Litopenaeus vannamei gene introduction method based on sperm mediation

Abstract

The invention provides a litopenaeus vannamei gene introduction method based on sperm mediation. The method comprises the following steps: integrating a target gene onto plasmids, injecting the plasmids into maturely developed spermatophore of a male shrimp in advance, transferring the plasmids into the sperm by performing electrical stimulation on the sperm in the spermatophore of the male shrimp in an electrical stimulation mode, mating the female shrimp with the sperm to lay eggs, and introducing the target gene into a fertilized egg by using the sperm as a carrier, so as to obtain the target gene. The method is used for realizing efficient introduction of exogenous genes in a fertilized egg layer of the penaeus vannamei boone so as to finally realize creation of new germplasm of the penaeus vannamei boone.

Description

Technical Field

[0001] The invention relates to the technical field of new germplasm, and in particular to a method for introducing genes into Litopenaeus vannamei based on sperm mediation. Background Art

[0002] Litopenaeus vannamei, also known as white shrimp, is a decapod Penaeididae species, also known as white shrimp and white shrimp. White shrimp is mainly naturally distributed along the Pacific coast of America, such as Ecuador and other countries. It is one of the most important economic shrimps in the world. Currently, there are more than 30 countries and regions in the world that farm white shrimp, among which my country ranks first in the world in terms of farming output. White shrimp is a tropical shrimp with wide temperature and salt tolerance. It often lives on muddy seabeds. It crawls or lurks on the seabed surface during the day and is active at night.

[0003] The white shrimp is very popular among aquaculture practitioners because of its delicious meat, fast growth, and suitability for high-density farming. It is currently the "most active" species in aquaculture. However, since white shrimp belongs to tropical shrimp, it has a strong tolerance to high temperatures, with an optimum temperature of 22-32°C, but poor tolerance to low temperatures. It stops feeding when the temperature is below 18°C ​​and dies when the temperature is below 12°C. Therefore, as an economic species for warm water farming, changes in natural water temperature limit the farming area and number of farming crops of white shrimp, affecting the production efficiency of the farming industry. In addition, the use of methods such as boiler heating to maintain water temperature not only increases costs, but also increases carbon emissions and pollutes the environment. In addition, with the increase in farming density and the deterioration of the farming environment, the demand for new white shrimp germplasm with high resistance to adversity and fast growth rate in aquaculture production is increasing.

[0004] With the widespread application of gene editing technology in the field of life sciences, it is becoming increasingly important in the research of new germplasm production with specific production traits. Gene editing technology mainly changes biological traits by changing biological genes, such as CRISPR-Cas9. However, since the fertilized eggs of white shrimp are small and divide quickly after fertilization, it is difficult to complete the gene introduction of traditional gene editing technology, which in turn hinders the creation of new germplasm. Summary of the invention

[0005] In view of the technical problems existing in the prior art, the present invention provides a method for gene introduction into Penaeus vannamei based on sperm-mediated introduction. The core point of the present invention is to integrate the target gene and the protein gene that emits specific fluorescence into the plasmid, inject the plasmid into the mature spermatophore of the male shrimp in advance, electrically stimulate the sperm in the spermatophore of the male shrimp, transfer the plasmid into the sperm by means of electrical stimulation, and then let the mature female shrimp mate and lay eggs with it, and introduce the target gene into the fertilized egg by using the sperm as a carrier, so as to realize the introduction of exogenous genes at the fertilized egg level of Penaeus vannamei, and finally realize the creation of new germplasm of Penaeus vannamei.

[0006] Specifically, the present invention first provides a method for sperm-mediated gene introduction into Penaeus vannamei, characterized in that the method comprises the following steps:

[0007] 1) Construct a recombinant plasmid containing the target improved gene and a protein gene that emits specific fluorescence;

[0008] 2) injecting the recombinant plasmid into the mature spermatophore of the male shrimp, and electrically stimulating the sperm in the spermatophore of the male shrimp to transfer the plasmid into the sperm by means of electrical stimulation, thereby achieving the transfer of the recombinant plasmid into the sperm;

[0009] 3) Selecting sexually mature female shrimps to mate with the male shrimps in step 2) to complete fertilization and spawning;

[0010] 4) collecting the fertilized eggs in step 3), and screening the positive fertilized eggs into which the target modified gene has been successfully introduced by screening for specific fluorescence under a fluorescence microscope;

[0011] 5) The fertilized eggs positive for the target improved gene in step 4) are incubated to obtain new germplasm of Penaeus vannamei.

[0012] Preferably, step 1) is to obtain the cDNA sequence of the target improved gene by PCR amplification and clone it into a plasmid.

