Bovine parvovirus type I and type II RPA (recombinase polymerase amplification) detection kit and detection method thereof

Abstract

The invention belongs to the technical field of in-vitro detection, and particularly relates to a bovine parvovirus type I and type II RPA (recombinase polymerase amplification) detection kit and a detection method thereof. The kit provided by the invention comprises a dual RPA reaction system and RPA Basic freeze-dried powder containing recombinase. The dual RPA reaction system comprises a DNA (Deoxyribose Nucleic Acid) template of the virus, an upstream primer pair, a downstream primer pair, a Rehydration Buffer and magnesium acetate tetrahydrate. The kit reacts for 20 minutes at the temperature of 45 DEG C, and an obtained product is subjected to agarose electrophoresis detection. According to the invention, the upstream primer, the downstream primer and the reaction time are screened, so that the bovine parvovirus type I and the bovine parvovirus type II are simultaneously detected, and the problems of long time consumption, high detection limit and dependence on professional equipment and professionals in bovine parvovirus detection are solved. The invention provides an efficient and accurate solution for large-scale bovine parvovirus screening, and has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of in vitro detection, and specifically relates to a bovine parvovirus type I and type II RPA detection kit and a detection method thereof. Background Art

[0002] Bovine parvovirus disease is an infectious disease of respiratory and reproductive dysfunction in adult cattle caused by infection with bovine parvovirus (BPV). It is very easy to be mixed with bovine viral diarrhea virus (BVDV), bovine rotavirus (BRV), bovine coronavirus (BCoV), bovine herpes virus type I (BoHV-1), etc. BPV can be transmitted through multiple routes. The initial clinical symptoms of infection are not obvious, so diagnosis and prevention become very difficult. BPV is mainly transmitted vertically through the placenta, causing spontaneous abortion and fetal infection in pregnant cows, and causing stillbirth in severe cases. When infected, newborn calves will cause respiratory and digestive tract symptoms such as coughing, enteritis, diarrhea, and red bloody stools in severe cases. The global incidence of BPV infection is about 83% to 100%, causing serious economic losses to the cattle industry.

[0003] Bovine parvovirus is a member of the Parvoviridae family and the Copiparvovirus genus. It is a single-stranded linear non-enveloped DNA virus. The gene is about 5.5 kb in length and contains three open reading frames (ORFs): ORF1, ORF2 and ORF3, which encode non-structural protein NS1, nuclear phosphoprotein NP1 and viral capsid protein VP1 / VP2, respectively. The VP2 protein encoded by ORF3 is the main capsid protein for assembling infectious virus particles, which is involved in receptor attachment, antigenicity and pathogenicity and is highly conserved. Therefore, the VP2 gene is often used to design primers to detect the virus or specify subgenotypes. Bovine parvovirus was first discovered in diarrheal calves in the 1960s. In 1961, Abinanti et al. isolated the first bovine parvovirus from the feces of healthy calves. In 1973, Inaba isolated another bovine parvovirus from Japan that was different from HADEN, so the former was subsequently called BPV-1 and the latter was called BPV-2.

[0004] Currently, the commonly used diagnostic methods for bovine parvovirus infection are mainly based on virus isolation, serological diagnosis, electron microscopy, etiology and molecular methods. Virus isolation is a traditional virus diagnosis method, but the detection rate is low and it takes a long time. Electron microscopy is more intuitive, but in certain specific areas, it is not suitable for on-site use in farms because it requires special equipment and professional personnel to operate, and has great limitations.

[0005] Recombinase polymerase amplification (RPA) technology uses a constant temperature amplification reaction to open the template chain through the recombinase UvsX, rather than high temperature denaturation as in conventional PCR. It can amplify the target nucleic acid in the shortest time and can be used for rapid on-site identification.

[0006] There is no existing method for detecting bovine parvovirus infection using RPA technology, especially for BPV-1 and BPV-2. Therefore, it is very important to establish a fast, simple method that does not require professional equipment and technicians for detecting bovine parvovirus. Summary of the invention

[0007] In view of the defects of the prior art, the present invention provides a bovine parvovirus type I and type II RPA detection kit and a detection method thereof, aiming to quickly and easily detect bovine parvovirus.

