Trans-cinnamic acid-4-hydroxylase mutant for synthesis of p-hydroxycinnamic acid

Abstract

The invention provides a transcinnamic acid-4-hydroxylase mutant, which is characterized in that a transcinnamic acid-4-hydroxylase gene and a P450 reductase gene are introduced into a pET28a vector to construct a fusion expression plasmid pET-28a (+)-C4H-CPR, and the fusion expression plasmid pET-28a (+)-C4H-CPR (T112G / R188P / L340I) is obtained through site-specific mutagenesis. After transcinnamic acid-4-hydroxylase is expressed and fused with P450 reductase, the mutant enzyme efficiently catalyzes trans-cinnamic acid and NADPH (nicotinamide adenine dinucleotide phosphate) to synthesize p-hydroxycinnamic acid. The enzyme activity of the C4H (T112G / R188P / L340I) mutant is improved to 3.6 U / mg from 1.8 U / mg of the enzyme activity of the wild type fusion protein C4H-CPR.

Description

Technical Field

[0001] The invention belongs to the field of photoresist materials, and in particular relates to a trans-cinnamic acid-4-hydroxylase mutant used for synthesizing p-hydroxycinnamic acid. Background Art

[0002] Photoresist, also known as photoresist, refers to a thin film material that changes its solubility when exposed to ultraviolet light, electron beam, ion beam, x-ray, etc. It is a light-sensitive mixed liquid composed of three main components: photosensitive resin, sensitizer and solvent. It is widely used in the processing and production of fine graphic circuits in the optoelectronic information industry and is a key material for micro-processing technology. However, domestic high-end photoresists still rely mainly on imports, and there are few companies that can produce photoresists.

[0003] Poly(p-hydroxystyrene) plays an important role in photoresist technology. P-hydroxystyrene-based polymer photoresist has become a key technology. Developed countries have completely replaced old thermal stability materials with p-hydroxy polyimide to improve the grade of liquid crystal display. P-hydroxycinnamic acid has dominated the foreign liquid crystal display industry. In China, the application of p-hydroxycinnamic acid in the field of photoresist has become the core difficulty of photoresist technology.

[0004] Cinnamate-4-hydroxylase (C4H) is an important monooxygenase that participates in the key step of cinnamic acid metabolism. It catalyzes the hydroxylation reaction of cinnamic acid and converts it into p-hydroxycinnamic acid. However, due to the low activity of trans-cinnamate-4-hydroxylase and its intolerance to high substrate concentrations, its efficiency is not high. It is now necessary to increase the activity of trans-cinnamate-4-hydroxylase, thereby improving the reaction efficiency of p-hydroxycinnamic acid, a key raw material of photoresist resin monomer. Summary of the invention

[0005] The present invention provides a trans-cinnamic acid 4-hydroxylase mutant, wherein the amino acids of the trans-cinnamic acid 4-hydroxylase (C4H) of sunflower (Helianthus annuus L.) are mutated to T112G / R188P / L340I, thereby improving the efficiency of catalytic synthesis of p-hydroxycinnamic acid.

[0006] The invention provides a trans-cinnamic acid 4-hydroxylase and P450 reductase fusion protein. The trans-cinnamic acid 4-hydroxylase and P450 reductase fusion protein is a fusion of trans-cinnamic acid 4-hydroxylase and P450 reductase.

[0007] Furthermore, the trans-cinnamic acid 4-hydroxylase and P450 reductase fusion protein are connected in the middle by the amino acid sequence "GSTSSGSG". The amino acid sequence of the trans-cinnamic acid 4-hydroxylase and P450 reductase fusion protein is shown in SEQ ID NO:5.

[0008] The trans-cinnamate-4-hydroxylase and P450 reductase fusion protein was mutated into a fusion protein C4H-CPR (T112G / R188P / L340I) by site-directed mutagenesis. The amino acid sequence of the mutant C4H-CPR (T112G / R188P / L340I) is shown in SEQ ID NO: 6.

[0009] The invention provides a mutant of a fusion protein of trans-cinnamate-4-hydroxylase and P450 reductase, which is a mutant of the fusion protein of trans-cinnamate-4-hydroxylase and P450 reductase. The mutant of the fusion protein of trans-cinnamate-4-hydroxylase and P450 reductase contains a mutant of trans-cinnamate-4-hydroxylase as shown in SEQ ID NO: 7, and the amino acid sequence of the mutant of the fusion protein of trans-cinnamate-4-hydroxylase and P450 reductase is as shown in SEQ ID NO: 6.