[0013] Preferably, the target improved gene is from antifreeze gene, growth-promoting gene, disease-resistant gene, etc.

[0014] Further preferably, the plasmid can be selected from pcDNA3.1(+)-N-eGFP plasmid.

[0015] Preferably, in step 2), a Hamilton micro-syringe is used to inject the recombinant plasmid into the spermatophore; and a WJ-2002 in vivo gene transfer instrument is used to perform electrical stimulation.

[0016] Preferably, step 3) also includes a male shrimp screening and identification step, which includes the following: for the spermatophore in step 2), gently squeezed with the thumb and then placed in a 5mL centrifuge tube with 3mL of 0.1% pancreatin, and the spermatophore was cut into pieces with scissors in the centrifuge tube; 37°C water bath for 10min for tissue digestion, shaking 2-3 times during the period; 1mL 15% FBS was added to terminate, 500rpm / min, centrifuged for 10min; the supernatant was taken into a new 5mL EP tube, 2000rpm / min, centrifuged for 10min; the supernatant was discarded, the precipitate was retained, and 200μL of physiological saline was added for dissolution to obtain semen. After obtaining the semen, 0.8ul1unit / uL DNase was added and incubated in a 37°C water bath for 1h for plasmid digestion. PCR amplification was used to identify whether the target improved gene existed in the mature sperm of male shrimp. Other male shrimps with the target improved gene were cultured to allow their sperm to mature naturally.

[0017] Preferably, step 3) further comprises a step of treating the sexual maturity of female shrimps, specifically, promoting the maturation of female shrimp gonads by removing the eyestalks. Use red-hot hemostats to scald the eyestalks on one side of the female shrimps, and after the eyestalks are scalded to a flat char and disinfected, they are moved to a pond for cultivation, waiting for the maturation of the female shrimp gonads.

[0018] Preferably, step 4) is to identify the fertilized eggs by screening for specific fluorescence under a fluorescence microscope, and screen the positive fertilized eggs for use.

[0019] On the other hand, the present invention also provides new germplasm of Penaeus vannamei obtained by the above method.

[0020] The advantages of the present invention are that the target gene is integrated into a plasmid, the plasmid is injected into the mature spermatophore of male shrimp in advance, the sperm in the spermatophore of male shrimp is electrically stimulated, the plasmid is transferred into the sperm by means of electrical stimulation, the female shrimp is allowed to mate and lay eggs, and the sperm is used as a carrier to introduce the target gene into the fertilized egg, so as to realize the introduction of exogenous genes at the level of fertilized eggs of white shrimp, and finally realize the creation of new germplasm of Penaeus vannamei. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 .Construction of pcDNA3.1(+)-N-eGFP-Afp expression vector, (A) Construction map of pcDNA3.1(+)-N-eGFP-Afp vector. (B) Afp cDNA sequence;

[0022] Figure 2 . Construction of pcDNA3.1(+)-Tol2-Afp expression vector, (A) Construction map of pcDNA3.1(+)-Tol2-Afp vector. (B) Tol2 5'TIR, Tol23'TIR sequence and AfpcDNA sequence;

[0023] Figure 3 .Afp-eGFP agarose gel electrophoresis and PCR amplification analysis, (A) M: DL-10000 Marker, p is the agarose gel electrophoresis of Afp-eGFP plasmid. (B) M: DL-2000 Marker, p is the PCR amplification result of Afp-eGFP plasmid;

[0024] Figure 4 .Detection of Afp-eGFP plasmid integration in shrimp sperm for 2h and 4h, M: DL-10000Marker. p is the result of PCR amplification of Afp-eGFP plasmid. s is the result of normal sperm amplification. a is the result of sperm amplification after 1μg plasmid was injected into the sperm pod of white shrimp for 2h. a1 is the result of amplification after sperm digestion with low concentration of DNAse (0.4U), and a1s is the result of amplification of the digestion supernatant of a1. a2 is the result of amplification after sperm digestion with high concentration of DNAse (0.8U), and a2s is the result of amplification of the digestion supernatant of a2. b is the result of sperm amplification after 1μg plasmid was injected into the sperm pod of shrimp in vitro for 2h. b1 is the result of amplification after sperm digestion with low concentration of DNAse (0.4U), and b1s is the result of amplification of the digestion supernatant of b1. b2 is the result of amplification after sperm digestion with high concentration of DNAse (0.8U), and b2s is the result of amplification of the digestion supernatant of b2. c is the amplification result of sperm injected with 1 μg plasmid for 4 hours after the shrimp spermatophore was injected. c1 is the amplification result after the sperm was digested with low concentration DNAse (0.4U), and c1s is the amplification result of the digestion supernatant of c1. is the amplification result after the sperm was digested with high concentration DNAse (0.8U), and c2 is the amplification result of the digestion supernatant. d is the amplification result of sperm injected with 1 μg plasmid for 4 hours after the shrimp spermatophore was injected in vitro. d1 is the amplification result after the sperm was digested with low concentration DNAse (0.4U), and d1s is the amplification result of the digestion supernatant of d. d2 is the amplification result after the sperm was digested with high concentration DNAse (0.8U), and d2s is the amplification result of the digestion supernatant of d2;

