Efficient isothermal amplification method

Abstract

The invention discloses an efficient isothermal amplification method, and relates to the technical field of amplification methods. The invention includes. By adopting an isothermal amplification system, the technology avoids complex thermal cycle equipment required by traditional PCR (Polymerase Chain Reaction), and the amplification process can be carried out only by maintaining the constant temperature of 25-45 DEG C. The isothermal amplification system not only simplifies the requirements of experimental equipment, but also greatly improves the simplicity and flexibility of operation, and is particularly suitable for being applied to field environments with limited resources or emergency situations. Traditional PCR depends on multiple times of heating and cooling circulation, the consumed time is long, the isothermal amplification technology can rapidly complete amplification within 10-40 minutes under the condition that the constant temperature is kept, and the experiment time is greatly shortened.

Description

Technical Field

[0001] The invention belongs to the field of isothermal amplification, and in particular relates to a high-efficiency isothermal amplification method. Background Art

[0002] Nucleic acid amplification technology is an important tool in the field of molecular biology and medical diagnosis, and is widely used in gene detection, pathogen detection, genetic screening and precision medicine. Among them, PCR (polymerase chain reaction), as the most commonly used nucleic acid amplification method, has become a standard technology in biological research and clinical diagnosis. With its extremely high sensitivity and specificity, PCR technology can amplify trace amounts of target DNA or RNA sequences, helping researchers or clinicians analyze genetic information and pathogens at the molecular level. But despite the significant advantages of PCR technology, it also faces some significant limitations.

[0003] Traditional PCR technology relies on complex thermal cycling equipment that requires precise temperature control and continuous heating and cooling cycles to ensure denaturation of DNA double strands, binding of primers, and extension of polymerase. This thermal cycle not only increases the complexity of the equipment and the difficulty of operation, but also requires the laboratory to have specific infrastructure, which significantly increases the cost of detection. Especially in field detection or field operations with limited resources, traditional PCR technology is not very applicable. In addition, the reaction time of PCR is long, usually taking 1-2 hours to complete the entire amplification process, which is a significant limitation for rapid diagnostic applications.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies of the prior art, provide an efficient constant temperature amplification method, and solve the problems raised in the above-mentioned background technology.

[0006] In order to solve the above technical problems, the basic concept of the technical solution adopted by the present invention is:

[0007] A highly efficient isothermal amplification method comprises the following steps:

[0008] Step (1): adding the sample to be tested into a lysis solution containing Tris-HCl buffer, salts, detergents and chelating agents, lysing the cell wall or cell membrane to release the nucleic acid into the solution, and centrifuging the sample lysate to remove impurities to obtain a nucleic acid extract containing the target nucleic acid.

[0009] Step (2): Mix the nucleic acid extract obtained in step (1) with an amplification reaction reagent to form an isothermal amplification reaction mixture.

[0010] Step (3): The isothermal amplification reaction mixture prepared in step (2) is placed under a constant temperature condition of 25-45°C for 10-40 minutes. At this temperature, the nucleic acid sequence is efficiently amplified through the combined action of the recombinase and the polymerase.

[0011] Step (4): After the amplification reaction is completed, the amplification product generated in step (3) is detected using fluorescent dye and colorimetry.

[0012] Optionally, in the step (1), the Tris-HCl concentration in the lysate is 10-50 mM, the pH value is 7.5-8.5, the detergent concentration is 0.1-1% (v / v), and the chelating agent concentration is 1-10 mM.

[0013] Optionally, the step (2) may include the following reagents:

[0014] A recombinase selected from UvsX of T4 phage or RecA of Escherichia coli;

[0015] A recombinase auxiliary protein selected from UvsY of T4 phage or RecR of Escherichia coli;

[0016] A single-stranded binding protein selected from GP32 of T4 phage or SSB of Escherichia coli;

[0017] DNA polymerase selected from Bsu Pol I, T7 DNA polymerase, Phi-29 DNA polymerase or Taq DNA polymerase;

[0018] RNA polymerase selected from T7 bacteriophage RNA polymerase;

[0019] A reverse transcriptase selected from MMLV reverse transcriptase or AMV reverse transcriptase;

[0020] ATP regeneration enzyme and ATP regeneration raw materials;

[0021] n-Butanol dehydrating agent (5-20%).