[0010] The invention provides an expression plasmid, which contains a mutant of a fusion protein of trans-cinnamic acid 4-hydroxylase and P450 reductase.

[0011] The trans-cinnamate-4-hydroxylase gene and P450 reductase gene were introduced into the pET28a vector to construct the fusion expression plasmid pET-28a(+)-C4H-CPR, and the site-directed mutagenesis was performed to obtain the fusion expression plasmid pET-28a(+)-C4H-CPR (T112G / R188P / L340I).

[0012] The present invention provides a recombinant engineering bacterium, comprising a fusion expression plasmid pET-28a(+)-C4H-CPR (T112G / R188P / L340I).

[0013] Furthermore, the recombinant engineered bacteria expressed the fusion protein C4H-CPR (T112G / R188P / L340I) mutant.

[0014] The present invention also provides an application of a trans-cinnamic acid-4-hydroxylase mutant for synthesizing p-hydroxycinnamic acid. The fusion protein C4H-CPR (T112G / R188P / L340I) mutant catalyzes the synthesis of p-hydroxycinnamic acid.

[0015] Furthermore, the fusion protein C4H-CPR (T112G / R188P / L340I) mutant catalyzed the synthesis of p-hydroxycinnamic acid from trans-cinnamic acid and NADPH.

[0016] Furthermore, the cultured bacterial cells of the recombinant engineered bacteria are used as whole-cell catalysts.

[0017] The recombinant engineered bacteria were cultured overnight, the supernatant was discarded, and the collected bacterial cells were used as whole cell catalysts. Beneficial Effects

[0018] 1. The present invention provides a mutant of a fusion protein of trans-cinnamate-4-hydroxylase and P450 reductase, wherein the enzyme activity of the mutant is increased from 1.8 U / mg of the wild type to 3.6 U / mg.

[0019] 2. The present invention provides a fusion expression plasmid pET-28a(+)-C4H-CPR (T112G / R188P / L340I), which is used to express the fusion protein C4H-CPR (T112G / R188P / L340I) mutant for the first time.

[0020] 3. The fusion protein C4H-CPR (T112G / R188P / L340I) mutant efficiently catalyzes the synthesis of p-hydroxycinnamic acid from trans-cinnamic acid and NADPH. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Agarose gel electrophoresis of the cinnamate 4-hydroxylase gene fragment amplified from the pET28a(+)-C4H vector.

[0022] Figure 2 Electrophoresis of the P450 reductase gene fragment amplified from the pET28a(+)-C4H vector.

[0023] Figure 3 SDS-PAGE gel electrophoresis of the expression of pET28a(+)-C4H-CPR protein after fusion. DETAILED DESCRIPTION

[0024] In order to make the present invention easy to understand, the present invention will be described in detail below in conjunction with specific embodiments. However, before describing the present invention in detail, it should be understood that the present invention is not limited to the specific embodiments described. It should also be understood that the terms used herein are only for describing specific embodiments and are not intended to be limiting.

[0025] Unless otherwise defined, all terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice of the present invention, preferred methods and materials are now described.

[0026] LB medium: tryptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L.

[0027] TB medium: tryptone 12 g / L, yeast powder 24 g / L, 4 mL glycerol, KH2PO4 2.31 g / L, K2HPO4 12.54 g / L.

[0028] Induction medium: Na2HPO4 31g, KH2PO4 15g, NaCl 2.5g, NH4Cl 5.0g, MgSO4 0.24g, CaCl2 0.01g, Glucose 10g, trace element stock solution 1mL.

[0029] Biotransformation medium: Na2HPO4 31 g, KH2PO4 15 g, NaCl 2.5 g, MgSO4 0.24 g, CaCl2 0.01 g, Glucose 20 g, trace element stock solution 1 mL.

[0030] Trace element mother solution formula: (NH4)6Mo7O 24 0.15mM, H3BO3 20.0mM, CoCl2 1.5mM, CuSO40.5mM, MnCl2 4.0mM, ZnSO4 0.5mM, HCl 100mM.

[0031] PCR amplification reaction system: TAKaRa EX Taq HS 0.25uL, 10 Ex Taq Buffer 5uL, parent plasmid 1uL, dNTP (2.5mM each) 4uL, upstream primer 1uL, downstream primer 1uL, and sterile water to a total volume of 50uL.

[0032] PCR amplification reaction program: 98°C for 2 min; 98°C for 10 s; 50-65°C for 30 s; 72°C for 7 min; 30 cycles; finally 72°C for 10 min.

