RPA-LFD reagent and kit for detecting sheep vesicular epidemic disease virus and application of RPA-LFD reagent and kit

Abstract

The invention discloses an RPA-LFD reagent and a kit for detecting an ovine vesicular epidemic disease virus and application of the RPA-LFD reagent and the kit. The reagent provided by the invention has relatively high sensitivity and specificity, the detection sensitivity of ORFV and CaPV reaches 5 * 10 < 1 > copies / [mu] L and 8 * 10 < 1 > copies / [mu] L, and the detection effect is stable, the rapid nucleic acid detection kit is prepared by using a dual RPA-LFD technology, and under the action of LFD chromatography, an amplification product is combined with a corresponding antibody marked on a test strip to generate an antigen-antibody immunoreaction, so that the detection sensitivity of ORFV and CaPV is greatly improved. The orf virus and the capripox virus can be simultaneously detected on the same test strip, so that the detection can be quickly, simply and conveniently realized.

Description

Technical Field

[0001] The present invention relates to the field of animal epidemic biotechnology, and in particular to an RPA-LFD reagent, a kit and an application thereof for detecting sheep vesicular disease virus. Background Art

[0002] Sheep vesicular diseases include foot-and-mouth disease, peste des petits ruminants, sheep pox and sheep ecthyma, which are all common viral diseases in the sheep industry. They can all cause blister symptoms in sheep and are all major or important diseases, causing significant losses to my country's sheep industry. Among them, sheep ecthyma (ORF), also known as contagious ecthyma, is a contact infectious disease of sheep and goats caused by the sheep ecthyma virus (ORFvirus, ORFV). It is characterized by the formation of papules, blisters, pustules and wart-like scabs on the lips, tongue, nose, breasts and other parts. It mainly occurs in lambs aged 3-6 months. Adult sheep can also be infected with this disease during the breeding process. It often occurs in groups. Once the flock is infected, ecthyma will occur continuously, showing an epidemic trend. Sheep ecthyma causes pain in the sheep's mouth and difficulty eating, and then the lips swell and ulcers form. It is even difficult to eat and even leads to death. Sheep ecthyma has been prevalent in my country for a long time. [1,2] , which is very harmful to the sheep farming industry and has been on the rise in my country in recent years. [3,4] , which is a Class I animal infectious disease as stipulated by the state. Capripox (CaP) is an acute, febrile, contact infectious disease caused by infection with the Capripoxvirus (CaPV). It is listed as a notifiable animal disease by the World Organization for Animal Health (OIE) and is also listed as a Class I infectious disease in my country. CaPV includes Sheeppox virus (SPPV), Goatpoxvirus (GTPV) and Lump skin disease virus (LSDV). The CaPV genome is highly conserved, and the consistency of the SPPV and GTPV genomes is over 96%.

[0003] Clinically, vesicular diseases have the following two characteristics: (1) They all produce vesicular symptoms, which can easily lead to confusion based on clinical symptoms alone, so differential diagnosis at the nucleic acid level is necessary; (2) They spread quickly and develop rapidly. If timely measures are not taken, they can easily lead to large-scale transmission, so diagnosis needs to be made as quickly as possible.

[0004] Different treatment methods for different vesicular diseases are different: foot-and-mouth disease, peste des petits ruminants and sheep pox are national Class I infectious diseases, and clinically only prevention is the main approach. Once an epidemic is discovered, it should be reported immediately to the relevant departments for blockade and culling; while sheep ulcers can be treated accordingly. Therefore, a rapid method is urgently needed for diagnosis to determine the appropriate treatment measures.

[0005] Therefore, there is an urgent need for simple and rapid dual nucleic acid testing in the prevention and control of sheep aphthous ulcers and sheep pox.

[0006] Nucleic acid amplification technology with polymerase chain reaction (PCR) as its core can achieve the diagnosis, identification, and typing of animal diseases by amplifying pathogen nucleic acids. It has the advantages of accuracy, rapidity, sensitivity, good repeatability, and easy standardization. It is recognized as the most reliable rapid detection technology and is widely used in the veterinary field. However, PCR and its derivative technologies, such as fluorescent quantitative PCR and immune PCR, all require denaturation, annealing, and extension steps at different temperatures, and therefore have the following disadvantages: (1) expensive large-scale cycle temperature control equipment is required; (2) the operation is complicated and time-consuming; (3) post-processing such as electrophoresis of traditional PCR is prone to nucleic acid contamination and false positives.

[0007] Recombinase polymerase isothermal amplification (RPA) is a nucleic acid amplification technology mediated by recombinase polymerase, which can isothermally amplify the target fragment at 37℃~42℃. Lateral flow detection (LFD) is the application of immunochromatography colloidal gold immunoassay in paper chromatography. Adding a specific nucleic acid probe with an antigen label for the target fragment to the RPA or RAA reaction system, it is cross-linked with the second label-specific antigen on the colloidal gold nanoparticles by binding to the label-specific antibody on the surface of the lateral flow strip detection line, thereby realizing the recognition of the antigen label, thereby generating a color signal that can be semi-quantitatively analyzed by the naked eye. RPA combined with LFD (RPA-LFD) can achieve rapid visualization of nucleic acid amplification results without the need for agarose gel electrophoresis. Compared with PCR, it has the following advantages: (1) It can be carried out at a relatively low temperature, with a standard reaction time of 37°C-42°C. It can also react and obtain results at a wider temperature, near room temperature, from 25°C to -42°C. It does not require denaturation and melting steps, and does not require repeated heating and cooling. Therefore, it does not require expensive cycle temperature control equipment, which is conducive to grassroots use. (2) The reaction is rapid and can generally be completed within 10min-20min. (3) It has high sensitivity and can detect 10 copies of the target fragment. (4) It has high specificity and is not significantly different from the specificity of qPCR. (5) The nucleic acid product does not require post-processing, does not require electrophoresis, and is not prone to cross-contamination. (6) It does not require expensive equipment and can be operated in the field. The operation is simple and the operator does not require professional training. It can be used at the grassroots level and in the field.