[0022] Optionally, the concentration of the recombinase is 75-600 ng / μL, the concentration of the recombinase auxiliary protein is 50-150 ng / μL, the concentration of the single-stranded binding protein is 150-1000 ng / μL, the concentration of the DNA polymerase is 25-150 ng / μL, the concentration of the RNA polymerase is 0-100 U / RXN, and the concentration of the reverse transcriptase is 125-1000 U / RXN. The concentration of the n-butanol dehydrating agent is 5-20% (v / v).

[0023] Optionally, the final concentration range of the isothermal amplification system is: RNA polymerase 0-100U / RXN, recombinase 75-600ng / μL, DNA polymerase 25-150ng / μL, ATP regeneration enzyme 0.1-15ng / μL, ATP regeneration raw material 50-500mM.

[0024] Optionally, in step (4), the amplified product is detected in real time by a fluorescent dye, and the fluorescent dye is selected from SYBRGreen I.

[0025] Optionally, the method is suitable for amplification of DNA and RNA templates, for detection of low copy number samples, and for nucleic acid detection of blood and saliva samples.

[0026] Optionally, the method is performed under isothermal conditions with an amplification time of 10-40 minutes.

[0027] After adopting the above technical solution, the present invention has the following beneficial effects compared with the prior art. Of course, any product implementing the present invention does not necessarily need to achieve all the advantages described below at the same time:

[0028] 1. By adopting a constant temperature amplification system, this technology avoids the complex thermal cycle equipment required for traditional PCR, and the amplification process only needs to be maintained at a constant temperature of 25-45°C. This constant temperature amplification system not only simplifies the requirements for experimental equipment, but also greatly improves the simplicity and flexibility of operation, and is particularly suitable for applications in field environments with limited resources or in emergency situations. Traditional PCR relies on multiple heating and cooling cycles, which takes a long time, while the constant temperature amplification technology can quickly complete the amplification within 10-40 minutes while maintaining a constant temperature, greatly shortening the experimental time.

[0029] 2. By using the synergistic effect of recombinase and polymerase, the amplification process of nucleic acid sequences is made more efficient, especially in the detection of low copy number samples, which shows extremely high sensitivity. The role of recombinase is to promote the efficient binding of primers and template DNA, while polymerase is responsible for replicating and amplifying the target nucleic acid sequence. This synergistic effect can greatly improve the efficiency of amplification. For low-concentration target nucleic acid samples, such as early pathogen infection or detection of rare gene mutations, traditional amplification methods often lead to missed detection or inaccurate test results due to insufficient sensitivity. However, isothermal amplification technology can effectively identify and amplify low-copy number target nucleic acid sequences, and even very trace samples can be amplified and detected in a short time.

[0030] The specific implementation modes of the present invention are further described in detail below in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The drawings described below are only some embodiments. For those skilled in the art, other drawings can be obtained based on these drawings without creative work. In the drawings:

[0032] Figure 1 This is a graph showing the fluorescent dye test results of Example 1;

[0033] Figure 2 This is a colorimetric test result diagram of Example 2.

[0034] It should be noted that these drawings and textual descriptions are not intended to limit the conceptual scope of the present invention in any way, but are intended to illustrate the concept of the present invention for those skilled in the art by referring to specific embodiments. DETAILED DESCRIPTION

[0035] The present invention will now be described in further detail with reference to the accompanying drawings.

[0036] See also Figure 1 As shown, Example 1: In this example, a highly efficient isothermal amplification method is provided, which uses a fluorescent dye (SYBR Green I) for real-time monitoring to achieve quantitative analysis of the amplification reaction, including the following steps:

[0037] Reagents and materials:

[0038] Sample: DNA taken from a sample of human blood.

[0039] Lysis buffer: contains Tris-HCl (concentration of 20 mM, pH 7.8), NaCl (concentration of 100 mM), detergent Triton X-100 (0.5% v / v), and chelating agent EDTA (5 mM).