[0033] Example 1 Preparation of parent plasmid According to the source from sunflower ( Helianthus annuus The amino acid sequence of trans-cinnamate 4-hydroxylase (C4H) of L. (GenBank accession number: XP_021970822.1, the nucleotide sequence is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2) was used to synthesize the required gene fragment, which was ligated into the pET28a vector with BamH I and Hind III restriction sites at both ends, respectively, to obtain a trans-cinnamate 4-hydroxylase (C4H) recombinant plasmid. The obtained recombinant plasmid was then transformed into Escherichia coli Rosetta competent cells DE3, and after kanamycin (Kan, 50 μg / mL) screening, a single colony clone was picked for sequencing. The sequencing verified that the cloned recombinant plasmid pET-28a(+)-C4H was successfully constructed, and the recombinant strain E. coli BL21(DE3)-C4H was obtained.

[0034] Synthesize the Arabidopsis thaliana ( Arabidopsis thaliana ) P450 reductase (CPR) protein sequence, two restriction sites of BamH I and Hind III and their protective base sequences were set at both ends, and connected to the pET28a vector to obtain the recombinant P450 reductase plasmid pET-28a(+)-CPR. The obtained recombinant plasmid was then transformed into Escherichia coli BL 21 competent cells DE3, and after kanamycin (Kan, 50μg / mL) screening, the colony single clone was picked for sequencing, and the cloned recombinant plasmid pET-28a(+)-CPR was successfully constructed by sequencing. The One-stepcloning kit (purchased from Nanjing Novozyme Biotechnology Co., Ltd.) was used to introduce the CPR encoding gene into the pET-28a(+)-C4H vector according to the product manual, that is, the CPR encoding gene was introduced into the C-terminal EcoRI restriction site of the pET-28a(+)-C4H vector, and the small amino acid sequence "GSTSSGSG" was used in the middle to connect. The fusion expression plasmid pET-28a(+)-C4H-CPR was constructed and verified by colony PCR. Further sequencing confirmed that the genes of C4H and CPR in the recombinant plasmid were fused. The amino acid sequences of the fused C4H and CPR are shown in SEQ ID NO:5.

[0035] Example 2 Site-directed mutagenesis of C4H (T112G) The recombinant strain containing the recombinant fusion plasmid pET-28a(+)-C4H-CPR obtained in Experimental Example 1 was inoculated into LB medium (containing 50 μg / mL kanamycin), cultured overnight, and the plasmid was extracted using a kit. The wild-type C4H enzyme was mutated using the whole plasmid site-directed mutagenesis PCR method. The first round of site-directed mutagenesis PCR was performed using the plasmid pET-28a(+)-C4H-CPR as a template and T112G_F and T112G_R as a primer pair. The primers were designed as follows: T112G_F:cgttccgttctttgggaataaagtggtg T112G_R:caccactttatcccaaagaacggaacggtc After PCR was completed, the template was digested with Dpn I enzyme and transformed into Escherichia coli Rosetta competent cells. After Kan screening, colonies were picked for sequencing to obtain the mutant plasmid pET-28a(+)-C4H-CPR (T112G).

[0036] Example 3 Site-directed mutagenesis of C4H (T112G / R188P) Using pET-28a(+)-C4H-CPR (T112G) as the template plasmid, T112G / R188P_F and T112G / R188P_R were used as primer pairs for the second round of site-directed mutagenesis. The primers were designed as follows: T112G / R188P_F:gaatggggaacgcagcccattggcgcagag T112G / R188P_R:ctgcgccaatgggctgcgttccccattca After PCR was completed, the template was digested with Dpn I enzyme and transformed into Escherichia coli Rosetta competent cells. After Kan screening, colonies were picked for sequencing to obtain the mutant plasmid pET-28a(+)-C4H-CPR (T112G / R188P).

[0037] Example 4 Site-directed mutagenesis of C4H (T112G / R188P / L340I) The third round of site-directed mutagenesis was performed using pET-28a(+)-C4H-CPR (T112G / R188P) as the template plasmid and T112G / R188P / L340I_F and T112G / R188P / L340I_R as primer pairs. The primers were designed as follows: T112G / R188P / L340I_F:gaaaccctgcgtatacggatggcaatc T112G / R188P / L340I_R:gattgccatccgtatacgcagggtttct After PCR was completed, the template was digested with Dpn I enzyme and transformed into Escherichia coli Rosetta competent cells. After Kan screening, colonies were picked for sequencing to obtain the mutant plasmid pET-28a(+)-C4H-CPR (T112G / R188P / L340I). The amino acid sequence of the mutant trans-cinnamate-4-hydroxylase and P450 reductase fusion mutant after mutation is shown in SEQ ID NO.6.

