Kit for efficiently extracting DNA and / or RNA in complex sample and application thereof

Abstract

The invention discloses a kit for efficiently extracting DNA and / or RNA in a complex sample and application of the kit. The kit comprises a cracking medium, a cracking solution, a precipitation solution, a binding solution, magnetic beads, a first impurity washing solution, a second impurity washing solution and an eluent. When the kit is used for extracting the nucleic acid in the complex sample, the advantages at least lie in that the accessibility and the convenience of efficient extraction of the nucleic acid in the complex sample are expanded, and various related mechanisms and research units can conveniently carry out daily extraction and related detection experiment work.

Description

Technical Field

[0001] The present application relates to the field of nucleic acid extraction and detection technology, and specifically to a kit for efficiently extracting DNA and / or RNA from complex samples and its application, and further to a DNA and / or RNA co-extraction kit for complex samples including sewage, soil, feces, sediment, sludge, water filter membranes, etc., and a corresponding DNA and / or RNA co-extraction method. Background Art

[0002] With the continuous development and improvement of molecular biology detection technology, its application scope is gradually expanding to more diverse fields and a wider range of sample types, including various complex samples such as sewage, soil, feces, sediments, sludge, water filter membranes, etc. For example, a large number of domestic and foreign scholars and government agencies have carried out monitoring of virus concentrations in sewage to obtain overall information on the prevalence of different viruses in the region. For another example, there are currently a large number of relevant clinical cases using human feces as the main means of detecting various digestive tract pathogens. At the same time, a large number of scientists are paying attention to the diversity and functional changes of various microbial communities in water, soil, sediments and sludge, so as to provide basic information for studying the interaction between organisms and the environment and exploring new high-quality microbial species resources.

[0003] In practical applications, the key to molecular testing of complex samples including sewage, soil, feces, sediment, sludge, and water filter membranes is how to extract sufficient and pure nucleic acids (including DNA and RNA) from these complex samples. Compared with traditional samples, these samples have more complex high-level structures, which makes it difficult for traditional enzymatic or thermal methods to release the nucleic acids encapsulated inside. At present, some solutions mostly involve the use of chemical reagents such as β-mercaptoethanol, phenol-chloroform-isoamyl alcohol, etc. to enhance the lysis effect, but because most of the above reagents are regulated chemicals, they are difficult to purchase and use in most application scenarios, so it is difficult to meet the usage requirements under most conditions.

[0004] At the same time, the above-mentioned complex samples often contain a large number of various PCR inhibitors including humic acid, plant-derived polysaccharides, plant polyphenols, etc. The presence of these inhibitors will interfere with downstream molecular biological reactions, thereby affecting the accuracy of molecular detection. Although some schemes are currently available that can remove most of the PCR inhibitors in samples through selective precipitation technology, most commercially available selective precipitation reagents will lose RNA molecules while precipitating PCR inhibitors, leaving only DNA molecules. This makes most commercially available kits only able to achieve efficient extraction of DNA from complex samples, but cannot meet the relevant needs of RNA extraction. At present, only a few imported kit brands have mastered the selective precipitation technology of removing shielding agents that can retain RNA, while there are few similar products in China that can achieve related functions. This means that RNA extraction for such complex samples mostly relies on imported products, resulting in high prices, long delivery times, and difficulty in large-scale development.

[0005] In addition, most commercially available DNA / RNA extraction kits for the above-mentioned complex samples use the centrifugal column method to recover nucleic acids. However, due to the limitations of the principle of the centrifugal column method, it is difficult to achieve automatic extraction based on an automated nucleic acid extraction platform. This makes the extraction of such highly complex samples highly dependent on manual operation, resulting in problems such as long time consumption, poor extraction effects, and unstable extraction effects in different batches.

[0006] In summary, for the extraction of nucleic acids from complex samples including sewage, soil, feces, sediment, sludge, water filter membranes, etc., there is still a lack of a nucleic acid extraction kit and a corresponding nucleic acid extraction method that can achieve efficient sample lysis and PCR shielding agent removal without using regulated chemical reagents, and simultaneously retain DNA and RNA molecules, while being compatible with automated operations.

[0007] Therefore, there is an urgent need to develop a new method for extracting nucleic acids in this field. Summary of the invention

[0008] Based on this, it is necessary to provide at least a kit for efficiently extracting DNA and / or RNA from complex samples and its application.