[0008] The present invention provides a primer combination for detecting bovine parvovirus, wherein the primer combination comprises at least one of the following combinations:

[0009] The nucleotide sequence of the upstream primer is SEQ ID NO.1, and the nucleotide sequence of the downstream primer is SEQ ID NO.3;

[0010] Or, the nucleotide sequence of the upstream primer is SEQ ID NO.5, and the nucleotide sequence of the downstream primer is SEQ ID NO.7;

[0011] Or, the nucleotide sequence of the upstream primer is SEQ ID NO.6, and the nucleotide sequence of the downstream primer is SEQ ID NO.8.

[0012] The present invention provides a bovine parvovirus detection reagent, which includes an RPA reaction system;

[0013] The RPA reaction system includes the following components:

[0014] Template 100~140ng,

[0015] Upstream primer 0.22~0.48μM,

[0016] Downstream primer 0.22~0.48μM,

[0017] Rehydration Buffer 14%~60% V / V,

[0018] Magnesium acetate tetrahydrate 2.8~16.8mmol / L;

[0019] The primer combination includes at least one of the following combinations:

[0020] The nucleotide sequence of the upstream primer is SEQ ID NO.1, and the nucleotide sequence of the downstream primer is SEQ ID NO.3;

[0021] Or, the nucleotide sequence of the upstream primer is SEQ ID NO.5, and the nucleotide sequence of the downstream primer is SEQ ID NO.7;

[0022] Or, the nucleotide sequence of the upstream primer is SEQ ID NO.6, and the nucleotide sequence of the downstream primer is SEQ ID NO.8.

[0023] Preferably, the nucleotide sequence of the upstream primer is SEQ ID NO.1, and the nucleotide sequence of the downstream primer is SEQ ID NO.3;

[0024] And / or, the nucleotide sequence of the upstream primer is SEQ ID NO.6, and the nucleotide sequence of the downstream primer is SEQ ID NO.8.

[0025] Use of the above-mentioned bovine parvovirus detection primer combination and the above-mentioned detection reagent in preparing a bovine parvovirus detection kit.

[0026] The present invention also provides a bovine parvovirus detection kit, which comprises: RPA Basic freeze-dried powder containing recombinase and the above-mentioned detection reagent; the recombinase comprises UvsX.

[0027] The present invention also provides a method for detecting bovine parvovirus for non-diagnostic purposes using the bovine parvovirus detection kit, which comprises the following steps:

[0028] Step 1, taking a biological sample, extracting DNA as a template, and adding a bovine parvovirus detection reagent;

[0029] Step 2, mixing the bovine parvovirus detection reagent with the RPA Basic lyophilized powder containing the recombinase;

[0030] Step 3, reacting at 40-45° C. for 10-30 minutes to obtain a product;

[0031] Step 4: The product is tested by nucleic acid electrophoresis.

[0032] Preferably, the reaction time in step 2 is 20 minutes.

[0033] Preferably, the biological sample is animal feces;

[0034] Preferably, the nucleic acid electrophoresis is agarose gel electrophoresis, wherein the mass / volume percentage of agarose is 1-2%;

[0035] Preferably, the method for determining the nucleic acid electrophoresis detection result includes the following:

[0036] If the electrophoresis result shows a band of 400-550bp, the biological sample contains bovine parvovirus type I; if the electrophoresis result shows a band of 100-300bp, the biological sample contains bovine parvovirus type II; if the electrophoresis result shows both bands of 400-550bp and 100-300bp, the biological sample contains both bovine parvovirus type I and bovine parvovirus type II.

