificity to 90%; upload the encoded amino acid sequence to BepiPred (https: / / services.healthtech.dtu.dk / services / BepiPred-2.0 / ), and use flexible length prediction. The scores of the above antigenic epitopes are shown in Tables 1-3. Short peptide fragments with high antigenic epitope overlap rates are selected for truncation. After the fragments are concatenated using the GGSSG sequence, the ClyA gene is connected to the 5' end of the nucleotide sequence, and the ribosome binding site sequence and protective bases are inserted at the 5' end of the fusion gene, and the 6*His protein tag and stop codon are inserted at the 3' end, thereby obtaining the coding gene of the multi-epitope fusion protein.

[0035] Table 1 Antigenic scores of ABCpred for ompH, ompA, PlpE, VacJ, and P6 proteins

[0036]

[0037]

[0038]

[0039] Table 2 Antigenic scores of ompH, ompA, PlpE, VacJ and P6 proteins by BCPred

[0040]

[0041] Table 3 Antigenic scores of Bepipred for ompH, ompA, PlpE, VacJ, and P6 proteins

[0042]

[0043] The amino acid sequence of the protein encoded by the ClyA gene is shown in SEQ ID NO.1, and the amino acid sequence of the multi-antigenic epitope fusion protein is shown in SEQ ID NO.2.

[0044] SEQ ID NO.1:

[0045] MTEIVADKTVEVVKNAIETADGALDLYNKYLDQVIPWQTFDETIKELSRFKQEYSQAASVLVGDIKTLLMDSQDKYFEATQTVYEWCGVATQLLAAYILLFDEYNEKKASAQKDILIKVLDDGITKLNEAQKSLLVSSQSFNNASGKLLALDSQLTNDFSEKSSYFQSQVDKIRREAYAGAAAGVVAGPFGLIISYSIAAAVVEGKLIPELKNKLKSVQNFFTTLSNTVKQANKDIDAAKLKLTTEIAAIGEIKTETETTRFYVDYDDLMLSLLKEAAKKMINTCNEYQKRHGKKTLFEVPEV.

[0046] SEQ ID NO.2:

[0047] TANKKSIDEKIAASQKKVEAKVAALQKDAPKLRSADIKKREEEINKLGNSEQEAINKLVTAHDEEVSKYQDDYAKREREETAKLVDSIQNGGSSGNLSKVTPEGTSDNLVWPKIDESVFNHDGSQFGSWPNWDNVRMVERGMNKDQLYNLLGRPHFSEGLYGVREWDYVFNYRENGVHKVCQYKVLFDKNMNAQSFFWYPNGCNGSGGSSGNDFGDVTYKKSNAERRDFVAKNSKAFGKKFIVLPNTQYGDWEGGLDKNYFKGDSQSKLDVRAKGGSSGRAKALDKDALLEQSQDPYITFREAYFQNLEYRVKDGKVSTPKQDLTQDILNGGSSGGSSKKDESAGQMFGGYSVQDLQQRYNTVYFGFDKYNIEGEYVQILDAHAAFLNATPATKVVVEGNTDERGTPEYNIALGGSSG.

[0048] SEQ ID NO.3:

[0049] gaattcTTAAAGAGGAGAAAGGTCATGACTGAAATCGTTGCAGATAAAACGGTAGAGG

[0050] TAGTTAAAAACGCAATCGAAACCGCAGATGGAGCATTAGATCTTTATAATAAATATCTCG

[0051] ATCAGGTCATCCCCTGGCAGACCTTCGATGAAACCATAAAAGAGTTAAGTCGCTTTAAA

[0052] CAGGAGTATTCACAGGCAGCCTCCGTTTTAGTTGGCGATATTAAAACCTTACTTATGGAT

[0053] AGCCAGGATAAGTATTTTGAAGCAACCCAAACGGTGTATGAATGGTGTGGTGTTGCGAC

[0054] GCAATTGCTCGCAGCATATATTTTGCTATTTGATGAGTACAATGAGAAGAAAGCATCCGC

[0055] CCAGAAAGACATTCTCATTAAGGTACTGGATGACGGCATCACGAAGCTGAATGAAGCGC

[0056] AAAAATCTCTGCTGGTAAGCTCACAAAGTTTCAACAACGCTTCCGGAAAACTGCTGGCG

[0057] TTAGATAGCCAGTTAACCAATGATTTTTCAGAAAAAAGCAGCTATTTCCAGTCACAGGTA

[0058] GATAAAATCAGGAGGGAAGCGTATGCCGGTGCCGCAGCCGGTGTCGTCGCCGGTCCATT

[0059] TGGATTAATCATTTCCTATTCTATTGCTGCGGCCGTAGTTGAAGGGAAACTGATTCCAGAA

[0060] TTGAAGAACAAGTTAAAATCTGTGCAGAATTTCTTTACCACCCTGTCTAACACGGTTAAA

[0061] CAAGCGAATAAAGATATCGATGCCGCCAAATTGAAATTAACCACCGAAATAGCCGCCATC

[0062] GGTGAGATAAAAACGGAAACTGAAACAACCAGATTCTACGTTGATTATGATGATTTAATG

[0063] CTTTCTTTGCTAAAAGAAGCGGCCAAAAAAATGATTAACACCTGTAATGAGTATCAGAA

[0064] AAGACACGGTAAGAAGACACTCTTTGAGGTACCTGAAGTCGGTGGCAGCAGCGGTACC

[0065] GCAAACAAGAAGAGCATTGATGAAAAAATTGCAGCAAGCCAGAAGAAGGTGGAAGCA

[0066] AAAGTGGCAGCACTGCAGAAAGATGCACCGAAACTGCGTAGTGCGGATATTAAGAAGC

[0067] GCGAAGAAGAAATTAATAAACTGGGTAATAGCGAACAGGAAGCAATCAATAAACTGGTA

[0068] ACCGCGCATGATGAAGAAGTGAGCAAATATCAGGATGATTATGCAAAACGTGAACGTGA

[0069] AGAAACAGCAAAACTGGTGGATAGCATTCAGAATGGTGGTAGTAGCGGTAACCTGAGTA

[0070] AAGTGACACCGGAAGGTACCAGCGATAATCTGGTGTGGCCTAAAATTGATGAAAGCGTG

[0071] TTTAATCATGATGGTAGCCAGTTTGGCAGCTGGCCGAATTGGGATAATGTGCGTATGGTG

[0072] GAACGTGGTATGAAATAAAGATCAGCTGTATAATCTGCTGGGCCGTCCGCATTTTCTGAA

[0073] GGTCTGTATGGTGTTCGTGAATGGGATTATGTTTTTAAATTATCGTGAAACGGCGTGCATA

[0074] AAGTTTGTCAGTATAAAGTTCTGTTTGATAAAAACATGAACGCACAGAGTTTCTTCTGGT

[0075] ATCCGAATGGTTGCAATGGTAGCGGCGGTAGTTCCGGCAATGATTTTGGTGATGTTACCT

[0076] ATAAGAAGTCTAATGCAGAACGCCGTGATTTTGTTGCAAAAAAACTCAAAGCCTTTGGC

[0077] AAGAAGTTTATTGTTCTGCCGAATACACAGTATGGTGATTGGGAAGGTGGTCTGGATAAA

[0078] AATTATTTTAAAGGTGATAGTCAGAGTAAACTGGATGTTCGTGCCAAAGGTGGTAGCTCA

[0079] GGTCGTGCAAAGCCCTGGATAAAGATGCGCTGCTGGAACAGAGCCAGGATCCTGTATAT

[0080] CACATTTCGTGAAGCATATTTTCAGAATCTGGAATATCGTGTTAAAAGATGGTAAAGTTAGT

[0081] ACCCCTAAACAGGATCTGACCCAGGATATTCTGAATGGTGGTAGCAGCGGTGGTAGCAG

[0082] TAAGAAGGATGAAAGCCGGGCCAGATGTTTGGTGGTTAGCGTGCAGGATCTGCAGC

[0083] AGCGTTATAATACCGTTTATTTTGGTTTTGATAAATATAACATCGAAGGCGAATATGTGCA

[0084] GATTCTGGATGCACATGCAGCATTTCTGAATGCAACCCCGGCAACCAAAGTTGTTGTCG

[0085] AAGGTAACACCGATGAACGTGGTACCCCGGAATATAACATTGCACTGGGTGGTAGCTCTGGTCATCATCATCATCATCATTAAaagctt.