[0009] In a first aspect of the present application, a kit for efficiently extracting DNA and / or RNA from a complex sample is provided, which comprises a lysis medium, a lysis solution, a precipitation solution, a binding solution, magnetic beads, a first washing solution, a second washing solution and an elution solution; wherein:

[0010] The cracking medium comprises hard particles, and the particle size of the cracking medium is 0.1 mm to 3 mm;

[0011] The lysate comprises 10 mmol / L to 100 mmol / L buffer salt, 1 mol / L to 4 mol / L chaotropic salt, 0.01 wt% to 1 wt% detergent and 0.5 mol / L to 3 mol / L RNA solubilizing agent;

[0012] The precipitating agent used for the precipitating solution includes one or more of aluminum sulfate, potassium aluminum sulfate dodecahydrate, ammonium aluminum sulfate dodecahydrate, basic aluminum sulfate, aluminum chloride, basic aluminum chloride, ferric chloride and lanthanum chloride;

[0013] The binding solution comprises 10 mmol / L to 100 mmol / L buffer salt, 1 mol / L to 5 mol / L chaotropic salt, 10 wt% to 30 wt% organic solvent and 0.1 wt% to 5 wt% surfactant;

[0014] The magnetic beads in the magnetic bead storage solution include one or more of ferroferric oxide magnetic beads wrapped by hydroxyl-modified silica, ferroferric oxide magnetic beads wrapped by epoxy-modified silica, and ferroferric oxide magnetic beads wrapped by carboxyl-modified silica, and the concentration of the magnetic beads in the magnetic bead storage solution is 50 mg / mL to 100 mg / mL;

[0015] The first washing solution comprises 10 mmol / L to 100 mmol / L buffer salt, 0.05 mol / L to 2 mol / L chaotropic salt, 30% (v / v) to 80% (v / v) organic solvent and 0.1 wt% to 5 wt% surfactant, and the pH is 6.0 to 8.0;

[0016] The second washing solution comprises 10 mmol / L to 100 mmol / L buffer salt and 50% (v / v) to 90% (v / v) organic solvent, and the pH value is 6.0 to 8.0;

[0017] The eluent contains 1 mmol / L to 100 mmol / L buffer salt and 0.01 wt% to 1 wt% surfactant, and the pH is 6.0 to 8.0.

[0018] In a second aspect of the present application, a method for extracting DNA and / or RNA from a complex sample using the kit described in the first aspect is provided, the method comprising:

[0019] Mechanical grinding: the lysis medium, the lysis solution and the sample to be tested are mixed and ground by mechanical vibration to obtain a lysis mixture; wherein the relative amount of the lysis solution and the liquid sample to be tested in each reaction unit is (400 μL ~ 700 μL): (50 μL ~ 300 μL), and the relative amount of the lysis solution and the solid sample to be tested is (400 μL ~ 700 μL): (25 mg ~ 300 mg);

[0020] PCR inhibitor precipitation: centrifuge the lysis mixture at 5000 g ~ 15000 g to obtain a supernatant, mix the supernatant with the precipitate in a relative amount of (500 μL ~ 650 μL): (50 ~ 250 μL), invert several times, and centrifuge at 5000 g ~ 15000 g to obtain a supernatant;

[0021] Nucleic acid binding: the supernatant, binding solution and magnetic beads are mixed to allow the magnetic beads to adsorb nucleic acids, and the supernatant is removed to obtain magnetic beads bound with nucleic acids; the volume ratio of the supernatant to the binding solution is 1:0.8-1:3, and the amount of magnetic beads used in each reaction unit is 5 μg-50 μg;

[0022] Rinsing impurities: using the first washing solution and the second washing solution to wash the magnetic beads bound with nucleic acid in sequence to remove impurities, so as to obtain only magnetic beads bound with nucleic acid; the impurities include at least one of proteins, small molecules and salts;

[0023] Nucleic acid elution: Mix the magnetic beads bound only to nucleic acids with the elution buffer, incubate and centrifuge to obtain the supernatant containing the target DNA and / or RNA.

[0024] Compared with traditional technologies, the advantages of using the kit of this application for nucleic acid extraction from complex samples are at least:

[0025] 1. The system has improved the composition of lysate and lysate method, and has achieved efficient lysate of various complex samples without the need for additional reagents of concern. This can greatly expand the accessibility and convenience of efficient nucleic acid extraction from complex samples, and facilitate various related institutions and research units to carry out routine extraction and related detection experiments;

[0026] 2. Through systematic improvements to the working environment of the precipitation solution, the PCR inhibitors can be removed to the greatest extent possible through selective precipitation technology while keeping RNA suspended in the solution. This can effectively remove a large number of PCR inhibitors in various complex samples, thereby improving the purity of nucleic acid extraction and downstream compatibility;

[0027] 3. By optimizing the nucleic acid recovery method and automating the plate reagent distribution and operation procedures, semi-automatic DNA / RNA extraction for complex samples is achieved, which can reduce manual operation time by 85%, increase extraction and detection capabilities by 4 times, and is compatible with current mainstream automated nucleic acid extraction instruments, which can greatly improve the efficiency of nucleic acid extraction and detection for complex samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the implementation methods and examples of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for use in the description of the implementation methods or examples. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without creative work. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in explaining the present application.