[0037] The kit of the present invention includes a dual RPA reaction system and RPA Basic lyophilized powder containing recombinase. The dual RPA reaction system includes a viral DNA template, an upstream and downstream primer pair, a Rehydration Buffer and magnesium acetate tetrahydrate. The kit reacts at 45°C for 20 minutes, and the obtained product is detected by agarose electrophoresis. The present invention screens the upstream and downstream primers and reaction time, realizes the simultaneous detection of bovine parvovirus type I and bovine parvovirus type II, solves the problems of long time consumption, high detection limit and dependence on professional equipment and professionals in bovine parvovirus detection, and is more suitable for on-site detection at farms. The present invention provides an efficient and accurate solution for large-scale screening of bovine parvovirus, and has a good application prospect. The present invention has the following advantages:

[0038] (1) The method for detecting bovine parvovirus type I and bovine parvovirus type II of the present invention is simple to operate, does not require expensive and complex instruments and equipment, and does not require a lengthy reaction system, and can be used for rapid detection at the sample collection site or in the laboratory.

[0039] (2) The present invention can simultaneously detect two pathogens, bovine parvovirus type I and bovine parvovirus type II, in one reaction system, significantly shortening the time for bovine parvovirus disease detection, improving detection efficiency and saving costs, and has good application prospects.

[0040] (3) The RPA detection primer set of the present invention is designed for the conserved sequences of bovine parvovirus type I and bovine parvovirus type II. The primer set was used to detect bovine viral diarrhea virus (BVDV), bovine coronavirus (BcoV), bovine herpesvirus type I (BoHV1), and bovine rotavirus (BRV), but no bands were amplified, indicating that the primers designed by the present invention have strong specificity.

[0041] (4) The present invention has a high sensitivity for detecting bovine parvovirus type I and bovine parvovirus type II, which can be as high as 1×10 - 3 ng / μL.

[0042] (5) The detection results of the present invention are consistent with the results of nucleic acid gel electrophoresis interpretation. By screening RPA primers and optimizing the RPA reaction system, the stability of the detection results is improved, and the electrophoresis bands of two virus amplification products can be obtained at the same time, which solves the problem of insufficient stability of the RPA detection method and can effectively control the detection error.

[0043] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0044] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 The figure shows the electrophoresis results of detecting BPVⅠ with different primer pairs; Lane M represents the molecular weight DL2000Plus Marker, Lane 1 represents the amplification product using primers F1-R1, with a target fragment of 472bp, Lane 2 represents the amplification product using primers F2-R2, with a target fragment of 202bp, and Lane 3 represents the amplification product obtained using ddH2O as a template, which is a negative control.

[0046] Figure 2 The figure is the electrophoresis result of detecting BPVⅡ by different primer pairs of the present invention; Lane M represents the molecular weight DL2000PlusMarker, Lane 1 represents the amplification product using primers F3-R3, and the target fragment is 523bp, Lane 2 represents the amplification product using primers F4-R4, and the target fragment is 156bp, and Lane 3 represents the amplification product obtained by using ddH2O as a template, which is a negative control.

[0047] Figure 3 It is the electrophoresis diagram of the amplification products of the double RPA reaction system; Lane M represents the molecular weight DL2000PlusMarker, Lane 1 represents the BPVⅠ amplification product with a target fragment of 472bp, Lane 2 represents the BPVⅡ amplification product with a target fragment of 156bp, and Lane 3 represents the amplification product obtained using ddH2O as a template, which is a negative control.

[0048] Figure 4The figure shows the electrophoresis results of detecting BPVⅠ and BPVⅡ at different amplification reaction times; Lane M represents the molecular weight DL2000Plus Marker, Lane 1 represents the amplification product of 10 min amplification, Lane 2 represents the amplification product of 20 min amplification, Lane 3 represents the amplification product of 30 min amplification, Lane 4 represents the amplification product of 40 min amplification, Lane 5 represents the amplification product of 50 min amplification, and Lane 6 represents the amplification product obtained using ddH2O as a template, which is a negative control.

[0049] Figure 5 It is an electrophoresis diagram of the detection results of the specificity test; lane M represents the molecular weight DL2000Plus Marker, lane 1 represents the amplification product using BPVⅠ as a template, lane 2 represents the amplification product using BPVⅡ as a template, lane 3 represents the amplification product using BVDV as a template, lane 4 represents the amplification product using BcoV as a template, lane 5 represents the amplification product using BoHV1 as a template, lane 6 represents the amplification product using BRV as a template, and lane 7 represents the amplification product obtained using ddH2O as a template, which is a negative control.