[0025] Figure 5 .DNA enzyme digestion plasmid agarose gel electrophoresis detection, M: DL-10000Marker. (A) Different concentrations of DNA enzyme (0.05U, 0.1U, 0.2U, 0.4U, 0.8U) were used to digest 0.2μg of plasmid and then subjected to plasmid agarose gel electrophoresis. p is Afp-eGFP plasmid. (B) Different concentrations of DNA enzyme (0.05U, 0.1U, 0.2U, 0.4U, 0.8U) were used to digest 0.2μg of plasmid and then subjected to PCR amplification and agarose gel electrophoresis analysis. p is the PCR amplification result of Afp-eGFP plasmid;

[0026] Figure 6.Detection of shrimp sperm integration of Afp-eGFP plasmid for 4h, 8h, 16, and 42h, M: DL-10000Marker. p is the result of PCR amplification of Afp-eGFP plasmid. a (sample 1) and b (sample 2) are the results of sperm amplification after 1μg plasmid was injected into shrimp sperm pods for 4h. a1 and b1 are the results of amplification after a and b sperm were digested with DNA enzyme (0.8U), and a1s and b1s are the results of amplification of the digestion supernatant of a1 and b1. c (sample 1) and d (sample 2) are the results of sperm amplification after 1μg plasmid was injected into shrimp sperm pods for 8h. C1 and d1 are the results of amplification after c and d sperm were digested with DNA enzyme (0.8U), and c1s and d1s are the results of amplification of the digestion supernatant of c1 and d1. e (sample 1) and f (sample 2) are the results of sperm amplification after 16h of injection of 1μg plasmid into shrimp sperm pods. e1 and f1 are the amplification results of e and f sperm digested with DNA enzyme (0.8U), and e1s and f1s are the amplification results of el and f1 digested supernatants. g (sample 1) and h (sample 2) are the amplification results of shrimp sperm injected with 1μg plasmid 42h. g1 and h1 are the amplification results of g and h sperm digested with DNA enzyme (0.8U), and g1s and his are the amplification results of g1 and h1 digested supernatants;

[0027] Figure 7 .Detection of Afp-eGFP plasmid integration in shrimp fertilized eggs, M: DL-10000Marker. p is the result of PCR amplification of Afp-eGFP plasmid. (A) Detection of exogenous plasmid in fertilized eggs that were mated 10 days after sperm injection of 1 μg plasmid. a is the amplification of fertilized eggs after mating with sperm injected with physiological saline. b is the sperm after mating. c is the fertilized eggs that were mated after sperm injected with plasmid. (B) Detection of exogenous plasmid in fertilized eggs that were mated 25 days after sperm injection of 1 μg plasmid. a is the amplification of fertilized eggs after mating with sperm injected with physiological saline. b is the sperm injected with 1 μg plasmid 25 days ago. c is the sperm after mating. d is the fertilized eggs that were mated after sperm injected with plasmid;

[0028] Figure 8 .Observation of the morphology of fertilized eggs of shrimp. (A) Observation of the morphology of fertilized eggs 25 days after sperm injection with physiological saline. (B) Observation of the morphology of fertilized eggs 25 days after sperm injection with 1 μg plasmid. bar = 100 μm;

[0029] Fig. 9 .Analysis of fertilized egg integration rate, M: DL-2000Marker. p is the result of PCR amplification of Afp-eGFP plasmid. s is the result of PCR amplification of fertilized eggs after mating with spermatophores injected with physiological saline. 1-96 is the detection of fertilized eggs after mating with spermatophores injected with plasmids;

[0030] Fig.10.2cm shrimp integrated with Afp-eGFP plasmid, M: DL-1000Marker. p is the result of PCR amplification of Afp-eGFP plasmid. c1-c4 are PCR amplifications of shrimp produced by mating after male shrimp spermatophore was injected with physiological saline. b1-b20 are the detection of shrimp produced by mating after spermatophore was injected with plasmid;