[0008] Currently, RPA-LFD technology has been used in the diagnosis of many diseases; however, it is less used in cattle and sheep diseases. Summary of the invention

[0009] The present invention aims to solve at least one of the above-mentioned technical problems existing in the prior art. To this end, the object of the present invention is to provide an RPA-LFD reagent, a kit and an application for detecting sheep vesicular disease virus, wherein the reagent can realize the simultaneous detection of sheep pox virus and sheep orthosis virus.

[0010] In order to achieve the above object, the technical solution adopted by the present invention is:

[0011] The first aspect of the present invention provides a reagent, comprising a primer pair and / or a probe; the primer pair is a primer pair 1 and a primer pair 2; the probe is a probe 1 and a probe 2; the primer pair 1 comprises an upstream primer 1F and a downstream primer 1R, the sequence of 1F is: ACGACGCTGCGAACAACACTAAGCTGCTCAT, and the sequence of 1R is: TCCTTGACGATGTCGCCCTTCTCGGCGTTCA; the primer pair 2 comprises an upstream primer 2F and a downstream primer 2R, the sequence of 2F is: TGGAGTTTGGGAGATTGTTTGTGTAAATTCA, and the sequence of 2R is: GTTGAGACAATCCAAACCACCATACTAAGTA; the sequence of the probe 1 is: ACCTCACGGTCGCCAACCTCGACGGCACGCACCCGCTACCACGCCTTCGT; the sequence of the probe 2 is: ACCTAGCTGTAGTTCACCCAGTAAAATCAATTTCAATAAGGACAAAACGA.

[0012] Compared with PCR, dual PCR and RPA-LFD, dual RPA-LFD has more stringent requirements on primer and probe sequences. Dual RPA-LFD involves 4 primers and 2 probes, and the length of each primer (including probe) is more than 30p, forming two viral gene targets and forming two products.

[0013] In terms of primer length, compared with conventional PCR (primer length is about 18bp), the primers of RPA-LFD and dual RPA-LFD (primers and probes are both above 30bp) are longer; in terms of the number of primers, dual RPA-LFD requires 4 primers and 2 probes, while conventional PCR requires 2 primers, dual PCR requires 4 primers, and RPA-LFD requires 2 primers and 1 probe, so the difficulty of primer design is significantly increased.

[0014] From the perspective of primer-to-primer interactions, the lengthening and increase of primers means that the possibility of forming a high GC region increases, and the possibility of a single primer forming a hairpin structure increases; the possibility of different primers combining with each other to form dimers increases, and the primers may form more complex primer-to-primer interactions. From the perspective of DNA-primer interactions, the increase of primers means that the possibility of primers forming nonspecific amplification with host or other DNA is greater.

[0015] Therefore, the development of dual RPA-LFD has more stringent requirements on primer sequences. Dual RPA is not a simple superposition of two RPA-LFDs, but requires redesign and repeated experiments. Not only does it require the design of more candidate primers and the arrangement of more screening tests to screen for suitable primers, but it also requires more design skills and a higher level of design.

[0016] In the present invention, dual RPA-LFD primers and probes are designed for ORFV B2L gene and CaPV GPCR gene, which can achieve high-specificity and high-sensitivity detection of capripox virus and capripox virus.

[0017] Preferably, the 1F or the 1R is modified with a first molecular marker, preferably, the first molecular marker is selected from any one of biotin, digoxigenin (Dig), fluorescein isothiocyanate (FITC) and 6-carboxyfluorescein (FAM); the probe 1 contains a tetrahydrofuran base site; the 3' end of the probe 1 is modified with a blocking group, and the 5' end of the probe 1 is modified with a second molecular marker, preferably, the second molecular marker is selected from any one of biotin, digoxigenin (Dig), fluorescein isothiocyanate (FITC) and 6-carboxyfluorescein (FAM); the first molecular marker and the second molecular marker are different from each other.

[0018] Preferably, the 2F or the 2R is modified with a third molecular marker, preferably, the third molecular marker is selected from any one of biotin, digoxigenin (Dig), fluorescein isothiocyanate (FITC) and 6-carboxyfluorescein (FAM); the probe 2 contains a tetrahydrofuran base site; the 3' end of the probe 2 is modified with a blocking group, and the 5' end of the probe 2 is modified with a fourth molecular marker, preferably, the fourth molecular marker is selected from any one of biotin, digoxigenin (Dig), fluorescein isothiocyanate (FITC) and 6-carboxyfluorescein (FAM); the third molecular marker and the fourth molecular marker are different from each other, and at least one of the third molecular marker and the fourth molecular marker is different from both the first molecular marker and the second molecular marker.

[0019] Preferably, the blocking group is a C3-spacer.

[0020] The second aspect of the present invention provides a kit comprising the reagent described in the first aspect.

[0021] Preferably, the kit further comprises: at least one of an RPA-LFD amplification reagent and a lateral flow chromatography test strip.

[0022] Preferably, the RPA-LFD amplification reagent comprises at least one of an RPA-LFD enzyme, a rehydration buffer and magnesium acetate.

[0023] Preferably, the RPA-LFD enzyme comprises at least one of an endonuclease, a recombinase, a single-stranded binding protein and a DNA polymerase.

[0024] Preferably, the lateral flow chromatography test strip contains an antibody that recognizes the first molecular marker, an antibody that recognizes the second molecular marker, an antibody that recognizes the third molecular marker, and an antibody that recognizes the fourth molecular marker.

[0025] The third aspect of the present invention provides the use of the reagent described in the first aspect and / or the kit described in the second aspect in any one of (1)-(3): (1) detecting sheep pox virus and / or sheep sore virus for non-diagnostic purposes; (2) preparing products for detecting sheep pox virus and / or sheep sore virus; (3) screening drugs for preventing sheep pox and / or sheep sore, preventing and treating sheep pox and / or sheep sore, and / or inhibiting the replication and expression of sheep pox virus and / or sheep sore virus.