[0050] Figure 6 The electrophoresis diagram of the detection results of the sensitivity test; Lane M represents the molecular weight DL2000Plus Marker, Lane 1 represents the amplification product with 115.4ng / μL BPVⅠ and 131.45ng / μL BPVⅡ as templates, Lane 2 represents the amplification product with 11.54ng / μL BPVⅠ and 13.14ng / μL BPVⅡ as templates, Lane 3 represents the amplification product with 1.15ng / μL BPVⅠ and 1.31ng / μL BPVⅡ as templates, Lane 4 represents the amplification product with 1.15×10 －1 ng / μL BPVⅠ, 1.31×10 －1 ng / μL BPVⅡ as the template amplification product, lane 5 represents 1.15×10 －2 ng / μL BPVⅠ, 1.31×10 －2 ng / μL BPVⅡ as the template amplification product, lane 6 represents 1.15×10 －3 ng / μL BPVⅠ, 1.31×10 －3 Lane 7 represents the amplification product using ddH2O as template, and lane 8 represents the amplification product using ddH2O as template, which is a negative control. DETAILED DESCRIPTION

[0051] In the following examples and experimental examples, reagents and materials not particularly described are all commercially available.

[0052] The RPA Basic lyophilized powder containing the recombinant enzyme, Rehydration Buffer, and MgOAc (magnesium acetate tetrahydrate) are all from the commercially available RPA TwistAmp Basic Kit

[0053] Example 1 Bovine Parvovirus Type I and Bovine Parvovirus Type II Dual RPA Detection Kit

[0054] 1. Kit Composition

[0055] The kit of this embodiment mainly includes a dual RPA reaction system and RPA Basic lyophilized powder (containing recombinant enzyme). The composition of the dual RPA reaction system is shown in the following table:

[0056] Table 1 Reaction system of dual RPA

[0057]

[0058] In other embodiments, the volume of the template in Table 1 can be adjusted within the range of 0.5 to 2 μL; the initial concentrations of the upstream and downstream primers of BPVⅠ and BPVⅡ can be 20 μM; the volumes of the upstream and downstream primers of BPVⅠ can be adjusted within the range of 1.1 to 1.2 μL, respectively, and the volumes of the upstream and downstream primers of BPVⅡ can be adjusted within the range of 1.0 to 1.2 μL, respectively; the volume of MgOAc can be 0.5 μL;

[0059] The volume of Rehydration Buffer can be adjusted between 7 and 30 μL, and the volume of ddH2O can be adjusted between 9.8 and 37.4 μL. During the volume adjustment process, the total volume should remain unchanged at 50 μL.

[0060] The template is derived from the DNA of fecal samples. The DNA is extracted from the fecal samples using the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit, and the obtained DNA is used as a template.

[0061] The primer sequences for BPVⅠ and BPVⅡ are shown in the following table:

[0062] Table 2 Upstream and downstream primer sequences of BPVⅠ and BPVⅡ

[0063] name Serial Number Nucleotide sequence 5'-3' BPVⅠ upstream primer F1 SEQ ID NO.1 GGGGAAACGGCAGGCAGGTGGTC BPVⅠ downstream primer R1 SEQ ID NO.3 CCGACATACCTGTGTTTTGGAAGAG BPVⅡ upstream primer F4 SEQ ID NO.6 TGTGGTCACTAAAAACACTCGCC BPVⅡ downstream primer R4 SEQ ID NO.8 GAATCGTTCGTAGTCATTTACCAGG

[0064] 2. Detection Method

[0065] Add a tube of RPA Basic freeze-dried powder (containing recombinase) to the prepared 50 μL double RPA reaction system, amplify at 45°C for 20 minutes, terminate the reaction on ice, and obtain the RPA amplification product. The RPA amplification product was detected by 1.5% agarose gel electrophoresis.