[0031] Fig.11 .Detection of Afp-eGFP plasmid integration in different tissues of shrimp, M: DL-1000Marker. p is the PCR amplification result of Afp-eGFP plasmid. c is the PCR amplification of shrimp produced by mating after male shrimp spermatophore injection of physiological saline. b1-b14 are the detection of shrimp produced by mating after spermatophore injection of plasmid. Among them, G is hepatopancreas, Y is eye horn, and J is muscle;

[0032] Fig.12 .2cm shrimp integrated growth-promoting plasmid (Gro-eGFP) detection, M: DL-1000Marker. p is the PCR amplification result of Afp-eGFP plasmid. c1-c4 are the PCR amplifications of shrimp produced by mating after male shrimp spermatophore injection of physiological saline. a1-a24 are the detection of shrimp produced by mating after spermatophore injection of plasmid;

[0033] Fig.13 .Detection of the integration of Gro-eGFP plasmid in different tissues of shrimp, M: DL-1000Marker. p is the PCR amplification result of Gro-eGFP plasmid. c is the PCR amplification of shrimp produced by mating after male shrimp spermatophore was injected with physiological saline. a1-b10 are the detection of shrimp produced by mating after spermatophore was injected with plasmid. G is hepatopancreas, Y is eye horn, and J is muscle;

[0034] Fig.14 . Body weight and length of shrimp after integration of growth-promoting plasmid (Gro-eGFP). (A) Shrimp produced by mating after sperm injection of male shrimp with saline (Control) and injection of growth-promoting plasmid (Growth). (B) Comparison of body weight between Control and Growth groups. (C) Comparison of body length between Control and Growth groups. DETAILED DESCRIPTION

[0035] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0036] The following embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Based on the specific embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work belong to the protection scope of the present invention.

[0037] In the examples of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the examples of the present invention, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0038] Example 1

[0039] A method for sperm-mediated gene introduction into Penaeus vannamei, characterized in that the method comprises the following steps:

[0040] 1) Construction of a recombinant plasmid containing the target modified gene and a specific fluorescent protein:

[0041] Wherein, the target improved gene is selected from antifreeze proteins (Ant freeze proteins, Afp), and the construction of the recombinant plasmid includes the following steps:

[0042] Preparation of ligation product: The Afp cDNA sequence was ligated to the pcDNA 3.1(+)-N-eGFP plasmid through the KpnI and EcoRI sites to obtain a ligation product, which was stored at 4°C; wherein the Afp gene sequence: 5'-GGTACCATGAAGTGTTTAAGGCCGATCTTGGCTCATGCGATTATTAACACCGTATCTTCCGTTGCTCGTTTGCAAACACGAACTCTCAGCTCTGCGAGGGCTCCAAGGGCGAAAAATAGACGTTGAGCAACTGCCACGGCGATAAAAGCGAGGAAAGCGGCACTACCTGTACAGGAACCCGATTCGACGCAGTCATAGAACGACATCAACATGTACCGTTTCACGTAAAACAGGCCCTGGATGCAATATTTCCACGTGCATTATCATTGGGGGAGTACCTGCTCCATCAGCTGCTTGCAAGATCTCTGGAGGTACTTTGAGTGCTTTTTAGGAATTC-3' (SEQ ID NO.1).

[0043] Preparation of competent cells: After taking out Top10 competent cells from -80℃, immediately put them in ice to melt, 100μL per tube, and immediately put them on ice to dissolve. After dissolving, add 5μL of ligation product, gently blow and mix with a pipette, and put the centrifuge tube on ice for 30min; then put it in a 42℃ water bath for 45s, and immediately put the centrifuge tube on ice for 2min;

[0044] Competent cell expansion culture: add 500 μL LB liquid medium to the centrifuge tube after the ice bath, and culture at 37°C, 180 rpm, on a shaking platform for 1 hour;

[0045] Blue-white spot screening: after the shaking culture is completed, 50 μL of the culture is spread on 2% LB solid medium. Ampicillin, 20 μL X-Gal and 20 μL IPTG are evenly spread on the surface of the solid medium with a plate spreader in advance. After the plate is spread, it is placed upright for 30 minutes, and then sealed with a sealing film and placed in a 37°C incubator for inversion culture for 12-16 hours; after the solid culture plate is taken out of the 37°C incubator, it is first restored to room temperature, and when the blue-white spots appear on the colonies, 3-5 independent white spots are picked and placed in a 50mL centrifuge tube;

[0046] Propagation of the recombinant plasmid: Add 10 mL of LB liquid medium and ampicillin to the above centrifuge tube, and culture in a 37°C incubator at 250 rpm for 12 h.