[0026] The fourth aspect of the present invention provides a method for detecting capripox virus and / or capripox virus for non-diagnostic purposes, comprising the steps of using the reagent described in the first aspect and / or the kit described in the second aspect.

[0027] Preferably, the final concentration of any upstream primer and any downstream primer in the RPA reaction system is 0.1 μM-0.5 μM, preferably 0.36 μM; the final concentration of any probe in the RPA reaction system in the RPA reaction is 0.06 μM-0.3 μM, preferably 0.12 μM; the reaction temperature of the RPA reaction is 34-42°C, preferably 39°C; the reaction time of the RPA reaction is 10-20 min, preferably 18 min.

[0028] Compared with RPA-LFD and Duplex-real-time RPA, Duplex-RPA-LFD involves more antigen-antibody reactions, including the reaction between the molecular labels on the primers and probes and the corresponding antibodies. Under some conditions (such as excessive product concentration and the presence of impurities), interference is more likely to occur, and the possibility of false positive / false negative results is very high. Therefore, more experiments need to be arranged to screen and optimize the reaction conditions to facilitate the antigen-antibody reaction in LFD and avoid the generation of false positive and false negative results. These experiments include but are not limited to: (1) optimization of the ratio of primers and probes; (2) optimization of RPA reaction time; (3) optimization of the dilution ratio of RPA products; etc.

[0029] The beneficial effects of the present invention are:

[0030] The present invention provides a reagent for detecting sheep pox virus and sheep orthosis virus, which has high sensitivity and specificity. The detection sensitivity of ORFV and CaPV reaches 5×10 1 copies / μL and 8×10 1 It has no cross reaction with peste des petits ruminants virus (PRRV), pseudorabies virus (PRV), foot-and-mouth disease virus (FMDV), Escherichia coli, Salmonella, Streptococcus and Staphylococcus aureus, and the detection effect is stable.

[0031] The present invention uses dual RPA-LFD technology to prepare a nucleic acid rapid detection kit. Under the action of LFD chromatography, the amplification product binds to the corresponding antibody marked on the test strip, and an antigen-antibody immune reaction occurs, achieving a better naked eye recognition effect. The sheep sore virus and sheep pox virus can be detected on the same test strip at the same time, and the detection can be completed within 20 minutes. No large instrument is required, only a water bath is needed. The present invention can meet the detection needs of grassroots clinical practice and provide a tool for preventing and controlling sheep vesicular disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Schematic diagram of the structure of plasmid pT-B2L.

[0033] Figure 2 Schematic diagram of the structure of plasmid pT-GPCR.

[0034] Figure 3 This is the colony PCR identification of the bacteria transformed with plasmid pT-GPCR, where lane 0 is the blank control; lanes 1-9 are the monoclonal colonies of the bacteria transformed with plasmid pT-GPTV; M is the DL2000 DNA marker (the bands are 100bp, 250bp, 500bp, 750bp, 1000bp and 2000bp respectively).

[0035] Figure 4A step-by-step approach was developed for dual RPA-LFD.

[0036] Figure 5 The results are the preliminary screening results of single-base RPA primers, where lane 1 is the amplification of ORFV-containing samples by primer set ORFV153; lane 2 is the amplification of ORFV-containing samples by primer set ORFV151; lane 3 is the amplification of ORFV-containing samples by primer set ORFV115; lane 4 is the amplification of CaPV-containing samples by primer set CaPV208; lane 5 is the amplification of CaPV-containing samples by primer set CaPV193; lane 6 is the amplification of ORFV-containing samples by primer set ORFV121; M is DL500 DNA Marker; lane 7 is the amplification of CaPV-containing samples by primer set CaPV116; lane 8 is the amplification of CaPV-containing samples by primer set CaPV166; lane 9 is the amplification of CaPV-containing samples by primer set CaPV244; lane 10 is the amplification of ORFV-containing samples by primer set ORFV137; M.TaKaRa DNA Marker DL500 (band sizes are 50bp, 100bp, 150bp, 200bp, 300bp, 400bp, 500bp respectively).

[0037] Figure 6 The results of preliminary screening gene amplification of ORFV and CaPV dual basic RPA primers, where lane 1 is the amplification of samples containing ORFV and CaPV using primer set ORFV151 and ORFV137; lane 2 is the amplification of samples containing CaPV using primer set ORFV151 and ORFV137; lane 3 is the amplification of samples containing ORFV using primer set ORFV151 and ORFV137; lane 4 is the amplification of samples without Lane 5 is the amplification of samples containing ORFV and CaPV using the primer set CaPV208 and ORFV137; Lane 6 is the amplification of samples containing CaPV using the primer set CaPV208 and ORFV137; Lane 7 is the amplification of samples containing ORFV using the primer set CaPV208 and ORFV137; Lane 8 is the amplification of samples without ORFV and CaPV using the primer set CaPV208 and ORFV137; M is TaKaRa DNA Marker DL500 (band sizes are 50bp, 100bp, 150bp, 200bp, 250bp, 300bp, 400bp, 500bp, respectively).

[0038] Figure 7 The sensitivity test results of ORFV and CaPV dual basic RPA, where lanes 1-7 are the dual RPA products with gradient dilution of pT-B2L plasmid as template, and the concentration of pT-B2L plasmid is 1×10 5 copy / μL, 3×104 copy / μL, 1×10 3 copy / μL, 3×10 2 copy / μL, 1×10 2 copy / μL, 3×10 copy / μL, 10 copy / μL; Lanes 8-12 are the double RPA products with gradient dilution of pT-GPCR plasmid as template, and the concentration of pT-GPCR plasmid is 1×10 5 copy / μL, 1×10 4 copy / μL, 1×10 3 copy / μL, 1×10 2 copy / μL, 1×10 copy / μL. M is TaKaRa DNA Marker DL500 (band sizes are 50 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, respectively).

[0039] Figure 8 The results of the double RPA-LFD test were determined, where 1 was ORFV and CaPV positive; 2 was ORFV positive; 3 was CaPV positive; and 0 was the negative control. DETAILED DESCRIPTION

[0040] The present invention is further described in detail below by specific examples. Unless otherwise specified, the raw materials, reagents or devices used in the examples and comparative examples can be obtained from conventional commercial sources or can be obtained by prior art methods. Unless otherwise specified, the experiments or test methods are conventional methods in the art.