[0066] Example 2 Bovine Parvovirus Type I and Bovine Parvovirus Type II Dual RPA Detection Kit

[0067] The method of Example 1 is followed, except that the BPVⅡ upstream primer is BPVⅡ upstream primer F3, whose nucleic acid sequence is SEQ ID NO.5; the BPVⅡ downstream primer is BPVⅡ downstream primer R3, whose nucleic acid sequence is SEQ ID NO.7.

[0068] The technical solution of the present invention is further illustrated by experiments below.

[0069] Experimental Example 1 Primer Screening for Dual RPA Detection of Bovine Parvovirus Type I and Bovine Parvovirus Type II This experimental example provides primer design and primer screening methods and results.

[0070] 1. Dual RPA primer set design

[0071] Refer to the bovine parvovirus I (BPV I) and bovine parvovirus II registered in Gene Bank

[0072] The full gene sequence of BPVⅡ was compared using DNAMAN, and the highly conserved gene sequence candidate regions were selected as the detection target genes for each virus; the VP genes of BPVⅠ and BPVⅠⅠ were determined as target genes. According to the RPA primer design principles, Primer 5.0 software was used to design 2 pairs of specific primers for detecting BPVI and 2 pairs of specific primers for detecting BPVⅡ, and BLAST comparison was performed in NCBI to verify the primer specificity. Among them, in order to achieve specific amplification of template DNA and improve the efficiency of primer screening, in addition to the general primer design requirements, the RPA primer design principles used also include:

[0073] A. Primer length is between 30 and 35 bp;

[0074] B. The TM value of the primer is not used as a reference, but the GC content should be between 40% and 60%;

[0075] C. Primers do not have hairpin structures to avoid dimers and mismatches;

[0076] D. The 5' end of the primer should not contain three consecutive guanines or cytosines, and the 3' end should contain cytosine or guanine;

[0077] E. Avoid special structures in primers, such as hairpin structures, palindromic sequences, long strings of polypurines and polypyrimidines, etc.

[0078] The selected primers were sent to Jinweizhi Biotechnology Co., Ltd. for synthesis. The upstream and downstream primer sequences are shown in the following table:

[0079] Table 3 Upstream and downstream primer sequences of BPVⅠ and BPVⅡ

[0080] name Serial Number Nucleotide sequence 5'-3' BPVⅠ upstream primer F1 SEQ ID NO.1 GGGGAAACGGCAGGCAGGTGGTC BPVⅠ upstream primer F2 SEQ ID NO.2 CGGCAGGTGGTCCTTTGAAT BPVⅠ downstream primer R1 SEQ ID NO.3 CCGACATACCTGTGTTTTGGAAGAG BPVⅠ downstream primer R2 SEQ ID NO.4 CCTTGTTTCTGTTCTGGAGGTATCT BPVⅡ upstream primer F3 SEQ ID NO.5 GACCATTTTTAGCGAAAACATTGT BPVⅡ upstream primer F4 SEQ ID NO.6 TGTGGTCACTAAAAACACTCGCC BPVⅡ downstream primer R3 SEQ ID NO.7 GTTGTTGTCTACGACTGAGATTGGA BPVⅡ downstream primer R4 SEQ ID NO.8 GAATCGTTCGTAGTCATTTACCAGG

[0081] 2. Template construction

[0082] The fecal samples of cattle (from Henan University of Science and Technology) were taken and DNA was extracted using TaKaRa MiniBEST Viral RNA / DNAExtraction Kit to obtain the DNA templates corresponding to the samples to be tested, as shown in the following table. The DNA of BPVⅠ and BPVⅡ was used as templates for subsequent experiments.

[0083] Table 4 DNA template sequences of BPVⅠ and BPVⅡ

[0084]

[0085]

[0086]

[0087] 3. RPA response system

[0088] The 50 μL reaction system is shown in the following table: the upstream and downstream primer sequences of BPVⅠ and BPVⅡ are respectively placed in the reaction system.