[0047] Recombinant plasmid extraction: refer to OMEGAE.ZNA Plasmid Mini Kit, the specific method is as follows: prepare a centrifuge tube, mark it and aspirate 4mL of bacterial solution, centrifuge it at room temperature at 10000g for 1min, and discard the supernatant; add 250μL solution I containing RNaseA to lyse the bacteria, use a gun to blow the bacterial solution into a suspension without visible precipitation; add 250μL solution II (preheated at 37℃ before use), mix well and let the solution stand at room temperature for 2min after it becomes completely clear. Do not shake violently in this step; add 350μL solution III (preheated at 37℃ before use), mix well immediately, and a white precipitate will appear. It is very important to mix evenly in this step to prevent the formation of local precipitation; centrifuge it at 13000g at room temperature for 10min; after centrifugation, aspirate the supernatant into the HiBind column, centrifuge it at 10000g at room temperature for 1min (the column needs to be balanced before use); discard the waste liquid, add Buffer Add 500μL of HB to the adsorption column for elution, then quickly centrifuge; discard the waste liquid, add Wash Buffer 700ul, centrifuge at 10000g for 1min at room temperature, discard the waste liquid, and repeat this step; centrifuge at 13000g for 2min at room temperature to empty the column; put the column back into a 1.5mL tube, add 30-50μL of sterile water (sterile water needs to be preheated at 65℃ when used) to the matrix layer in the column, let it stand at room temperature for 1-2min, centrifuge at 13000g for 1min at room temperature, and the centrifuged product is the recombinant plasmid, which is marked and stored for later use.

[0048] 2) Inject the recombinant plasmid into the mature spermatozoa of male shrimp, and use electrical stimulation to transfer the recombinant plasmid into sperm:

[0049] The recombinant plasmid sperm injection includes the following steps: The white shrimp required for the experiment comes from the excellent shrimp of Jiangsu Xiaofeng Agricultural Science and Technology Group Co., Ltd. The mature male shrimp body length is 13.35cm±0.54cm, and the female shrimp body length is 18.54cm±0.44cm. The water temperature of the broodstock pond is 27℃~28℃. The salinity is 28~30. The sperm of mature male shrimp is white and plump. Wrap the back of the male shrimp with gauze, expose the abdomen, and hold it in your hand. Use a Hamilton micro-syringe (32ga) to slowly inject 5ul200ng / μL recombinant plasmid solution into the location of the sperm mass in the sperm. During the injection, gently push the plasmid solution in while slowly pulling out the injection needle to maximize the contact area between the plasmid solution and the semen. After the injection, use the WJ-2002 live gene introduction instrument for electrical stimulation, and finally raise the male shrimp.

[0050] 3) Select sexually mature female shrimps to mate with the male shrimps in step 2) to complete fertilization and spawning:

[0051] The process includes the steps of male shrimp screening and identification and female shrimp sexual maturity treatment. Specifically, male shrimp screening and identification include the following steps:

[0052] For the spermatophore in step 2), squeeze it gently with your thumb and put it into a 5mL centrifuge tube with 3mL of 0.1% pancreatin, and cut the spermatophore with scissors in the centrifuge tube; 37℃ water bath for 10min for tissue digestion, shaking 2-3 times during the period; add 1mL15% FBS to stop, 500rpm / min, centrifuge for 10min; take the supernatant into a new 5mL EP tube, 2000rpm / min, centrifuge for 10min; discard the supernatant, keep the precipitate, add 200μL of physiological saline to dissolve, and you can get semen. After obtaining the semen, add 0.8ul1unit / uL DNase and incubate in a 37℃ water bath for 1h for plasmid digestion. PCR amplification is used to identify whether the target Afp modified gene exists in the mature sperm of male shrimp. Cultivate other male shrimps with the target Afp modified gene to make their sperm mature naturally.

[0053] Treatment of sexual maturity of female shrimp: promote the maturation of female shrimp gonads by removing the eyestalk. Use red-hot hemostats to scald the eyestalk on one side of the female shrimp. After the eyestalk is burned to a flat char and disinfected, it is moved to a pond for cultivation and waits for the maturation of the female shrimp gonads.

[0054] 4) Collect the fertilized eggs in step 3) and perform fluorescence and target modified gene screening:

[0055] The process includes collecting fertilized eggs after spawning, first performing fluorescence screening, and extracting the recombinant plasmid in the fertilized eggs with reference to the rapid plasmid extraction kit, and then identifying whether there is a positive recombinant plasmid in the fertilized eggs through PCR amplification and agarose gel electrophoresis.