[0086] In order to increase the possibility of soluble protein expression, the nucleotide sequence encoding the fusion protein was codon optimized. The optimized nucleotide sequence is shown in SEQ ID NO.3, that is, the codons encoding SEQ ID NO.1 and SEQ ID NO.2 were synonymously replaced to adjust the GC content. An EcoRⅠ restriction site was inserted at the 5' end of the synthetic fusion protein nucleotide sequence, and a HindⅢ restriction site was inserted at the 3' end. The optimized sequence was synthesized and identified by Beijing Qingke Biotechnology Co., Ltd. The optimized sequence was connected to the pBAD24 (CmR) vector by double enzyme digestion to obtain the recombinant plasmid pBAD24 (CmR)-ClyA-P. The pBAD24 (CmR) vector was obtained by the transformation of the pBAD24 vector, specifically: the gene cassette expressing ampicillin resistance in pBAD24 was replaced with a gene cassette expressing chloramphenicol resistance. The pBAD24 (CmR) vector was provided by Professor Li Jiakui's laboratory at Huazhong Agricultural University.

[0087] The successfully identified recombinant plasmid was transformed into Escherichia coli Nissle1917 (ΔnlpIΔlpxM) to obtain the recombinant strain. Escherichia coli Nissle1917 (ΔnlpIΔlpxM) was kindly donated by Professor Yung-fu Chang of Cornell University.

[0088] The recombinant strain was inoculated into the culture medium. Specifically, 100 μL of bacterial solution was inoculated into 100 mL of LB culture medium (containing 50 mg / mL chloramphenicol) at 200 rpm and 37°C overnight. The next day, the overnight bacteria were transferred to 1 L of LB culture medium (containing 50 mg / mL chloramphenicol) at a ratio of 1:100 and cultured at 200 rpm and 37°C until OD 6000.6-0.8, add 2g L-arabinose, and continue induction for 12h. Take 1mL of the bacterial solution before and after induction and do the following: centrifuge at 12,000rpm for 2min, discard the supernatant, resuspend the bacteria with 80μL PBS, add 20μL 5× loading buffer, mix well, and boil for 15min.

[0089] The sample was identified by Western Blot to confirm the expression of this protein. The specific operation is as follows: First, perform a 10% SDS polyacrylamide gel electrophoresis experiment. At the same time, prepare the required reagents: Transfer solution: Take transfer powder and add 200mL of anhydrous ethanol, dilute to 1L with distilled water, and refrigerate at 4℃ for use. TBST: Dilute 20×TBST buffer to 1×TBST. Blocking buffer: Weigh 5g of skim milk powder, add 100mL of TBST, and prepare it for use.

[0090] Transfer: The wet transfer method used in the present invention is to pre-cool the transfer solution in a 4°C refrigerator, transfer the SDS-PAGE gel to the transfer solution, and cut the PVDF membrane according to the size of the target protein gel. The transfer condition is a constant current of 220 mA for 1 hour.

[0091] After the transfer is completed, remove the PVDF membrane and block it with 5% skim milk powder at room temperature for 2 hours (or overnight at 4°C). Dilute the His tag protein monoclonal antibody with the primary antibody diluent at a ratio of 1:5000 and incubate at room temperature for 1 hour; then wash the membrane with TBST on a shaker at room temperature 3 times, 10 minutes each time. Dilute HRP-labeled goat anti-mouse IgG as the secondary antibody at a ratio of 1:10000 and incubate at room temperature for 1 hour; discard the secondary antibody and wash the membrane with TBST 3 times, 5 minutes each time. Mix the A solution and B solution in the ultrasensitive ECL chemiluminescence kit at a ratio of 1:1, use filter paper to absorb the residual TBST on the PVDF membrane, put the membrane into the imaging system, add the luminescent liquid on the membrane, and adjust the parameters of the instrument for exposure.

[0092] According to the results of Western Blot ( Figure 2 ) It can be seen that the recombinant strain can express the target recombinant protein after being induced by L-arabinose. Lane 1 is the marker, lane 2 is the uninduced bacterial solution, and lane 3 is the induced bacterial solution.

[0093] Example 2 Preparation of recombinant E. coli OMV

[0094] Take 1L of the bacterial solution induced with L-arabinose in Example 1, centrifuge at 8,000rpm to remove the bacteria to obtain the supernatant, filter through a 0.45μm filter, and use a 100KD ultrafiltration membrane for ultrafiltration to concentrate to about 200mL. Centrifuge at 150,000×g for 2h, resuspend the precipitate, ultracentrifuge at 150,000×g for 2h, and resuspend with 1mL of PBS to obtain OMV. After the concentration is determined by the BCA method, the devices are stored in a -80℃ refrigerator for standby use.