[0041] The materials used in the embodiments of the present invention are as follows:

[0042] 1. Cells and strains: MDBK cells and VERO cells are preserved by the Animal Health Institute of Guangdong Academy of Agricultural Sciences. [4] , isolated from clinical samples of black goats by our laboratory and propagated in MDBK cell culture; the attenuated sheeppox virus vaccine strain CVCC AV41 was purchased from a commercial (produced by Harbin Pharmaceutical Group Co., Ltd.) and propagated on VERO cell culture. The pathogen sources used in the specific test: Peste des petits ruminants virus (PRRV) is the vaccine strain Clone9, isolated from the attenuated live vaccine; Oral ulcer virus (ORFV) is the cell culture of ORFV / GD-QY / 01 strain; Pseudorabies virus (PRV) is a Guangdong isolate; Capripox virus (CaPV) comes from the Chudouling small ruminant sheeppox bivalent attenuated vaccine; cDNA obtained by reverse transcription of total nucleic acid of the foot-and-mouth disease virus (FMDV) vaccine strain was donated by Harbin Lanzhou Veterinary Research Institute; Escherichia coli DH5α is a genetically engineered bacterium, and Staphylococcus aureus, Salmonella and Streptococcus suis are all Guangdong isolates.

[0043] 2. RPA and RAA kits: TwistAmp TM Basic kit, TwistAmp TM RT exo kit and TwistAmp TM nfo kit is a TwistDx product. Single-plex nucleic acid testing strip (NAtesting1 (LFD)) and double-plex nucleic acid testing strip (NA testing2 (LFD)) are Diamond products purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0044] 3. Other biochemical reagents: GeneJET viral DNA / RNA extraction kit, PureLink TM HQ Mini-Plasmid DNA Purification Kit and TOPO TM TACloning TM T vector ligation kit was purchased from Thermo Fisher Scientific (China) Co., Ltd. PreMix ExTaq DNA polymerase and DNA molecular weight standard were TaKaRa products. Amplification primers and probes were synthesized by Guangzhou Qingke Biotechnology Co., Ltd.

[0045] Example 1 Construction of standard plasmids of target genes of oropharyngeal sore virus and capripox virus

[0046] 1. PCR amplification of ORFV B2L gene and CaPV GPCR gene: 200 μL of ORFV and CaPV virus liquid were used to extract total viral nucleic acid using GeneJET viral DNA / RNA purification kit, and then used as templates for PCR amplification using corresponding primers (Table 1).

[0047] Table 1

[0048]

[0049] The PCR reaction system was: 2.5 μL 10× Buffer, 1 μL dNTP, 0.25 μL of upper and lower primers, 0.3 μL TaqDNA polymerase, 24 μL sterile deionized water, and 1 μL lysate. The PCR reaction program was: 95°C for 5 min; 94°C for 30 s, 59°C for 30 s, 72°C for 60 s, 30 cycles; 72°C for 10 min extension. The PCR products were electrophoresed using 1.5% agarose gel. The amplified B2L gene sequence is shown in SEQ ID NO.5. The amplified GPCR gene sequence is shown in SEQ ID NO.6.

[0050] 2. Construction of standard plasmids pT-B2L and pT-GPCR: The amplified products of the B2L gene of ORFV and the GPCR gene of CaPV were recovered using a gel recovery kit, respectively, and connected to the T vector to construct plasmids pT-B2L and pT-GPCR. Construction of plasmid pT-B2L containing the B2L gene of ovariectomy virus ( Figure 1 ) and plasmid pT-GPCR containing the capripox virus GPCR gene ( Figure 2 ). The plasmid pT-GPCR was confirmed to be constructed correctly by PCR ( Figure 3 ). The plasmid pT-B2L was sequenced and confirmed to be constructed correctly.

[0051] 3. Extraction and preservation of plasmid: The plasmid concentration was measured, diluted tenfold, and stored at -40°C for use as a template for subsequent amplification experiments.

[0052] Example 2 Establishment of a dual RPA-LFD method for ORFV and CaPV

[0053] Dual RPA-LFD step-by-step establishment method Figure 4 As shown:

[0054] First, based on domestic and foreign reference sequences, multiple sets of RPA primers and probes were designed for the B2L gene of ORFV and the G protein-coupled chemokine receptor gene (GPCR) of CaPV. In the second step, upstream and downstream primers containing only nucleotides but not dig, biotin, FAM and other molecular markers were synthesized, and TwistAmp was used to TMBasic Kit, screen out primer pairs (upstream and downstream primers) with better amplification effects, and establish a single basic RPA method. The third step is to combine each primer pair for ORFV and each primer pair for CaPV in pairs, establish a dual basic RPA method, screen out primer sets with better amplification, and optimize conditions such as reaction time and temperature. The fourth step is to refer to the screened primer sets, synthesize primers and probes containing molecular markers, and establish single RPA methods for ORFV and CaPV respectively. The fifth step is to establish a dual RPA-LFD method based on the single RPA method. After optimization of product dilution multiples, optimization of product diluent, further screening and content optimization of primers and probes, and optimization of reaction temperature and time, the multiple RPA-LFD method was successfully established and assembled into a kit.

[0055] The details are as follows: Design of RPA primers: Based on domestic and foreign reference sequences, more than ten sets of RPA primers and probes were designed for the B2L gene of ORFV and the G protein-coupled chemokine receptor gene (GPCR) of CaPV. The upstream and downstream primers and probes containing only nucleotides but not molecular markers are shown in Table 2.

[0056] Table 2

[0057]

[0058]

[0059] Synthesize primers and probes containing only nucleotides without dig, biotin and other molecular markers, using TwistAmp TM Basic Kit, screen out primer pairs (upstream and downstream primers) with better amplification effects, and establish a single-plex basic RPA method.