[0040] Amplification Reagents:

[0041] Recombinase: UvsX of T4 bacteriophage, concentration 300 ng / μL;

[0042] Recombinase auxiliary protein: UvsY of T4 bacteriophage, concentration of 100 ng / μL;

[0043] Single-stranded binding protein: GP32 of T4 bacteriophage, concentration 500 ng / μL;

[0044] DNA polymerase: Taq DNA polymerase, concentration 100 ng / μL;

[0045] RNA polymerase: T7 bacteriophage RNA polymerase, concentration 50U / RXN;

[0046] Reverse transcriptase: MMLV reverse transcriptase, concentration 500U / RXN;

[0047] ATP regeneration enzyme: creatine kinase, concentration is 10 ng / μL, ATP regeneration raw material is creatine phosphate, concentration is 200 mM;

[0048] n-Butanol dehydrating agent: 10% (v / v);

[0049] dNTPs: 200 μM;

[0050] Fluorescent dye: SYBR Green I;

[0051] Primer sequences:

[0052] Upstream primer (SEQ ID NO: 1): ATGCGTACGTAGCTAGCTAGCTAGTACGATCG

[0053] Downstream primer (SEQ ID NO: 2): CGTAGCTAGTACGCTAGCTAGCTAGCGTACGATC

[0054] Target DNA sequence:

[0055] Target DNA template (SEQ ID NO:3): ACTGACGTAGCTAGCTAGCTACGATCGTAGCTGATCGTACG

[0056] Amplification steps:

[0057] Sample lysis: Add 5 μL of blood sample to 100 μL of lysis buffer and let stand at room temperature for 10 minutes. After centrifugation, collect the supernatant as nucleic acid extraction solution.

[0058] Preparation of amplification reaction mixture: The nucleic acid extract was mixed with the above-mentioned amplification reaction reagents to a total volume of 50 μL, including SEQ ID NO: 1 and SEQ ID NO: 2 primers, for amplifying the target DNA sequence (SEQ ID NO: 3).

[0059] Isothermal amplification: The reaction mixture is placed at 37°C for 30 minutes to amplify the target DNA sequence using the action of recombinase and DNA polymerase.

[0060] Fluorescence quantitative detection: During the reaction, a real-time fluorescence quantitative PCR instrument is used to monitor the SYBR Green I fluorescence signal. As the amplification product is generated, the fluorescence intensity gradually increases, thereby achieving real-time quantitative monitoring of the amplification reaction.

[0061] Data analysis: Based on the real-time changes in fluorescence intensity, an amplification curve is drawn and the target DNA concentration in the sample is quantitatively analyzed.

[0062] Experimental conditions:

[0063] Reaction time: 30 minutes

[0064] Fluorescence detection: SYBR Green I real-time fluorescence detection

[0065] Sample type: DNA samples with different starting concentrations (e.g. low, medium, high copy number DNA)

[0066] Experimental data:

[0067]

[0068]

[0069] Data Analysis:

[0070] The Ct values ​​of different samples indicate that the fluorescence signal appears at different times. The higher the concentration, the lower the Ct value. For example, sample 5 has the highest starting concentration (2×10 4 copies), with the lowest Ct value (18.3), while sample 4 had the lowest starting concentration (5×10 2 copies), with the highest Ct value (30.1).

[0071] The peak fluorescence intensity is related to the amount of amplified product. A higher starting concentration (such as sample 5) produces a stronger fluorescence signal, while a low concentration sample (such as sample 4) produces a weaker fluorescence signal.

[0072] The DNA concentration calculated by the standard curve was consistent with the starting concentration, verifying the effectiveness of the fluorescence detection method in quantitative analysis.

[0073] The experimental data showed that the fluorescence real-time quantitative amplification reaction of Example 1 was effective, and the initial DNA concentration of the sample had a direct impact on the Ct value and the fluorescence intensity. The concentration of DNA in the sample could be accurately and quantitatively analyzed through the fluorescence signal of SYBR Green I.

[0074] See also Figure 2 As shown, Example 2: In this example, a highly efficient isothermal amplification method is provided, using a colorimetric method for endpoint detection, comprising the following steps:

[0075] Reagents and materials:

[0076] Sample: RNA from a saliva sample.

[0077] Lysis buffer: contains Tris-HCl (concentration of 30 mM, pH 8.0), KCl (concentration of 150 mM), detergent NP-40 (0.3% v / v), and chelating agent EDTA (3 mM).