[0095] Observe the morphology of OMVs using a transmission electron microscope. Take the collected OMVs, dilute them at different gradients, take 10 μL of OMVs and drop them on the copper grid. Let it stand for 10 minutes and then carefully wash off the liquid. Use 2% phosphotungstic acid solution to stain the OMVs. Let it stand for 2 minutes and then remove the staining liquid and observe it under a transmission electron microscope. Figure 3 As shown, a saucer-shaped outer membrane vesicle structure was observed under transmission electron microscopy, and the morphological structure was relatively clear.

[0096] The ZetaView Particle Metrix instrument sample pool was cleaned with pure water for 3 times, and then the instrument was calibrated with a standard (100nm PS beads, polystyrene microspheres). The sample to be tested was diluted with PBS buffer, and the diluted OMV sample was added to the sample pool to observe the real-time dynamic image of the nanoparticles and collect data. The dilution ratio was 1:4000, and the particle detection concentration was 6.4×10 7 Particles / mL. Figure 4 As shown in Figure 2, the OMV obtained after separation and purification has two peaks at 236.3nm and 172.7nm. The original particle size concentration is calculated to be 2.6×10 11 Particles / mL, of which 50% of the distribution has a smaller particle size of 201.3 nm. The particle characterization results of OMVs show that the isolated OMVs have good stability.

[0097] Example 3 Localization detection of recombinant fusion protein in OMV

[0098] ClyA has the function of anchoring to the cell outer membrane. It is connected in series with the target fusion protein so that the target fusion protein is expressed on the outer membrane of OMV, thereby exposing the antigen epitope. The proteinase K method is used to detect the localization of the fusion protein, as follows:

[0099] Take three 200 μL EP tubes, add 100 μL OMV, add proteinase K with a final concentration of 0.1 mg / mL in the presence or absence of 1% SDS, add phenylmethylsulfonyl fluoride (PMSF) with a final concentration of 10 mM after 10 min at 37°C, then aspirate 80 μL of the sample, add 20 μL 5× loading buffer, mix well, and boil for 15 min. The sample is identified by Western Blot to determine the location of the protein expression. The method is the same as in Example 1.

[0100] According to Western Blot results ( Figure 5 ) It can be seen that the recombinant protein is expressed in the outer membrane of OMV, where lane 1 is the marker, lane 2 is the OMV with SDS but no proteinase K, lane 3 is the OMV with proteinase K but no SDS, and lane 4 is the OMV with both SDS and proteinase K.

[0101] Example 4 Preparation of recombinant vaccine

[0102] Follow these steps to prepare the vaccine:

[0103] The OMV prepared in Example 2 was mixed with the ISA 61VG adjuvant to prepare the vaccine rOMV@ISA 61VG, wherein the volume ratio of OMV to ISA 61VG was 3:2, and each dose of the vaccine contained 600 μg of OMV.

[0104] The OMV prepared in Example 2 was mixed with the Gel 01 adjuvant to prepare the vaccine rOMV@Gel 01, wherein the volume ratio of OMV to Gel 01 was 10:1, and each dose of the vaccine contained 600 μg of OMV.

[0105] The OMV prepared in Example 2 was mixed with Al(OH)3 adjuvant to prepare the vaccine rOMV@Al(OH)3, wherein the volume ratio of OMV to Al(OH)3 adjuvant was 1:4, and each dose of the vaccine contained 600 μg of OMV.

[0106] Example 5

[0107] 1. Evaluation of the immune effect of OMV vaccine on yaks

[0108] Yak calves aged 6 months to 1 year without antibodies to Pasteurella multocida were randomly divided into 5 groups, 4 in each group. The OMV prepared in Example 2 and the three vaccines prepared in Example 4 were used for immunization, wherein the rOMV@Gel 01 group was subcutaneously injected with rOMV@Gel 01 prepared in Example 4; the rOMV group was intramuscularly injected with OMV prepared in Example 2; the rOMV@ISA 61VG group was intramuscularly injected with rOMV@ISA 61VG prepared in Example 4; the rOMV@Al(OH)3 group was intramuscularly injected with rOMV@Al(OH)3 prepared in Example 4; and the control group was intramuscularly injected with PBS. A booster immunization was performed 21 days after the first immunization. On the 42nd day, 2 million B-type Pasteurella multocida were injected subcutaneously, and the yaks were observed for 7 days to evaluate the protective power of the vaccine. If the yaks showed obvious respiratory symptoms or clinical symptoms of cattle dysentery such as subcutaneous edema, the immunization was judged to be ineffective.

