SNP molecular markers associated with ear length in maize under low phosphorus conditions and their application

Abstract

The present invention discloses SNP molecular markers associated with corn ear length under low-phosphorus conditions and their applications, and belongs to the field of molecular genetic marker technology. SNP molecular markers include SNP-209022198 and SNP-209022765 located on chromosome 5 of the corn Zm-B73-REFERENCE-NAM-5.0 reference genome. SNP-209022198 is located at 209022198bp on chromosome 5 of the corn genome, and the variation type is T / C; SNP-209022765 is located at 209022765bp on chromosome 5 of the corn genome, and the variation type is G / A. The SNP molecular markers significantly associated with corn ear length disclosed in the present invention can be used for molecular-assisted breeding of corn ear length traits under low-phosphorus conditions, and through molecular breeding improvement, the corn ear length trait can be screened out, and long-ear corn varieties can be cultivated, thereby increasing corn yield.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetic markers, and particularly relates to SNP markers related to corn ear length under low-phosphorus conditions and applications thereof. Background Art

[0002] Corn is an important grain and cash crop. In 2023, China's grain planting area reached 1.499 billion mu, with 663 million mu being planted with corn. It is crucial to national economic planning and food security. Phosphorus, one of the three essential elements, significantly impacts corn yield. Domestic farmland soils are low in phosphorus. China has experienced severe phosphorus losses and a significant phosphorus load for many years, accounting for approximately 30% of the global anthropogenic phosphorus load to freshwater. Furthermore, as a non-renewable resource, phosphorus in agriculture relies primarily on applied phosphate fertilizers. However, phosphate fertilizers are expensive, and excessive use can cause severe environmental pollution. Therefore, screening for crop varieties that are tolerant to low phosphorus levels and highly efficient in phosphorus is a key solution to addressing soil phosphorus deficiency and the environmental pollution caused by excessive phosphate fertilizer use. Corn ear length is a key indicator of yield, with longer ears generally resulting in higher yields. Therefore, testing corn ear length genotypes under low-phosphorus conditions not only helps identify corn germplasm capable of achieving longer ear lengths under these conditions, but also provides a scientific basis for breeding corn varieties with longer ear lengths under these conditions.

[0003] Genome-wide association study (GWAS) is an important method in crop genetic breeding research. Its theoretical basis is linkage disequilibrium (LD). Its main purpose is to find single nucleotide polymorphisms (SNPs) associated with specific traits. This method combines phenotypic and genotypic detection to find SNPs associated with specific traits. These SNPs are variant sites in the genome and are very likely to affect gene expression, thereby causing phenotypic changes.

[0004] Competitive allele-specific PCR (KASP) is a fluorescence-based genotyping technique primarily used to detect SNP variations. This technique detects SNP sites based on the specific matching of primer terminal bases, i.e., fluorescence reading after the PCR reaction. This experiment generally uses a primer set consisting of two specific upstream primers and a universal downstream primer. The terminal bases of the two upstream primers correspond to the two alleles of the SNP site to be tested, with each site having three possible genotypes (homozygous 1, homozygous 2, or heterozygous). The 5' end of primer 1 is linked to a FAM fluorescent label sequence, and the 5' end of primer 2 is linked to a HEX fluorescent label sequence. Probes are usually provided by MIX reagents. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides two SNP molecular markers related to corn ear length under low phosphorus conditions.

[0006] Specifically, the inventors discovered that two single-nucleotide polymorphisms (SNPs) located at positions 209022198 and 209022765 on chromosome 5 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome are strongly associated with maize ear length under low-phosphorus conditions. These SNPs are located within the Zm00001eb252100 gene, annotated as bHLH transcription factor 29. These two SNPs form two major haplotypes, TG (H001) and CA (H002). Statistical analysis of the ear length phenotype revealed that the ear length of the Hap1 inbred line is significantly longer than that of the Hap2 inbred line.

[0007] The SNP molecular markers associated with corn ear length under low-phosphorus conditions provided by the present invention include SNP-209022198 and SNP-209022765; SNP-209022198 is located at 209022198bp on chromosome 5 of the corn genome, and the variation type is T / C; SNP-209022765 is located at 209022765bp on chromosome 5 of the corn genome, and the variation type is G / A.

[0008] The present invention also provides a primer set for detecting molecular markers of corn ear length under low phosphorus conditions, which consists of four specific forward primers shown in SEQ ID No. 1-3 and SEQ ID No. 4-6 in the sequence listing and two universal reverse primers.

[0009] The SNP molecular markers provided by the present invention can be used in the following applications:

[0010] (1) Detecting ear length of corn under low phosphorus conditions;

[0011] (2) Maize genetic breeding and germplasm improvement;

[0012] The present invention also provides a method for detecting corn ear length under low-phosphorus conditions, comprising the steps of sequencing a corn gene and, based on the sequencing results, detecting the genotype of the SNP molecular marker described herein. When the haplotype consisting of the SNP markers at positions 209022198 bp and 209022765 bp on chromosome 5 is TG, the corn has a longer ear length trait. The sequencing methods include, but are not limited to, whole-genome resequencing, targeted sequencing, or multiplex PCR sequencing.