[0078] Amplification Reagents:

[0079] Recombinase: RecA of Escherichia coli, concentration 200 ng / μL;

[0080] Recombinase auxiliary protein: RecR of Escherichia coli, concentration is 100 ng / μL;

[0081] Single-stranded binding protein: SSB from Escherichia coli, concentration 600 ng / μL;

[0082] DNA polymerase: Phi-29 DNA polymerase, concentration 50 ng / μL;

[0083] RNA polymerase: T7 bacteriophage RNA polymerase, concentration is 100U / RXN;

[0084] Reverse transcriptase: AMV reverse transcriptase, concentration is 700U / RXN;

[0085] ATP regeneration enzyme: creatine kinase, concentration is 5 ng / μL, ATP regeneration raw material is creatine phosphate, concentration is 300 mM;

[0086] n-Butanol dehydrating agent: 15% (v / v);

[0087] dNTPs: 300 μM;

[0088] Colorimetric reagent: ammonium iodide (NH4I);

[0089] Primer sequences:

[0090] Upstream primer (SEQ ID NO: 4): GATCGTACGTAGCTAGCTCGTAGTCGATCGTACG Downstream primer (SEQ ID NO: 5): CGTAGCTCGTACGCTAGCGTACGTAGCTGATC

[0091] Target RNA sequence:

[0092] Target RNA template (SEQ ID NO:6): AUGCUACGUACGCUAGCUAGCUAGCGUACGUAGCU

[0093] Amplification steps:

[0094] Sample lysis: Add 10 μL of saliva sample to 200 μL of lysis buffer, let stand at room temperature for 15 minutes, and collect the nucleic acid extract after centrifugation.

[0095] Preparation of amplification reaction mixture: The nucleic acid extract was mixed with the above-mentioned amplification reaction reagents to a total volume of 100 μL, and the target RNA sequence (SEQ ID NO: 6) was amplified using primers SEQ ID NO: 4 and SEQ ID NO: 5.

[0096] Isothermal amplification: The reaction mixture is placed at 40°C for 20 minutes, the RNA sequence is amplified using the action of recombinase and RNA polymerase, and the RNA is converted into cDNA using reverse transcriptase.

[0097] Colorimetric endpoint detection: After the reaction is completed, add 20 μL of colorimetric reagent (ammonium iodide) and let it stand for 5 minutes before detecting the reaction product by colorimetry. The nucleic acid amplification product reacts with the colorimetric reagent to produce a color change, and the depth of the color reflects the amount of the amplified product.

[0098] Data analysis: The color change intensity of the end-point reaction product is detected by colorimetry to qualitatively or semi-quantitatively analyze the amplification of the target RNA.

[0099] Experimental conditions:

[0100] Reaction time: 20 minutes

[0101] Detection method: Colorimetric endpoint detection

[0102] Sample type: RNA sample, color change occurs when the amplified product reacts with the colorimetric reagent

[0103] Experimental data:

[0104]

[0105] The OD value represents the color depth in the colorimetric detection. The higher the initial RNA concentration, the larger the OD value. For example, sample 5 (2×10 4 The OD value of sample 3 (8×10 2 The OD value of the 2000 copies was lower (0.21) and the color was the lightest.

[0106] After the reaction, samples with different starting concentrations will show different shades of yellow through the colorimetric reagent. The darker the color, the more amplified products there are, which is proportional to the starting RNA concentration.

[0107] Quantification of RNA concentration: The RNA concentration calculated by the standard curve was consistent with the actual starting concentration, indicating that the colorimetric method can be effectively used for qualitative and semi-quantitative analysis.

[0108] The experimental data of Example 2 show that the end point of the amplification reaction is well detected by colorimetry. The colorimetric signal (OD value) is positively correlated with the initial RNA concentration. A higher RNA concentration leads to a darker color change, indicating more amplified products. This method is suitable for rapid qualitative and semi-quantitative analysis, and has application potential in field detection in particular.

[0109] In summary, Example 1 uses fluorescent dyes for real-time quantitative monitoring and shows that DNA samples with different starting concentrations are successfully amplified within 30 minutes, the intensity of the fluorescent signal is positively correlated with the number of amplified products, and the difference in starting concentration can be accurately reflected by the Ct value. Example 2 uses colorimetry for endpoint detection, proving that RNA samples are effectively amplified within 20 minutes, the color changes significantly, and the amplification results can be quickly judged. Both methods show that the isothermal amplification system of the present invention has the ability to efficiently amplify target nucleic acids, does not require complex thermal cycling equipment, and is easy and fast to operate.

[0110] The DNA sample with a minimum starting concentration of 500 copies in Example 1 can also produce a significant fluorescent signal, and the RNA sample with a starting concentration of 800 copies in Example 2 also shows an obvious color change, indicating that the amplification method has a high sensitivity to low copy number samples and can detect low concentrations of target nucleic acid sequences at an early stage.