[0089] Table 5 RPA reaction system

[0090]

[0091] 4. RPA constant temperature amplification reaction

[0092] Add a tube of RPABasic freeze-dried powder (containing recombinase) to the prepared 50 μL RPA reaction system, amplify at 45°C for 30 minutes, terminate the reaction on ice, and obtain the RPA amplification product. The RPA amplification product was detected by 1.5% agarose gel electrophoresis.

[0093] 5. Filter results

[0094] The results of BPVⅠ primer screening are as follows Figure 1As shown in the figure, the primer pair F2-R2 did not amplify the target band and could not be used for subsequent experiments. Therefore, the primer pair F1-R1 was selected for subsequent experiments for BPVI. Figure 2 As shown in the figure, primer pairs F3-R3 and F4-R4 amplified specific bands, but the band of F4-R4 was brighter, indicating that the amplification stability and product content were higher under primer F4-R4. Therefore, primer pair F4-R4 was selected for subsequent experiments for BPVⅡ.

[0095] The above results show that primer pair F1-R1 is the preferred primer for BPVI detection; primer pair F4-R4 is the preferred primer for BPVⅡ detection.

[0096] Experimental Example 2 Establishment of a dual RPA detection method for bovine parvovirus type I and bovine parvovirus type II This experimental example provides a dual RPA detection method for BPVⅠ and BPVⅡ.

[0097] 1. The DNA templates of BPVⅠ and BPVⅡ were mixed, and the primer set (F1-R1, F4-R4) screened in Experimental Example 1 was used for RPA isothermal amplification reaction.

[0098] (1) The reaction system of dual RPA is shown in the following table.

[0099] Table 6 Reaction system of dual RPA

[0100]

[0101] (2) Add 50 μL of the prepared dual RPA reaction system to a tube of RPABasic lyophilized powder (containing recombinase), amplify at 45°C for 30 min, terminate the reaction on ice, and obtain the RPA amplification product.

[0102] 2. Method Validation

[0103] The RPA amplification product was detected by 1.5% agarose gel electrophoresis. Figure 3 As shown, the dual RPA reaction system successfully amplified BPVⅠ with a size of 472bp and BPVⅡ with a size of 156bp. The results showed that 50μL dual RPA reaction system amplified at 45℃ for 30min to obtain the amplified products of BPVⅠ and BPVⅡ.

[0104] 3. Screening experiment of amplification time

[0105] Using the dual RPA reaction system in Table 6, the amplification reaction time was set to: 10 min, 20 min, 30 min, 40 min, 50 min, and RPA amplification was performed at the determined optimal reaction temperature of 45°C. After the amplification, the amplified product was detected by 1.5% agarose gel electrophoresis.

[0106] The detection results of amplification products under different amplification reaction times are as follows Figure 4 As shown, within 30 minutes, the band gradually becomes brighter with time, and the band becomes darker after more than 30 minutes. In addition, there is little difference in the brightness of the bands at 20 minutes and 30 minutes. Therefore, the optimal amplification reaction time is determined to be 20 minutes.

[0107] The above results show that a 50 μL dual RPA reaction system amplified at 45°C for 20 min is a fast and efficient method to obtain the amplification products of BPVⅠ and BPVⅡ.

[0108] Experimental Example 3 Performance Verification of Dual RPA Detection of Bovine Parvovirus Type I and Bovine Parvovirus Type II The reaction system and reaction conditions of the dual RPA used in this experimental example are as described in Example 1.

[0109] 1. Specificity test

[0110] 1. Methods

[0111] Bovine parvovirus type Ⅰ (BPVⅠ), bovine parvovirus type Ⅱ (BPVⅡ), bovine herpes virus type Ⅰ (BoHV1, AF202064.1), bovine viral diarrhea virus (BVDV, MW054933.1), bovine rotavirus (BRV, J04346.1), bovine coronavirus (BCoV, LC830477.1) gene fragments were used as templates, and ddH2O was used as a negative control to add the RPA reaction system in Table 1. 50 μL of the prepared dual RPA reaction system was added to a tube of RPA Basic lyophilized powder, amplified at 45°C for 20 minutes, and the reaction was terminated on ice to obtain the RPA amplification product, which was detected by 1.5% agarose gel electrophoresis.