[0060] Single-base RPA approach

[0061] Preliminary screening of single-base RPA primers: Using CaPV virus nucleic acid as a template, multiple primer sets were used to amplify the CaPV virus GPCR gene using the RPA method; using ORFV virus nucleic acid as a template, multiple primer sets were used to amplify the ORFV virus B2L gene using the RPA method.

[0062] The specific method is as follows: Preliminary screening of RPA upstream and downstream primers

[0063] Using TwistAmp from TwistDX TM Basic kit, use different upstream and downstream primers to perform RPA amplification on plasmids of different concentrations. TM The Basic kit instructions are as follows:

[0064] (1) Add the following to the EP tube in order: 2.4 μL of each upstream and downstream primer, 29.5 μL of Rehydration Buffer, and 1 μL of the template to be tested, then add sterile deionized water to a total volume of 47.5 μL and mix thoroughly. (2) Add the above mixture to the reaction tube containing the freeze-dried enzyme preparation and mix by pipetting. (3) Add 2.5 μL of 280 mmol / L magnesium acetate to each reaction tube and mix. (4) Immediately place the reaction tube in the PCR instrument, keep the constant temperature at 39°C for 4 minutes, take out and vortex to mix, and then react for another 14 minutes. (5) Immediately place the product on ice. Use 2.5% agarose gel electrophoresis to observe the results.

[0065] The primer pairs with certain amplification efficiency were preliminarily screened out. Figure 5 shown.

[0066] Dual-Base RPA Approach

[0067] Preliminary screening of upstream and downstream primers for dual RPA: using TwistAmp from TwistDX TM Basic kit, double RPA was performed on primers for ORFV and primers for CaPV. The specific steps are as follows: (1) Add 2.4 μL of each primer, 29.5 μL of Rehydration Buffer, and 1 μL of the template to be tested in the EP tube in sequence, then add sterile deionized water to a total volume of 47.5 μL and mix thoroughly. (2) Add the above mixture to the reaction tube containing the freeze-dried enzyme preparation and mix with a pipette. (3) Add 2.5 μL of 280 mmol / L magnesium acetate to each reaction tube and mix. (4) Immediately place the reaction tube in the PCR instrument, keep the temperature at 39°C for 4 minutes, take out and vortex to mix, and then react for 14 minutes. (5) The product is immediately placed on ice. Use 2.5% agarose gel electrophoresis to observe the results.

[0068] Primer pairs with certain amplification efficiency were preliminarily screened out.

[0069] Preliminary screening of upstream and downstream primers of RPA

[0070] The results showed that multiple sets of dual RPA upstream and downstream primers were screened. Among the multiple sets of primers, the sensitivity of 4 sets of primers reached or even less than 1×10 1 copies / μL, which is similar to the detection limit of traditional PCR method.

[0071] After multiple rounds of screening, two sets of primers were selected to establish ORFV and CaPV dual basic RPA. The first set of primers was the primer set ORFV151 (upstream and downstream primers were ORFV151-F and ORFV151-R, respectively) and ORFV137 (upstream and downstream primers were ORFV137-F and ORFV137-R, respectively), and the second set of primers was the primer set ORFV137 and CaPV208 (upstream and downstream primers were CaPV208-F and CaPV208-R, respectively). The primer information is shown in Table 6. The amplification results are shown in Figure 6 As shown, primer set CaPV208 and primer set ORFV137 were finally selected.

[0072] Primer groups CaPV208 and ORFV137 were selected for reaction condition optimization. After optimizing the amount of primers added, the reaction temperature and reaction time, the final result was: in a 50μL reaction system, the amount of primers added was: ORFV137-F 1.8μL, ORFV137-R 1.8μLμL, CaPV208-F 2.1μL, CaPV208-R 2.1μL. The optimal reaction temperature was 39°C, and the optimal reaction time was 18min.

[0073] Specificity test for dual-base RPA

[0074] The results of the specificity test showed that the dual-based RPA of ORFV and CaPV could correctly distinguish positive and negative, indicating that the established dual-based RPA method has good specificity.

[0075] Sensitivity test of dual-base RPA

[0076] The results show that ( Figure 7 ), and the sensitivity to ORFV and CaPV-related plasmids reached 3×10 1 copies / μL and 1×10 2 copies / μL, which is similar to the detection limit of traditional PCR method.

[0077] RPA-LFD method for ORFV

[0078] Establishment of RPA-LFD method

[0079] ReferenceTwistAmp TMNFO kit instructions, step by step operation as follows: prepare the reaction premix according to the instructions and mix thoroughly, transfer to the reaction tube containing freeze-dried NFO, melt and mix and dispense 17μL into each reaction tube; add 2μL DNA template to each reaction tube; finally add 1μL 280mmol / L magnesium acetate; immediately put the reaction tube into the PCR instrument, keep constant temperature at 39℃ for 4min, take out and vortex to mix, and then react for 14min; take out 10μL of the product, dilute with 150μL double distilled water respectively, mix well, draw 80μL and drop it into the sample well of the PCRD test paper card, let it stand at room temperature for 10min to observe the test results. The primers and probes used are shown in the following table:

[0080] Table 3

[0081]

[0082] Sensitivity analysis

[0083] The sensitivity of RPA-LFD test targeting ORF was analyzed by using the gradient dilution of the quantified plasmid pT-B2L as template. The results showed that the sensitivity of primer set ORFV137 reached 1×10 copies / μL, which is similar to the detection limit of the traditional PCR method.

[0084] Specificity analysis

[0085] According to the instructions of the viral RNA / DNA extraction kit, reference viral nucleic acid was extracted to obtain the attenuated vaccine of peste des petits ruminants virus (PRRV), oral ulcer virus (ORFV), pseudorabies virus (PRV), and capripox virus (CaPV) nucleic acid. Among them, PRRV was reverse transcribed to obtain cDNA. The genomic DNA of mutton tissue, Escherichia coli, Salmonella, Streptococcus and Staphylococcus aureus were extracted respectively. In addition, the reverse transcription product of foot-and-mouth disease virus (FMDV) nucleic acid was donated by Lanzhou Veterinary Research Institute. PRA-LFD for ORFV was performed using the ORFV137 primer set to verify its specificity.