[0038] Example 5 Construction of recombinant engineering bacteria The mutant plasmid pET-28a(+)-C4H-CPR (T112G / R188P / L340I) was transformed into E. coli BL21(DE3) to obtain the recombinant engineered bacteria E. coli BL21(DE3)-pET-28a(+)-C4H-CPR (T112G / R188P / L340I). The recombinant engineered bacteria were inoculated into a shaking tube containing 5 mL LB medium containing kanamycin and cultured on a shaker at 37 °C for 5 h at a speed of 220 rpm. Then, the culture solution was inoculated into a shaking flask containing 200 mL induction medium TB at a 1% inoculation rate and cultured at 220 rpm and 37 °C for 2.5 h. When the OD 600 When the concentration reached about 0.6, IPTG was added at a final concentration of 0.25 mM, and the mixture was induced at 25 °C for 16 h. The next day, the cells were collected by centrifugation to obtain the whole cell suspension of the recombinant engineered bacteria E. coli BL21 (DE3)- pET-28a (+) -C4H-CPR (T112G / R188P / L340I).

[0039] Example 6 Inducible expression of wild-type cinnamate-4-hydroxylase recombinant Escherichia coli and preparation of enzyme solution The recombinant fusion expression strain E. coli BL21 (DE3)-C4H-CPR was inoculated into a small volume of LB medium (containing 50 μg / mL Kan) and cultured overnight at 30-37°C. Then, the inoculum was transferred to 1 L of LB medium (containing 50 μg / mL Kan) at a volume of 1-5% and cultured at 30-37°C until the OD 600 When the pH reaches 0.6-0.8, add isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 0.1 mM-1 mM, induce expression at 20-37 °C for 10-20 h, and then collect the cells by centrifugation. The fermented cells are suspended in 4 volumes of 50-100 mM phosphate buffer (pH 7.4) and ultrasonically disrupted for 20 min, and the supernatant is centrifuged to obtain the supernatant crude enzyme solution of wild-type fusion cinnamate-4-hydroxylase (C4H)-reductase (CPR).

[0040] Example 7 Determination of wild-type fusion C4H-CPR enzyme activity The crude enzyme solution of the wild-type fusion protein C4H-CPR uses cinnamic acid as a substrate. In a 3 mL reaction system, 1 mL of 35 mM cinnamic acid and 100 μL of diluted enzyme solution are added and reacted at pH 7.0 and 37 °C for a certain time. The absorbance of the product p-hydroxycinnamic acid increases at 405 nm. 1 unit of enzyme activity is defined as: 1 μmol of p-hydroxycinnamic acid is produced per minute, which is 1 U. In the temperature range of 10-65 °C and pH 4.0-9.0, the enzyme activity of the wild-type fusion protein C4H-CPR is 1.8 U / mg.

[0041] Example 8 Determination of enzyme activity of fusion protein C4H-CPR (T112G / R188P / L340I) mutant The method for determining the enzyme activity of the fusion protein C4H-CPR (T112G / R188P / L340I) mutant was the same as that of the wild-type fusion protein C4H-CPR. The recombinant engineered bacteria that successfully mutated in Example 5 were induced to express, and the enzyme activity was determined using the same method as Example 7. At a temperature range of 10-65°C and a pH value of 4.0-9.0, the enzyme activity of the C4H-CPR (T112G / R188P / L340I) mutant was 3.6 U / mg.

[0042] Example 9 Synthesis of p-hydroxycinnamic acid catalyzed by fusion protein C4H-CPR (T112G / R188P / L340I) mutant (1) Preparation of whole-cell catalyst Pick a single clone of the recombinant engineered bacteria E. coli BL21(DE3)-pET-28a(+)-C4H-CPR (T112G / R188P / L340I) and inoculate it into LB medium supplemented with kanamycin (final concentration of 50 μg / ml) and culture it overnight at 37 ℃ and 200 rpm. Dilute the overnight culture broth 100 times in 50 mL fermentation medium containing kanamycin (final concentration of 50 μg / mL). When the bacterial broth grows to the desired OD 600 When the concentration of isopropyl-β-D-thiogalactoside (IPTG) was 0.6-0.8, the inducer was added (final concentration was 0.1 mmol / L) for induction. After induction, the culture temperature was changed to 25 °C, the fermentation time was 14-18 h, and then the obtained recombinant cell solution was centrifuged at 8000 rpm for 10 min, the supernatant was discarded, and the collected recombinant engineering bacteria E. coli BL21 (DE3) -pET-28a (+) -C4H-CPR (T112G / R188P / L340I) bacterial cells were used as whole cell catalysts.