[0112] 2. Results

[0113] The electrophoresis results are as follows Figure 5 As shown: The method of this experimental example can quickly and accurately detect BPVⅠ and BPVⅡ without non-specific amplification of the other 6 pathogens, indicating that the method of this experimental example has high specificity and good versatility.

[0114] 2. Sensitivity test

[0115] 1. Methods

[0116] In order to check the sensitivity of the dual RPA detection method established for bovine parvovirus type I and bovine parvovirus type II of the present invention, the extracted DNA template was used, and 115.4ng / μL BPVⅠ and 131.5ng / μL BPVⅡ were used as the mother solution, which was diluted 10 times as a template and added to the RPA reaction system in Table 6, wherein the upstream primer and the downstream primer used the primer set (F1-R1, F4-R4) screened in Experimental Example 1. The prepared 50μL dual RPA reaction system was added to a tube of RPA Basic lyophilized powder, amplified at 45℃ for 20min, and the reaction was terminated on ice to obtain the RPA amplification product, which was detected by 1.5% agarose gel electrophoresis.

[0117] 2. Results

[0118] The electrophoresis results are as follows Figure 6 As shown: The minimum detection limit of the method in this experimental example is 1×10 -3 ng / μL, indicating a high sensitivity.

[0119] 3. Clinical Sample Testing

[0120] 1. Methods

[0121] In order to check the detection effect of the dual RPA detection method of bovine parvovirus I and bovine parvovirus II established by the present invention on clinical samples, in July 2023, 80 different cattle feces samples were randomly collected in Xinjiang, and TaKaRaMiniBEST Viral RNA / DNA Extraction Kit was used to extract DNA. The obtained DNA was used as a template, and ddH2O was used as a negative control. The RPA reaction system in Table 4 was added, wherein the upstream primer and the downstream primer used the primer set (F1-R1, F4-R4) screened in Experimental Example 1. Add the prepared 50μL dual RPA reaction system to a tube of RPA Basic lyophilized powder, amplify at 45℃ for 20min, terminate the reaction on ice, obtain the RPA amplification product, and perform 1.5% agarose gel electrophoresis on the amplification product. At the same time, the BPVⅠ and BPVⅡ detection methods based on PCR technology were used for detection.

[0122] Interpretation of RPA amplification product detection results: After agarose gel electrophoresis detection, if a 472bp band appears in the test results, individuals infected with bovine parvovirus type 1 are present in the test sample; if a 156bp band appears, individuals infected with bovine parvovirus type 2 are present in the test sample; if both 472bp and 156bp bands appear at the same time, individuals infected with both bovine parvovirus type 1 and bovine parvovirus type 2 are present in the fecal sample to be tested; if no band appears, individuals infected with both bovine parvovirus type 1 and bovine parvovirus type 2 are not present in the fecal sample to be tested.

[0123] 2. Results

[0124] The test results are shown in Table 7: The results of the dual RPA detection method established by the present invention are consistent with those of the existing PCR detection method, indicating that the dual RPA detection method of the present invention can be used for the actual detection of BPVⅠ and BPVⅡ, and since no complex instruments and equipment are required, the reaction time is shorter and it is more suitable for on-site detection in farms.

[0125] Table 7 Results of testing bovine serum samples using different methods

[0126]

[0127] The above results show that the dual RPA detection method established in the present invention has high specificity and high sensitivity, and can meet the needs of practical applications.

[0128] It can be seen from the above embodiments and experimental examples that the kit of the present invention includes a dual RPA reaction system and RPA Basic lyophilized powder containing recombinase. The dual RPA reaction system includes a viral DNA template, an upstream and downstream primer pair, a Rehydration Buffer and magnesium acetate tetrahydrate. The kit is reacted at 45°C for 20 minutes, and the obtained product is detected by agarose electrophoresis. The present invention screens the upstream and downstream primers and reaction times, realizes the simultaneous detection of bovine parvovirus type I and bovine parvovirus type II, solves the problems of long time consumption, high detection limit and dependence on professional equipment and professionals in bovine parvovirus detection, and is more suitable for on-site detection in farms. The present invention provides an efficient and accurate solution for large-scale screening of bovine parvovirus, and has a good application prospect.