[0086] The results of the specificity test showed that the established ORFVPRA-LFD method only generated positive bands for ORFV samples, while FMDV, PRRV, PRV and CaPV were all negative. PRA-LFD was performed using genomic DNA from mutton tissue, Escherichia coli, Salmonella, Streptococcus and Staphylococcus aureus as templates, and the results were all negative. This shows that the established ORFVPRA-LFD method has good specificity.

[0087] RPA-LFD method for CaPV

[0088] Establishment of RPA-LFD method

[0089] ReferenceTwistAmp TM NFO kit instructions, step by step operation as follows: prepare the reaction premix according to the instructions and mix thoroughly, transfer to the reaction tube containing freeze-dried NFO, melt and mix and dispense 17μL into each reaction tube; add 2μL DNA template to each reaction tube; finally add 1μL 280mmol / L magnesium acetate; immediately put the reaction tube into the PCR instrument, keep constant temperature at 39℃ for 4min, take out and vortex to mix, and then react for 14min; take out 10μL of the product, dilute with 150μL double distilled water respectively, mix well, draw 80μL and drop it into the sample well of the PCRD test paper card, let it stand at room temperature for 10min to observe the test results. The primers and probes used are shown in the following table:

[0090] Table 4 RPA-LFD primers

[0091]

[0092] Sensitivity analysis

[0093] The RPA-LFD test for CaPV was performed using the quantitative plasmid pT-GPCR gradient dilution as a template. The results showed that the sensitivity of the primer set CaPV208 reached 2×10 1 copies / μL, which is similar to the detection limit of traditional PCR method.

[0094] Specificity analysis

[0095] According to the instructions of the viral RNA / DNA extraction kit, reference viral nucleic acid was extracted to obtain the attenuated vaccine of peste des petits ruminants virus (PRRV), oral ulcer virus (ORFV), pseudorabies virus (PRV), and capripox virus (CaPV) nucleic acids. Among them, PRRV was reverse transcribed to obtain cDNA. The genomic DNA of mutton tissue, Escherichia coli, Salmonella, Streptococcus and Staphylococcus aureus were extracted respectively. In addition, the reverse transcription product of foot-and-mouth disease virus (FMDV) nucleic acid was donated by Lanzhou Veterinary Research Institute. Using the ORFV137 set of primers, PRA-LFD for ORFV was performed to verify its specificity. The results of the specificity test showed that the established CaPV-PRA-LFD method only generated positive bands for CaPV samples, while FMDV, PRRV, PRV and ORFV were all negative. PRA-LFD was performed using the genomic DNA of mutton tissue, Escherichia coli, Salmonella, Streptococcus and Staphylococcus aureus as templates, and the results were all negative. This indicates that the established CaPV-PRA-LFD method has good specificity.

[0096] Establishment of the dual RPA-LFD method

[0097] Based on the single RPA method, a dual RPA-LFD method was established. The reverse primer for ORFV (ORFV137-R) was labeled with a Biotin group, and the primer for CaPV (CaPV208-R) was labeled with a Biotin group. The THF group was inserted into the middle of the probe for modification, and the C3 spacer was inserted into the 3' end of the probe for modification; the probe for ORFV was labeled with a FAM group, and the probe for CaPV was labeled with a Dig group, as shown in Table 5. After amplification, products labeled with different groups are generated. Under the action of LFD chromatography, they bind to the corresponding antibodies marked on the test strip, and an antigen-antibody immune reaction occurs. The test result judgment criteria are as follows: Figure 8 .

[0098] Table 5

[0099]

[0100] Explore and optimize the concentration of each component and reaction parameters in the dual RPA reaction system, including primer ratio, reaction temperature, reaction time and product dilution multiple.

[0101] Further optimization of amplification conditions

[0102] (1) Optimization of product dilution factor: The RPA reaction product was diluted 10 times, 20 times, 30 times, 40 times and 50 times with PBS, and double RPA-LFD was performed. The results showed that there was no significant difference in specificity between 10 times and 50 times of dilution, and 10 times of dilution was the best in sensitivity. After comprehensive consideration, 20 times of dilution was selected as the product dilution factor.

[0103] (2) Optimization of product diluent: PBS and PBST were selected for RPA-LFD respectively. The specificity met the requirements and no significant difference was found in sensitivity. After comprehensive consideration, PBST was selected as the diluent for dual RPA.

[0104] (3) Optimization of primer ratios: The other reaction conditions remained unchanged. In a 50 μL reaction system, the primer addition amounts were set in the following four groups, and the sensitivity and specificity were measured respectively: (1) Primer ORFV137-F (10 μM) 2.1 μL, primer ORFV137-RB (10 μM) 2.1 μL, primer ORFV137-PF (10 μM) 0.7 μL, primer CaPV208-F (10 μM) 2.1 μL, primer CaPV208-RB (10 μM) 2.1 μL, primer CaPV208-PD (10 μM) 0.7 μL. (2) Primer ORFV137-F (10μM) 1.8μL, primer ORFV137-RB (10μM) 1.8μL, primer ORFV137-PF (10μM) 0.6μL, primer CaPV208-F (10μM) 1.8μL, primer CaPV208-RB (10μM) 1.8μL, primer CaPV208-PD (10μM) 0.6μL. (3) Primer ORFV137-F (10μM) 2.1μL, primer ORFV137-RB (10μM) 2.1μL, primer ORFV137-PF (10μM) 0.7μL, primer CaPV208-F (10μM) 1.8μL, primer CaPV208-RB (10μM) 1.8μL, primer CaPV208-PD (10μM) 0.6μL. (4) Primer ORFV137-F (10 μM) 1.8 μL, primer ORFV137-RB (10 μM) 1.8 μL, primer ORFV137-PF (10 μM) 0.6 μL, primer CaPV208-F (10 μM) 2.1 μL, primer CaPV208-RB (10 μM) 2.1 μL, primer CaPV208-PD (10 μM) 0.7 μL.