[0056] Specifically, the extraction method of the recombinant plasmid is as follows: add 200 μL of GA buffer in the marine animal tissue genomic DNA extraction kit, vortex for 15 seconds; add 20 μL of Proteinase K in the marine animal tissue genomic DNA extraction kit, vortex to mix, and briefly centrifuge to remove water droplets in the cap. Place at 56°C until the tissue is dissolved; add 150 μL of solution P1 to the centrifuge tube and vortex; add 150 μL of solution P2 to the centrifuge tube and turn it upside down 6-8 times; add 350 ul of solution P5 to the centrifuge tube, immediately and quickly turn it upside down for 12-20 times, mix it thoroughly, and flocculent precipitation will appear at this time. Centrifuge at 12000rpm (~13400g) for 2min; transfer the supernatant from the previous step to the adsorption column CP3, centrifuge at 12000rpm (~13400g) for 30sec, pour out the waste liquid in the collection tube, and place the adsorption column CP3 into the collection tube. Add 300 μL of rinse solution PWT to the adsorption column CP3, centrifuge at 12000rpm (~13400g) for 30 seconds, and discard the waste liquid in the collection tube; place the adsorption column CP3 in the collection tube, centrifuge at 12000rpm (~13400g) for 1 minute to remove the residual rinse solution in the adsorption column; place the adsorption column CP3 in a clean centrifuge tube, add 50-100 μL of elution buffer TB to the middle part of the adsorption membrane, centrifuge at 12000rpm (~13400g) for 30 seconds to collect the plasmid solution into the centrifuge tube. PCR amplification: Configuration of PCR reaction system

[0057]

[0058] PCR reaction conditions were set as follows: 94°C pre-denaturation for 2 min. 98°C denaturation for 10 sec. 58°C annealing for 30 sec. 68°C extension for 30 sec / kb. A total of 30 cycles. Full extension at 68°C for 10 min. The amplified product size was 143 bp.

[0059] Among them, the PCR amplification primer sequences are: upstream primer 5'-GATTCGACGCAGTCATAGA-3 (SEQ ID NO.2)', downstream primer 5'-CACTCAAAGTACCTCCAGAG-3' (SEQ ID NO.3). The amplified fragment sequence is: 5'-GATTCGACGCAGTCATAGAACGACATCAACATGTACCGTTTCACGTAAAACAGGCCCTGGATGCAATATTTCCACGTGCATTATCATTGGGGGAGTACCTGCTCCATCAGCTGCTTGCAAGATCTCTGGAGGTACTTTGAGTG-3' (SEQ ID NO.4).

[0060] Agarose gel electrophoresis: Prepare 0.8% agarose gel, weigh 0.8g agarose powder, put it into a conical flask, add 100mL 1xTAE electrophoresis buffer, add 10ul Gelred (10000x), and place the conical flask in a microwave or electric stove to heat until the agar is dissolved; for the preparation of the gel plate, wash and dry the organic glass inner tank, put it into the gel mold, and insert a comb in a fixed position. Gently shake the agarose gel solution cooled to about 60°C, pour it into the organic glass inner tank, and let it stand at room temperature until it solidifies; add the sample, mix the sample with 6x loading buffer and then load it (1μL loading buffer + 5ul sample); electrophoresis, the gel plate is electrophoresed in 1xTAE electrophoresis buffer. Voltage 120V, time 25min. Development analysis.

[0061] 5) Incubate the fertilized eggs positive for the target improved gene in step 4) to obtain new germplasm of Penaeus vannamei:

[0062] The process further includes conducting tissue distribution detection analysis of the target improved gene on the hatched mature shrimp.

[0063] The test results are as follows:

[0064] Construction and verification of expression plasmids: Figure 1 As shown, the present invention successfully cloned the cDNA sequence of antifreeze proteins (Afp) into the pcDNA3.1(+)-N-eGFP plasmid through KpnI and EcoRI sites, hereinafter named Afp-eGFP. In order to further insert the exogenous Afp-eGFP into the genome of the host cell, the present invention constructed the Tol2 vector system as a transposon plasmid, mainly through BamHI and EcoRI sites to clone Tol2 5'TIR, Tol23'TIR and Afp cDNA into pcDNA3.1(+)-N-eGFP plasmid. Figure 2), and ordered the transposase pCS2FA COTol2TPase from Addgene as an auxiliary plasmid, which is responsible for encoding the transposase. Subsequently, the plasmid Afp-eGFP was analyzed by agarose gel electrophoresis and PCR amplification. The electrophoresis results showed the presence of an obvious specific band, with a size of approximately 6.1kb, 143bp, which was consistent with the experimental design results ( Figure 3 ).