[0109] As shown in Table 4, within 7 days after the infection, all yaks in the control group were judged to have no immune effect, while all immune groups had a protective effect, among which the combination of OMV and adjuvant showed a better immune effect.

[0110] Table 4 Evaluation results of immune protection of yaks after OMV vaccine immunization

[0111] Grouping Number of surviving heads Protection rate PBS 0 / 4 0 OVV 1 / 4 25％ rOMV@Gel01 2 / 4 50％ rOMV@ISA61VG 3 / 4 75％ <![CDATA[rOMV@Al(OH)3]]> 3 / 4 75％

[0112] 2. Detection of yak serum antibody levels

[0113] After each group is immunized, 5 mL of blood is collected from the jugular vein every 7 days. The blood is allowed to stand until the serum is precipitated, and the supernatant is centrifuged at 4°C and stored at -20°C. The ELISA method is used to detect the antibody level in the serum as follows:

[0114] ① Coating: Dilute the OMV obtained in Example 2 to 20 μg / mL with the coating solution, add 100 μL to each well of the ELISA test plate, and place at 4°C overnight. The next day, discard the solution in the wells, add 200 μL PBST solution to each well, let stand for 2 minutes, and then tap clean, repeat 3 times.

[0115] ② Blocking: Add 200 μL of blocking horse serum to each well, incubate at 37°C for 2 h, discard the blocking solution and wash three times with PBST.

[0116] ③ Sample addition: dilute the serum to be tested with PBS at a ratio of 1:500 and add 100 μL to each well. Set up 3 replicates for each sample. Incubate at 37°C for 1 hour, discard the solution in the well, and add PBST to wash 3 times.

[0117] ④ Add enzyme-labeled secondary antibody: Add HRP-labeled goat anti-bovine IgG (1:10000 dilution), incubate at 37℃ for 1h, discard the liquid and add PBST to wash 3 times.

[0118] ⑤ Color development: Add 50 μL of TMB substrate color development solution and incubate at 37°C for 15 min in the dark.

[0119] ⑥Terminate the reaction: add 50 μL of stop solution (2 M sulfuric acid).

[0120] Result determination: Place the ELISA plate in an ELISA reader and measure the OD value of each well at 450nm.

[0121] like Figure 6 As shown, all immunized groups began to produce antibodies from the 7th day after immunization, and the serum IgG level on the 42nd day was significantly higher than that of the control group, with a very significant difference (P < 0.001).

[0122] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A multi-epitope fusion protein of yak-derived Pasteurella multocida type B, characterized in that: The amino acid sequence of the multi-antigen epitope fusion protein is shown in SEQ ID NO.

2.

2. A gene encoding the multi-antigen epitope fusion protein as claimed in claim 1.

3. The coding gene according to claim 2, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.

3.

4. A recombinant plasmid, characterized in that: Comprising the coding gene described in claim 2 or 3.

5. A recombinant host cell, characterized in that Comprising the recombinant plasmid described in claim 4.

6. Use of the coding gene according to claim 2 or 3, the recombinant plasmid according to claim 4 or the recombinant host cell according to claim 5 in the preparation of a subunit vaccine of yak-derived Pasteurella multocida type B.

7. The use according to claim 6, characterized in that: The subunit vaccine is an outer membrane vesicle vaccine.

8. A method for preparing an outer membrane vesicle vaccine of yak-derived Pasteurella multocida type B, characterized in that: The following steps are involved: The recombinant host cell of claim 5 is fermented and cultured to induce the expression of the multi-antigen epitope fusion protein of claim 1, and then the outer membrane vesicles are isolated to obtain the outer membrane vesicle vaccine.

9. An outer membrane vesicle vaccine prepared according to the preparation method according to claim 8.

10. The outer membrane vesicle vaccine according to claim 9, characterized in that The outer membrane vesicle vaccine also includes a vaccine adjuvant.

Images