[0105] It was finally determined that in a 50μL reaction system, the optimal primer ratio was: primer ORFV137-F (10μM) 1.8μL, primer ORFV137-RB (10μM) 1.8μL, primer ORFV137-PF (10μM) 0.6μL, primer CaPV208-F (10μM) 1.8μL, primer CaPV208-RB (10μM) 1.8μL, primer CaPV208-PD (10μM) 0.6μL.

[0106] (4) Optimization of reaction time: Other reaction conditions remain unchanged, and the reaction times are 14 min, 16 min, 18 min, 20 min, and 22 min, respectively, and the sensitivity and specificity are measured. Repeated comparative tests of different reaction times show that there is no significant difference in specificity between 14 min, 16 min, 18 min, 20 min, and 22 min, and there is no significant difference in sensitivity between 16 min, 18 min, 20 min, and 22 min. 18 min was selected as the reaction time.

[0107] (5) Optimization of reaction temperature: The reaction temperatures were 37°C, 38°C, 39°C, 40°C, 41°C, and 42°C, and the sensitivity and specificity were measured. The results showed that the change of reaction temperature had no effect on the specificity; the reaction sensitivity was slightly reduced at 42°C. After comprehensive consideration, 39°C was selected as the optimal reaction temperature.

[0108] (6) Optimization of the intermediate treatment time of the reaction: During the reaction process, the reaction tube was taken out for mixing and centrifugation at 3 min, 4 min, 5 min and 6 min respectively. The results showed that 3 min, 4 min and 5 min after the reaction were the best. After comprehensive consideration, it was decided to take out the reaction tube for mixing and centrifugation at 4 min of the reaction.

[0109] (7) Selection of markers and test strips from different manufacturers: Nucleic acid test strips with different markers and from different manufacturers were selected. After comprehensive consideration of the effect and cost, the test strips selected were: Double nucleic acid test strip NA Testing 2 (LFD) is a Diamond product purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0110] Sensitivity test of the dual RPA-LFD method for ORFV and CaPV

[0111] The sensitivity test of the dual RPA method for ORFV and CaPV was carried out using the quantitative plasmid pT-GPCR and pT-B2L gradient dilution as templates. The results showed that the detection sensitivity of ORFV and CaPV reached 5×10 1 copies / μL and 8×10 1 copies / μL, which is similar to the detection limit of traditional PCR method.

[0112] Specificity test of the dual RPA-LFD method for ORFV and CaPV

[0113] According to the instructions of the viral RNA / DNA extraction kit, reference viral nucleic acid was extracted to obtain the attenuated vaccine of peste des petits ruminants virus (PRRV), oral ulcer virus (ORFV), pseudorabies virus (PRV), and capripox virus (CaPV) nucleic acids. Among them, PRRV was reverse transcribed to obtain cDNA. The genomic DNA of mutton tissue, Escherichia coli, Salmonella, Streptococcus and Staphylococcus aureus were extracted respectively. In addition, the reverse transcription product of foot-and-mouth disease virus (FMDV) nucleic acid was donated by Lanzhou Veterinary Research Institute. Using the primers of ORFV137 and CaPV208, RPA-LFD for ORFV and CaPV was performed to verify its specificity. The results showed that the established dual RPA-LFD method can correctly distinguish between positive and negative.

[0114] Example 3 Detection of ORFV and CaPV by dual RPA-LFD on clinical samples

[0115] Kit Components

[0116] 1. Primer: Primers were commissioned to be synthesized by Guangzhou Qingke Biotechnology Co., Ltd. The sequence is shown in Table 5. They are freeze-dried powders and diluted with sterile double distilled water to a final concentration of 10 μM before use. Plasmids were diluted with sterile double distilled water to a final concentration of 10 μM before use.

[0117] 2. Reagents: Primer Free Rehydration buffer, reaction tubes containing freeze-dried protein preparations, and 280 mM magnesium acetate, all from TwistAmp of TwistDX TM NFO kit components.

[0118] Preparation of PBST (phosphate buffered saline with pH 7.4 and 0.05% Tween 20): 0.24g potassium dihydrogen phosphate (KH2PO4), 1.44g disodium hydrogen phosphate (Na2HPO4), 8.0g sodium chloride (NaCl), 0.2g potassium chloride (KCl), add water to 1000mL, add 0.5mL Tween 20, mix well. It can be stored at 4℃ for 1 month.

[0119] Reaction plate: Double nucleic acid test strip NA Testing 2 (LFD) is a Diamond product purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0120] Control plasmid: Plasmid pT-B2L is a plasmid containing the B2L gene of ORFV, and is a positive control template for ORFV amplification. The plasmid was diluted 100 times with sterile double distilled water before use. Plasmid pT-GPCR is a plasmid containing the GPCR gene, and is a positive control template for CaPV amplification. The plasmid was diluted 100 times with sterile double distilled water before use.

[0121] Kit operation instructions: (1) Add the following components in a centrifuge tube in sequence: primer ORFV137-F (10μM) 1.8μL, primer ORFV137-RB (10μM) 1.8μL, primer ORFV137-PF (10μM) 0.6μL, primer CaPV208-F (10μM) 1.8μL, primer CaPV208-RB (10μM) 1.8μL, primer CaPV208-PD (10μM) 0.6μL, Primer Free Rehydration buffer 29.5μL, template and ddH2O 9.6μL, a total of 47.5μL. Centrifuge briefly to mix well. (2) Add the above mixture to the reaction tube containing the lyophilized protein preparation and mix well by pipetting. (3) Add 2.5μL 280mM magnesium acetate and mix well immediately. Note: The RPA reaction starts immediately after the addition of magnesium acetate. (4) Incubate at 39℃ for 18min. If the template copy number is low, take out the reaction tube after 4min of reaction, flick it with your fingers to mix, centrifuge briefly, and return it to the incubator to continue the reaction until the total time is 18min. (5) Aspirate 10μL of the product, add 490μL of PBST, mix well, and aspirate 80μL to the sample well of the reaction plate. Place it horizontally at room temperature for 15 minutes and observe the results. (6) Result determination: Negative: A blue band appears on the test strip C and no band on T. Pox virus positive: A blue band appears on the test strip C and a red band appears on T1. The color of the T1 band can be dark or light, and both are positive results. Pox virus positive: A blue band appears on the test strip C and a red band appears on T2. ​​The color of the T2 band can be dark or light, and both are positive results. Pox virus and pox virus double positive: A blue band appears on the test strip C, two red bands in the T area, a red band appears on T1, and a red band appears on T2. The color of T1 and T2 bands can be dark or light, both are positive results. Invalid: No bands appear on test strip C, regardless of whether T1 or T2 bands appear, it means the result is invalid and needs to be retested.