[0065] Analysis of target DNA uptake by shrimp sperm: In order to study whether sperm can capture exogenous DNA in vitro. After obtaining the spermatophore of white shrimp, 1μg of plasmid was injected in vitro for 6h and 12h, and then sperm was extracted. Since the transferred recombinant plasmid carries the strong CMVp promoter, the target gene is entirely possible to be expressed. We detected the integration of exogenous DNA into its sperm by PCR amplification. 1μg of plasmid was injected into the spermatophore of white shrimp for 2h and 4h, or 1μg of plasmid was injected in vitro for 2h and 4h after obtaining the spermatophore, and then sperm plasmid extraction and PCR verification were performed. Normal sperm was used as a template as a negative control, and 50ngAfp-eGFP plasmid was used as a template as a positive control. The results confirmed that specific bands were amplified in the sperm after treatment in both ways, indicating the presence of exogenous Afp-eGFP plasmid in the sperm ( Figure 4 ).

[0066] In order to further exclude the possibility of residual extra-sperm plasmid DNA, we used different concentrations of DNA enzyme (0.05U, 0.1U, 0.2U, 0.4U, 0.8U) to incubate and digest 0.2μg of plasmid and then perform PCR amplification. The results confirmed that after DNA enzyme treatment, no bands appeared in the plasmid itself or in the amplification ( Figure 5 ). Subsequently, sperm were incubated with low-concentration (0.4U) or high-concentration (0.8U) DNA enzymes. The results confirmed that positive plasmids were still present in sperm after treatment with different concentrations of DNA enzymes. Although weak bands were amplified in the supernatant of some experimental groups, the amplified products in the supernatant after high-concentration DNA enzyme treatment were significantly lower than those in the low-concentration group. We speculate that the incomplete treatment was due to the excessive viscosity of the matrix in the semen, resulting in incomplete enzyme digestion of the plasmid ( Figure 5 ). In short, the amplification results show that after spermatozoa are injected with plasmid, sperm can effectively integrate exogenous Afp-eGFP plasmid.

[0067] It is not clear whether sperm can continue to exist after integrating exogenous Afp-eGFP plasmid. Therefore, we injected 1 μg plasmid into shrimp spermatophore 4h, 8h, 16, 42h after sperm extraction and PCR verification. The results showed that the target plasmid still existed 42h after sperm uptake of exogenous plasmid, and the digestion supernatant was used as a template for PCR detection, and no amplification bands were found at some time points ( Figure 6 ).

[0068] Detection of target plasmid integration in shrimp fertilized eggs: In order to study whether shrimp sperm can carry exogenous plasmids into egg cells during fertilization. Female shrimps with mature gonads mated with male shrimps whose spermatophores had been injected with Afp-eGFP plasmids for 10 days and 25 days. All fertilized eggs were collected after the female shrimps finished spawning. Normal fertilized eggs were used as negative controls, and 50ng of plasmid was used as a template as a positive control. At the same time, we performed PCR amplification on spermatophores that had mated and produced sperm. The PCR results confirmed that specific bands existed in the fertilized eggs that were mated 10 days and 25 days after the spermatophores were injected with plasmids. However, there were no amplified bands in normal fertilized eggs. Specific bands were also amplified in spermatophores that were injected with 1μg of plasmid for 25 days. This result confirms that sperm can effectively integrate exogenous genes into fertilized eggs as a vector, and that exogenous genes can exist in spermatophores for a long time ( Figure 7 ). At the same time, in order to determine whether sperm integration of plasmids would affect fertilized eggs, we observed the morphology of fertilized eggs. The results showed that sperm ingestion of plasmids and fertilization had no effect on the morphology of fertilized eggs ( Figure 8 ).

[0069] Analysis of the positive rate of fertilized eggs: The ability of sperm as a carrier to introduce exogenous genes into fertilized eggs, that is, the integration rate of exogenous genes, directly affects the subsequent work. Therefore, we analyzed the gene transfer rate of fertilized eggs. After the mating of shrimps, we immediately collected all fertilized eggs and randomly selected 96 fertilized eggs for PCR amplification detection. Among them, 71 fertilized eggs had obvious amplification bands, indicating that sperm successfully integrated exogenous genes into shrimp fertilized eggs, and the gene transfer rate was as high as 73.96% ( Fig. 9 ). We then tested each shrimp fry one by one and further analyzed the gene transfer rate. The results showed that in addition to fertilized eggs, the target improved gene was also detected in the juvenile shrimps that were hatched and cultured to about 2 cm, and the gene transfer rate reached 20% ( Fig.10 ). Through the detection of tissue distribution of the target modified gene in commercial shrimps about 10 cm long, it was found that the positive expression rate of the modified gene in shrimp hepatopancreas was 78.5%, the positive expression rate of the modified gene in the eyestalk was 28.6%, and the positive expression rate of the modified gene in the muscle was 100% ( Fig.11 ), which further proves the feasibility of the present invention in creating new germplasm.