[0043] (2) Whole-cell catalysis of p-hydroxycinnamic acid synthesis The whole cell catalytic system contains: 50 g / L of C4H-CPR (T112G / R188P / L340I) mutant fusion protein whole cells, 2.5 mM trans-cinnamic acid, 2.4 mM NADPH 50 µL, 100 µM Tri-HCl (pH 8.5), and a final volume of 1 mL. The reaction was carried out at 250 rpm and 28 °C for 16 hours, and an equal volume of methanol was added and shaken to mix. Centrifuge at 12000 rpm for 5 minutes at room temperature. 1 mL of the supernatant was filtered with a 0.22 μm pore size organic filter membrane, and the filtrate was detected by high performance liquid chromatography (HPLC). The detection conditions were as follows: HPLC LC-2030C (Shimadzu, Japan), Xtimate C18 (5μm, 4.6×250mm), column temperature 35 ℃, diode array detector, wavelength 270 nm and 310 nm, injection volume 10 μL, mobile phase A was water (containing 1.3% acetic acid), mobile phase B was 100% acetonitrile, gradient elution: 0-20 min, 10-100% B, 20-21 min, 100%-10% B, 21-30 min isocratic 10% B, flow rate 1 mL / min. The constructed recombinant E. coli BL21(DE3)-pET-28a(+)-C4H-CPR (T112G / R188P / L340I) was able to synthesize p-hydroxycinnamic acid, and the amount of the product was 124 mg / L.

Claims

1. A trans-cinnamate-4-hydroxylase mutant, characterized in that: The nucleotide sequence of the mutant gene of trans-cinnamate-4-hydroxylase is shown in SEQ ID NO:

7.

2. A trans-cinnamate-4-hydroxylase and P450 reductase fusion protein, characterized in that: The trans-cinnamic acid 4-hydroxylase and P450 reductase fusion protein is a fusion of trans-cinnamic acid 4-hydroxylase and P450 reductase.

3. Encoding the trans-cinnamate 4-hydroxylase and P450 reductase fusion protein according to claim 2, characterized in that: The amino acid sequence "GSTSSGSG" is used to connect them in the middle. The amino acid sequence of the trans-cinnamic acid 4-hydroxylase and P450 reductase fusion protein is shown in SEQ ID NO:

5.

4. A mutant of a fusion protein of trans-cinnamate 4-hydroxylase and P450 reductase, characterized in that: The mutant is a mutant of a fusion protein of trans-cinnamate 4-hydroxylase and P450 reductase, the mutant contains the trans-cinnamate 4-hydroxylase mutant according to claim 1, and the amino acid sequence of the mutant is shown in SEQ ID NO:

6.

5. An expression plasmid, characterized in that: The expression plasmid contains the mutant of the trans-cinnamate 4-hydroxylase and P450 reductase fusion protein according to claim 4.

6. A recombinant engineered bacterium, characterized in that: It comprises the fusion expression plasmid pET-28a(+)-C4H-CPR (T112G / R188P / L340I) described in claim 5.

7. The recombinant engineered bacterium according to claim 6, characterized in that The recombinant engineering bacteria expresses a fusion protein C4H-CPR (T112G / R188P / L340I) mutant.

8. Use of a trans-cinnamic acid-4-hydroxylase mutant to synthesize p-hydroxycinnamic acid, characterized in that: The fusion protein C4H-CPR (T112G / R188P / L340I) mutant according to claim 4 catalyzes the synthesis of p-hydroxycinnamic acid.

9. The use of a trans-cinnamic acid-4-hydroxylase mutant for synthesizing p-hydroxycinnamic acid according to claim 8, characterized in that: The fusion protein C4H-CPR (T112G / R188P / L340I) mutant catalyzes the synthesis of p-hydroxycinnamic acid from trans-cinnamic acid and NADPH.

10. The use of a trans-cinnamic acid-4-hydroxylase mutant for synthesizing p-hydroxycinnamic acid according to claim 9, characterized in that: The cultured bacterial cells of the recombinant engineered bacteria according to claim 6 are used as whole-cell catalysts.

Images