[0122] Clinical sample detection: 25 amniotic fluid or O / P fluid samples were collected in Heyuan and Shaoguan areas, and the test kit in Example 3 was used for detection. The test results (Table 6) were 100% consistent with the PCR test results. Among them, samples P, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15 were from the dairy goat farm of Guangdong Chuangsheng Agricultural Development Co., Ltd. in Dongtang Town, Renhua County, Shaoguan City; samples 16, 17, 18, 19, and 20 were from Liangtoupu Goat Farm in Fogang County, Qingyuan City; samples 21, 22, 23, 24, and 25 were from Tiechangpu Village Goat Farm in Dongyuan County, Heyuan City. Samples P, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 23, 24, and 25 are O / P liquids; samples 21 and 22 are blister liquids.

[0123] Table 6 Clinical sample test results

[0124]

[0125] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

[0126] References:

[0127] [1] Guo Suzhen, Zhang Huian, Kuang Minghui, et al. Study on the isolation and identification of the pathogen of sheep oral ulcer [J]. Chinese Journal of Veterinary Science and Technology, 1987(04): 5-6.

[0128] [2] He Shuilin, Chen Jie, Cai Yushu, et al. Isolation and identification of ovine oral virus [J]. Chinese Journal of Veterinary Science and Technology, 2002(09): 22-23.

[0129] [3] Guo Lulu, Cui Yanshun. Isolation and identification of the Guangdong Dapu strain of ovine oral sore virus and its genetic evolution analysis[J]. Chinese Journal of Veterinary Medicine, 2017, 53(12): 20-23, 66.

[0130] [4] Xiang Rong, Zhai Shaolun, Wang Xiaohu, et al. Isolation and identification of the ORFV / GD-QY / 01 strain of ovine oral virus[J]. Guangdong Agricultural Sciences, 2018, 45(09): 116-120.

Claims

1. A reagent comprising a primer pair and / or a probe; The primer pair is primer pair 1 and primer pair 2; The probes are probe 1 and probe 2; The primer pair 1 comprises an upstream primer 1F and a downstream primer 1R, The sequence of 1F is: ACGACGCTGCGAACAACACTAAGCTGCTCAT, The sequence of 1R is: TCCTTGACGATGTCGCCCTTCTCGGCGTTCA; The primer pair 2 comprises an upstream primer 2F and a downstream primer 2R, The sequence of 2F is: TGGAGTTTGGGAGATTGTTTGTGTAAATTCA, The sequence of 2R is: GTTGAGACAATCCAAACCACCATACTAAGTA; The sequence of the probe 1 is: ACCTCACGGTCGCCAACCTCGACGGCACGCACCCGCTACCACGCCTTCGT; The sequence of probe 2 is: ACCTAGCTGTAGTTCACCCAGTAAAATCAATTTCAATAAGGACAAACGA.

2. The reagent according to claim 1, characterized in that: The 1F or the 1R is modified with a first molecular marker; The probe 1 contains a tetrahydrofuran base site; The 3' end of the probe 1 is modified with a blocking group, and the 5' end of the probe 1 is modified with a second molecular label; The first molecular marker and the second molecular marker are different from each other.

3. The reagent according to claim 2, characterized in that: The 2F or the 2R is modified with a third molecular marker; The probe 2 contains a tetrahydrofuran base site; The 3' end of the probe 2 is modified with a blocking group, and the 5' end of the probe 2 is modified with a fourth molecular marker; The third molecular marker and the fourth molecular marker are different from each other, and at least one of the third molecular marker and the fourth molecular marker is different from both the first molecular marker and the second molecular marker. A kit comprising the reagent according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that: The kit further comprises: at least one of an RPA-LFD amplification reagent and a lateral flow chromatography test strip.

6. The kit according to claim 5, characterized in that: The RPA-LFD amplification reagent comprises at least one of an RPA-LFD enzyme, a rehydration buffer and magnesium acetate.

7. The kit according to claim 6, characterized in that: The RPA-LFD enzyme comprises at least one of an endonuclease, a recombinase, a single-strand binding protein and a DNA polymerase.

8. Use of the reagent according to any one of claims 1 to 3 and / or the kit according to any one of claims 4 to 7 in any one of (1) to (3): (1) Testing for vesicular disease virus in non-diagnostic destinations; (2) Preparation of products for detecting vesicular disease virus; (3) screening drugs for preventing, treating, and / or inhibiting the replication and expression of vesicular disease of sheep, in, The sheep vesicular disease virus is sheep pox virus and / or sheep scab virus; the vesicular disease is sheep pox and / or sheep scab.

9. A method for detecting vesicular disease virus of sheep for non-diagnostic purposes, comprising the step of using the reagent according to any one of claims 1 to 3 and / or the kit according to any one of claims 4 to 7, wherein the vesicular disease virus of sheep is capripox virus and / or capripox virus.

10. The method according to claim 9, characterized in that The final concentration of any upstream primer and any downstream primer in the RPA reaction system is 0.1 μM-0.5 μM, preferably 0.36 μM; The final concentration of any probe in the RPA reaction system is 0.06 μM-0.3 μM, preferably 0.12 μM; The reaction temperature of the RPA reaction is 37-42°C, preferably 39°C; The reaction time of the RPA reaction is 10-20 min, preferably 18 min.

Images