[0111] Example 1 and Example 2 completed the amplification reaction and detection within 30 minutes and 20 minutes respectively, significantly shortening the detection time of conventional PCR. This method is suitable for on-site detection and rapid diagnosis, which helps to quickly obtain results in emergency situations, especially in pathogen detection and emergency detection.

[0112] The present invention can not only perform real-time monitoring through fluorescence quantitative amplification (Example 1), but also perform endpoint detection through colorimetry (Example 2), providing multiple detection methods to adapt to different experimental conditions and application scenarios. Fluorescence quantification is suitable for accurate quantitative analysis, while colorimetry is easy to operate and does not require complex equipment, which is suitable for field and resource-limited environments.

[0113] The present invention is not limited to the above-mentioned embodiments. Anyone should be aware that any structural changes made under the enlightenment of the present invention, and any technical solutions that are the same or similar to the present invention, fall within the protection scope of the present invention. The technology, shape, and structural parts not described in detail in the present invention are all well-known technologies.

Claims

1. A highly efficient isothermal amplification method, characterized in that: The following steps are involved: Step (1): adding the sample to be tested into a lysis solution containing Tris-HCl buffer, salts, detergents and chelating agents, lysing the cell wall or cell membrane to release the nucleic acid into the solution, and centrifuging the sample lysate to remove impurities to obtain a nucleic acid extract containing the target nucleic acid. Step (2): Mix the nucleic acid extract obtained in step (1) with an amplification reaction reagent to form an isothermal amplification reaction mixture. Step (3): The isothermal amplification reaction mixture prepared in step (2) is placed under a constant temperature condition of 25-45°C for 10-40 minutes. At this temperature, the nucleic acid sequence is efficiently amplified through the combined action of the recombinase and the polymerase. Step (4): After the amplification reaction is completed, the amplification product generated in step (3) is detected using fluorescent dye and colorimetry.

2. A highly efficient isothermal amplification method according to claim 1, characterized in that: In the step (1), the concentration of Tris-HCl in the lysate is 10-50 mM, the pH value is 7.5-8.5, the concentration of the detergent is 0.1-1% (v / v), and the concentration of the chelating agent is 1-10 mM.

3. The high-efficiency isothermal amplification method according to claim 1, characterized in that: The actual step (2) includes the following reagents: A recombinase selected from UvsX of T4 phage or RecA of Escherichia coli; A recombinase auxiliary protein selected from UvsY of T4 phage or RecR of Escherichia coli; A single-stranded binding protein selected from GP32 of T4 phage or SSB of Escherichia coli; DNA polymerase selected from Bsu Pol I, T7 DNA polymerase, Phi-29 DNA polymerase or Taq DNA polymerase; RNA polymerase selected from T7 bacteriophage RNA polymerase; A reverse transcriptase selected from MMLV reverse transcriptase or AMV reverse transcriptase; ATP regeneration enzyme and ATP regeneration raw materials; n-Butanol dehydrating agent (5-20%).

4. The high-efficiency isothermal amplification method according to claim 2, characterized in that: The concentration of the recombinase is 75-600 ng / μL, the concentration of the recombinase auxiliary protein is 50-150 ng / μL, the concentration of the single-stranded binding protein is 150-1000 ng / μL, the concentration of the DNA polymerase is 25-150 ng / μL, the concentration of the RNA polymerase is 0-100 U / RXN, and the concentration of the reverse transcriptase is 125-1000 U / RXN. The concentration of the n-butanol dehydrating agent is 5-20% (v / v).

5. The high-efficiency isothermal amplification method according to claim 2, characterized in that: The final concentration range of the isothermal amplification system is: RNA polymerase 0-100U / RXN, recombinase 75-600ng / μL, DNA polymerase 25-150ng / μL, ATP regeneration enzyme 0.1-15ng / μL, ATP regeneration raw material 50-500mM.

6. The high-efficiency isothermal amplification method according to claim 1, characterized in that: In step (4), the amplified product is detected in real time by a fluorescent dye, and the fluorescent dye is selected from SYBR Green I.

7. The high-efficiency isothermal amplification method according to claim 1, characterized in that: This method is suitable for the amplification of DNA and RNA templates, for the detection of low copy number samples, and for the detection of nucleic acids in blood and saliva samples.

8. The high-efficiency isothermal amplification method according to claim 1, characterized in that: The method is carried out under isothermal conditions with an amplification time of 10-40 minutes.

Images