[0013] The present invention also provides a breeding method for increasing corn ear length under low-phosphorus conditions, comprising the following steps: performing genotype detection on the above-mentioned SNP markers in corn samples, and selecting corn samples with TG haplotypes for breeding.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The SNP molecular marker significantly associated with corn ear length disclosed in the present invention can be used in molecular-assisted breeding for corn ear length. Through molecular breeding, the corn ear length trait can be screened out and long-eared corn varieties can be cultivated, thereby increasing corn yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a violin plot of the ear length phenotype corresponding to the haplotype formed by the combination of two SNPs in the present invention. Among them, the difference between H001 and H002 is extremely significant (****, P-value < 0.0001).

[0017] Figure 2 This is a linkage diagram of the two SNPs in the present invention. SNP-209022198 and SNP-209022765 are strongly linked.

[0018] Figure 3 This is the Manhattan plot of the significant SNP sites on chromosome 5 obtained by GWAS using the MLM model.

[0019] Figure 4 This is the QQ plot of GWAS using the MLM model.

[0020] Figure 5 This is a diagram of the genotyping results performed by KASP. DETAILED DESCRIPTION

[0021] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0022] Example 1

[0023] 1. Phenotypic determination

[0024] In 2019 and 2021, 359 maize inbred lines, including 239 temperate and 120 tropical / subtropical inbred lines, were planted in high- and low-phosphorus plots at the Shangzhuang Experimental Station of China Agricultural University. In 2019, soil available phosphorus concentrations were 2.10 mg / kg in low-phosphorus plots and 4.50 mg / kg in normal-phosphorus plots. In 2021, available phosphorus concentrations were 2.72 mg / kg in low-phosphorus plots and 4.67 mg / kg in normal-phosphorus plots. Ear length (EL) phenotypes were measured under normal- and low-phosphorus conditions, and secondary indices were constructed based on the best linear unbiased prediction (BLUP) values ​​for each trait:

[0025] LPTI = BLUP under low phosphorus stress / BLUP under normal phosphorus

[0026] 2. Genome-wide association analysis

[0027] 359 maize inbred lines were sequenced by a sequencing company. PLINK software was used to perform quality control on 980K high-density SNP markers (MAF>5%; missing rate<20%), and PLINK was used to calculate the number of independent markers, window size, step size, and r. 2 The parameters were set to 50, 50, and 0.2, respectively, and 128,197 independent markers were obtained. PCA analysis was performed using TASSEL software to prevent population stratification. The marker data were then associated with the constructed secondary indicators using a mixed linear model (MLM). The significance threshold was set to -logP-value>4, and two significant SNP sites in the present invention, SNP-209022198 and SNP-209022765, were obtained (see the specific results for details). Figure 2 ).

[0028] Haplotype construction was performed using the geneHapR package in R studio software. Four haplotypes consisting of two loci were obtained. Haplotypes with sample numbers <15 were removed, and the remaining two haplotypes were plotted using the ggplot package to plot the violin plot of the LPTI index of spike length (see the specific results for details). Figure 1 ), the results showed that the ear length of maize under low-phosphorus conditions was significantly different between the haplotype H001 and the haplotype H002 (****, P-value<0.0001), that is, maize with the H001 haplotype had a longer ear length under low-phosphorus conditions.

[0029] Table 1 shows the haplotypes formed by the combination of two SNPs in the present invention and their numbers in the GWAS population

[0030] -------- 209022198 209022765 COUNT ALLELE T / C G / A H001 T G 300 H002 C A 50

[0031] Example 2

[0032] Primer design

[0033] The maize reference genome Zm-B73-REFERENCE-NAM-5.0 contains SNPs at 209022198bp and 209022765bp on chromosome 5. The polymorphisms are T / C and G / A, respectively. Primers were designed from the 100bp flanking sequences surrounding each locus. Each primer set consists of three primers: two specific forward primers with FAM and HEX fluorescent linker sequences attached to their 5' ends, respectively, and a universal reverse primer. Primers were synthesized by Qingke Biotechnology and purified by UltraPAGE. The sequences of primer set 1 are as follows (5' to 3'):

[0034] SEQ ID NO.1 (SNP1-F1):

[0035] GAAGGTGACCAAGTTCATGCT GCTGGTTTGTTGTGGGAACATGT T;

[0036] SEQ ID NO.2 (SNP1-F2):

[0037] GAAGGTCGGAGTCAACGGATT CTGGTTTGTTGTGGGAACATGT C;

[0038] SEQ ID NO.3 (SNP1-R):

[0039] AGAGCTTCAGATTACAAGCAAAGCAAAG

[0040] The uppercase bases on the left of SEQ ID NO. 1 and 2 are tag sequences.

[0041] PCR was performed on the extracted DNA using specific primers of SEQ ID NO. 1-3. If only FAM fluorescence signal was detected in the PCR product, the detection site base was TT; if HEX fluorescence signal was detected, the detection site base was CC; if both FAM and HEX fluorescence signals were detected, the detection site base was TC, and the test material was a heterozygous genotype.