[0070] In addition, the inventors also selected other target improved genes (such as growth-promoting genes) and used the same method as above to construct new shrimp germplasm. The results of growth-promoting gene construction showed that the target improved genes could be detected in young shrimps that were hatched and cultured to about 2 cm, and the gene transfer rate reached 79.17% ( Fig.12). Through the detection of tissue distribution of the target modified gene in commercial shrimps about 10 cm long, it was found that the positive expression rate of the modified gene in shrimp hepatopancreas was 40%, the positive expression rate of the modified gene in the eyestalk was 0%, and the positive expression rate of the modified gene in the muscle was 100% ( Fig.13 ). Through the analysis of body weight and body length, it was found that the weight and growth rate of shrimp modified by growth-promoting genes were greatly improved ( Fig.14 The above results show that the above method can successfully construct a new variety with improved target gene.

[0071] It is necessary to point out that the above embodiments are limited to further elaboration and explanation of the technical solution of the present invention, and are not further limitations of the technical solution of the present invention. The method of the present invention is only a preferred implementation scheme, and is not used to limit the protection scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for sperm-mediated gene introduction into Penaeus vannamei, characterized in that: The method comprises the following steps: 1) Construct a recombinant plasmid containing the target improved gene and a specific fluorescent protein; 2) Injecting the recombinant plasmid into the mature spermatozoa of male shrimp, and using electrical stimulation to achieve the transfer of the recombinant plasmid into the sperm; 3) Selecting sexually mature female shrimps to mate with the male shrimps in step 2) to complete fertilization and spawning; 4) collecting the fertilized eggs in step 3), and screening the positive fertilized eggs into which the target modified gene has been successfully introduced by screening for specific fluorescence under a fluorescence microscope; 5) The fertilized eggs positive for the target improved gene in step 4) are incubated to obtain new germplasm of Penaeus vannamei.

2. The method according to claim 1, characterized in that The method comprises the step of identifying the characteristics of the new Litopenaeus vannamei germplasm.

3. The method according to claim 1, characterized in that Step 1) is to obtain the cDNA sequence of the target improved gene by PCR amplification and clone it into a plasmid.

4. The method according to claim 1, characterized in that The target improved gene is from antifreeze gene, growth-promoting gene and / or disease-resistant gene.

5. The method according to claim 1, characterized in that The plasmid can be selected from pcDNA3.1(+)-N-eGFP plasmid.

6. The method according to claim 1, characterized in that Step 2) is to use a Hamilton micro-injector to complete the injection of the recombinant plasmid into the spermatophore, and to use the WJ-2002 living gene introduction instrument to complete the electrical stimulation; the electrical stimulation step includes the following: inserting the electrode into the injection plasmid, using a stimulation voltage of 50-80V, a cycle of 50-400ms, each stimulation time of about 1s, and giving 10 stimulations in total.

7. The method according to claim 1, characterized in that Step 3) also includes male shrimp screening and identification steps.

8. The method according to claim 7, characterized in that The identification and screening steps include the following: for the spermatophore in step 2), the spermatophore is obtained by gently squeezing with a thumb and then placed in a 5mL centrifuge tube containing 3mL of 0.1% trypsin, and the spermatophore is cut into pieces with scissors in the centrifuge tube; tissue digestion is performed in a water bath at 37°C for 10 minutes, during which the spermatophore is shaken 2-3 times; 1mL of 15% FBS is added to terminate the digestion, and the mixture is centrifuged at 500rpm / min for 10 minutes; the supernatant is taken into a new 5mL EP tube, and the mixture is centrifuged at 2000rpm / min for 10 minutes; the supernatant is discarded, the precipitate is retained, and 200μL of physiological saline is added for dissolution to obtain semen; after obtaining the semen, 0.8ul of 1unit / uL of DNA enzyme is added and incubated in a water bath at 37°C for 1h for plasmid digestion; PCR amplification is used to identify whether the target improved gene exists in the mature sperm of male shrimp; and other male shrimps with the target improved gene are cultured to allow their sperm to mature naturally.

9. The method according to claim 1, characterized in that Step 3) also includes a step of processing the sexual maturity of female shrimps, specifically, promoting the maturation of female shrimp gonads by removing the eyestalks, using red-hot hemostatic forceps to scald the unilateral eyestalks of female shrimps, and the eyestalks are scalded to a flat char and disinfected before being moved to a pond for cultivation, waiting for the maturation of the female shrimp gonads.

10. The method according to claim 1, characterized in that Step 4) is to identify the fertilized eggs by screening for specific fluorescence under a fluorescence microscope, and select positive fertilized eggs for use.

Images