Claims

1. A primer combination for detecting bovine parvovirus, characterized in that: The primer combination includes at least one of the following combinations: The nucleotide sequence of the upstream primer is SEQ ID NO.1, and the nucleotide sequence of the downstream primer is SEQ ID NO.3; Or, the nucleotide sequence of the upstream primer is SEQ ID NO.5, and the nucleotide sequence of the downstream primer is SEQ ID NO.7; Or, the nucleotide sequence of the upstream primer is SEQ ID NO.6, and the nucleotide sequence of the downstream primer is SEQ ID NO.

8.

2. A bovine parvovirus detection reagent, characterized in that: It includes RPA reaction system; The RPA reaction system includes the following components: Template 100~140ng, Upstream primer 0.22~0.48μM, Downstream primer 0.22~0.48μM, Rehydration Buffer 14%~60%V / V, Magnesium acetate tetrahydrate 2.8~16.8mmol / L; The primer combination includes at least one of the following combinations: The nucleotide sequence of the upstream primer is SEQ ID NO.1, and the nucleotide sequence of the downstream primer is SEQ ID NO.3; Or, the nucleotide sequence of the upstream primer is SEQ ID NO.5, and the nucleotide sequence of the downstream primer is SEQ ID NO.7; Or, the nucleotide sequence of the upstream primer is SEQ ID NO.6, and the nucleotide sequence of the downstream primer is SEQ ID NO.

8.

3. The detection reagent according to claim 2, characterized in that: The nucleotide sequence of the upstream primer is SEQ ID NO.1, and the nucleotide sequence of the downstream primer is SEQ ID NO.3; And / or, the nucleotide sequence of the upstream primer is SEQ ID NO.6, and the nucleotide sequence of the downstream primer is SEQ ID NO.

8.

4. Use of the bovine parvovirus detection primer combination according to claim 1 and the detection reagent according to claim 2 or 3 in the preparation of a bovine parvovirus detection kit.

5. A bovine parvovirus detection kit, characterized in that: include: RPA Basic lyophilized powder containing recombinase and the detection reagent according to claim 2 or 3; the recombinase includes UvsX.

6. A method for detecting bovine parvovirus for non-diagnostic purposes using the bovine parvovirus detection kit according to claim 5, characterized in that: The steps include: Step 1, taking a biological sample, extracting DNA as a template, and adding a bovine parvovirus detection reagent; Step 2, mixing the bovine parvovirus detection reagent with the RPA Basic lyophilized powder containing the recombinase; Step 3, reacting at 40-45° C. for 10-30 minutes to obtain a product; Step 4: The product is tested by nucleic acid electrophoresis.

7. The method for detecting bovine parvovirus for non-diagnostic purposes according to claim 6, characterized in that: The reaction time of step 2 is 20 minutes.

8. The method for detecting bovine parvovirus for non-diagnostic purposes according to claim 6, characterized in that: The biological sample is animal feces.

9. The method for detecting bovine parvovirus for non-diagnostic purposes according to claim 6, characterized in that: The nucleic acid electrophoresis is agarose gel electrophoresis, wherein the mass / volume percentage of agarose is 1-2%.

10. The method for detecting bovine parvovirus for non-diagnostic purposes according to claim 6, characterized in that: The method for determining the nucleic acid electrophoresis detection result includes: the following: If the electrophoresis result shows a band of 400 to 550 bp, the biological sample contains bovine parvovirus type Ⅰ; If the electrophoresis result shows a band of 100 to 300 bp, the biological sample contains bovine parvovirus type II; If the electrophoresis results show two bands of 400-550 bp and 100-300 bp at the same time, the biological sample contains both bovine parvovirus type I and bovine parvovirus type II.

Images