[0042] The sequences of primer set 2 are as follows (5' to 3'):

[0043] SEQ ID NO.4 (SNP2-F1):

[0044] GAAGGTGACCAAGTTCATGCT GTAACTTCTGGCTTGTTCTTGAGG A;

[0045] SEQ ID NO.5 (SNP2-F2):

[0046] GAAGGTCGGAGTCAACGGATT GTAACTTCTGGCTTGTTCTTGAGG G;

[0047] SEQ ID NO.6 (SNP2-R):

[0048] TGCACAATTTCAGTCGGTAGAAAGTGAGT;

[0049] Among them, the uppercase bases on the left of SEQ ID NO. 4 and 5 are tag sequences.

[0050] PCR was performed on the extracted DNA using specific primers of SEQ ID NO. 4-6. If only FAM fluorescence signal was detected in the PCR product, the detection site base was AA; if HEX fluorescence signal was detected, the detection site base was GG; if both FAM and HEX fluorescence signals were detected, the detection site base was AG, and the test material was a heterozygous genotype.

[0051] Example 3

[0052] 1. Extract DNA using Magen's plant DNA extraction kit

[0053] (1) 20 corn materials were selected for seedling in a greenhouse. 30 mg of leaves were placed in a 2 ml EP tube and magnetic beads were placed in the tube.

[0054] (2) Mark the tube cap and place it in a centrifuge tube plate. Use liquid nitrogen to quickly freeze the leaves, and then place the frozen sample in a grinder for grinding.

[0055] (3) Add 700 μl of Buffer PAL preheated to 65°C to each tube and mix thoroughly using a vortex machine. After mixing, place the sample in a 65°C water bath for 30 minutes, mixing 2-3 times during the water bath.

[0056] (4) Add 700 μl of Buffer BDP to each tube and vortex to mix thoroughly. Centrifuge at 12,000 × g for 5 minutes at room temperature.

[0057] (5) Transfer 600 μl of supernatant to a new centrifuge tube, add 600 μl of Buffer GWP, and mix by inverting 6-8 times.

[0058] (6) Place the purification column in a collection tube and transfer the mixture to the purification column twice. Centrifuge at 10,000 × g for 1 minute after each transfer. Discard the filtrate, add 400 μl of Buffer GWP to the column, and centrifuge at 10,000 × g for 1 minute.

[0059] (7) Discard the filtrate, add 750 μl of Buffer SW2 to the column, and centrifuge at 10,000 × g for 1 minute. Discard the filtrate, and centrifuge again at 10,000 × g for 1 minute.

[0060] (8) Transfer the column to a new 1.5 ml centrifuge tube, add Elution Buffer preheated to 65°C to the column, let it stand at room temperature for 3 minutes, and centrifuge at 10,000 × g for 1 minute.

[0061] (9) Discard the binding column, detect the DNA concentration, and dilute the concentration to 10 ng / μl for subsequent experiments.

[0062] 2. KASP experiment

[0063] The KASP experiment used FLU-ARMS for KASP 2×PCRMixV5F produced by Guangzhou Good Biotechnology Co., Ltd. and included the following steps:

[0064] (1) Prepare PCR reaction solution on ice:

[0065] Add components Dosage (10μl system) DNA samples 4.5 μl FLU-ARMS2×PCRMix 5μl Forward specific primer F1 (10 μM) 0.1μL Forward specific primer F2 (10 μM) 0.1μL Reverse universal primer R (10 μM) 0.3μL Refill to 10 μL

[0066] (2) PCR reaction conditions:

[0067]

[0068] The KASP reaction products were read using a BIORAD CFX96 fluorescence quantitative PCR instrument, and the fluorescence scanning results were automatically converted into graphics.

[0069] The results of marker typing are as follows Figure 5 As shown in Table 2, "○" represents the genotype showing FAM fluorescence, "◇" represents the genotype showing HEX fluorescence, and "×" represents the NTC control. The ear lengths of the test materials are shown in Table 2, and the results are in line with expectations.

[0070] Table 2 KASP typing of 20 randomly selected genotypes and their spike length under low-P and normal-P conditions

[0071]

[0072]

[0073] The results show that the two SNP molecular markers provided by the present invention can accurately detect the length of corn ears under low-phosphorus conditions. It is only necessary to detect the haplotype composed of the SNP markers and select corn samples with TG haplotypes for breeding, so as to quickly select corn varieties with longer ear length traits under low-phosphorus conditions.

[0074] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should fall within the scope of protection of the present invention.

Claims

1. Application of a SNP molecular marker for detecting ear length in maize under low phosphorus conditions; The SNP molecular markers include SNP-209022198 and SNP-209022765 located on chromosome 5 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome; SNP-209022198 is located at 209022198bp on chromosome 5 of the maize genome, and the variation type is T / C; SNP-209022765 is located at 209022765bp on chromosome 5 of the maize genome, and the variation type is G / A.

2. A breeding method for increasing corn ear length under low phosphorus conditions, characterized in that: The method comprises the following steps: performing genotype detection on the SNP marker according to claim 1 in corn materials, and selecting corn materials with TG haplotype for breeding.

Images