[0029] Figure 1 The nucleic acid extraction method proposed in one embodiment of the present application and other domestic and foreign commercial kits are effective in extracting complex samples. DETAILED DESCRIPTION

[0030] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present application are given in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0032] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0033] In this application, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, "one or more" and the like, when used in other ways to mean "one or more", are also understood in the same way unless otherwise specified.

[0034] The terms "combination thereof", "any combination thereof", "any combination thereof" and the like used in this application include all suitable combinations of any two or more of the listed items.

[0035] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method", etc. is based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0036] In this application, "further", "further", "particularly", "for example", "such as", "example", "for example", etc. are used for descriptive purposes, indicating that the previous and subsequent different technical solutions are related in terms of the content covered, but should not be understood as a limitation on the previous technical solution, nor can it be understood as a limitation on the protection scope of this application. In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0037] In this application, "optionally", "optional", and "optional" mean optional, that is, any one of the two parallel solutions of "yes" or "no". If there are multiple "optional" in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent. Unless otherwise specified, the descriptions of "optionally include", "optionally contain", etc. in this application, taking "optionally include" as an example, mean "may include or not include".

[0038] The terms "contain", "include" and "include" used in this application are synonymous, which are inclusive or open-ended and do not exclude additional, uncited members or features. Members or features include materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions for the occurrence of actions, timing, states, etc.

[0039] In this application, the technical features or technical solutions described in an open language include closed technical features or technical solutions composed of the listed contents, and also include open technical features or technical solutions containing the listed contents.

[0040] In the present application, exemplary descriptions such as "in some implementation modes (or examples)" and "in one implementation mode (or example)" may include but are not limited to the following meanings: these solutions may be combined with other solutions in a suitable manner to form new technical solutions.

[0041] In the present application, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0042] In the present application, it is related to a numerical interval (i.e., a numerical range). If not otherwise specified, the distribution of the optional numerical values ​​in the numerical interval is considered to be continuous, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. If not otherwise specified, when the numerical interval only refers to the integer in the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints, which is equivalent to directly listing each integer. For example, t is an integer selected from 1 to 10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical range disclosed herein should be understood to include any and all sub-ranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.

[0043] In this application, if there are multiple steps involved in the method flow, unless there is a clear different description in this document, there is no strict order restriction for the execution of these steps, and they can be executed in other orders than described. Moreover, any step can include multiple sub-steps or multiple stages, and these sub-steps or stages are not necessarily executed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn, alternating or simultaneously with other steps or parts of sub-steps or stages of other steps.

[0044] The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

[0045] In the present application, %(w / w) and wt% both refer to weight percentage, %(v / v) refers to volume percentage, and %(w / v) refers to mass volume percentage.

[0046] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference separately. Unless they conflict with the application purpose and / or technical solution of this application, the cited documents involved in this application are cited with all contents and all purposes. When the cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the cited documents are involved in this application, the examples and preferred methods of the cited relevant technical features can also be incorporated into this application as references, but are limited to the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be modified adaptively according to the description of this application.

[0047] The inventors creatively combine relevant components such as lysis medium, lysis solution, precipitation solution, binding solution, magnetic beads, first washing solution, second washing solution and elution solution, and can effectively break up the high-level structure of complex samples by combining physical fragmentation with chemical fragmentation without adding any additional regulated reagents, thereby releasing nucleic acids and creating a suitable selective precipitation environment. On the basis of retaining DNA and RNA, various PCR inhibitors in the sample can be selectively precipitated, and efficient recovery of DNA and / or RNA can be achieved through the specific adsorption, binding and elution effects of magnetic beads.

[0048] A first aspect of an embodiment of the present application provides a kit for efficiently extracting DNA and / or RNA and removing PCR inhibitors from complex samples such as sewage, soil, feces, sediment and activated sludge, wherein the kit comprises a lysis medium, a lysis solution, a precipitation solution, a binding solution, a magnetic bead storage solution, a first washing solution, a second washing solution and an elution solution.

[0049] The lysis medium in the present application may be hard particles pre-packed in a grinding tube, and its function is at least to provide impact, friction and other effects during the vortex collision, so as to use physical stress to break the complex high-level structures in the sample and protective structures such as bacterial cell walls and viral nucleocapsids, thereby releasing the nucleic acids in the organism. Optionally, the type of lysis medium includes one or more of the following: acid-washed glass beads, zirconium beads, steel balls, garnet or other hard spherical particles. In some embodiments, the above-mentioned lysis medium is acid-washed glass beads. In the present application, the particle size of the lysis medium may be 0.1 mm ~ 3 mm. In some embodiments, the particle size of the lysis medium is 0.1 mm, 0.2 mm, 0.3 mm, 0.4 mm, 0.5 mm, 0.6 mm, 0.7 mm, 0.8 mm, 0.9 mm, 1 mm, 1.1 mm, 1.2 mm, 1.3 mm, 1.4 mm, 1.5 mm, 1.6 mm, 1.7 mm, 1.8 mm, 1.9 mm, 2 mm, 2.1 mm, 2.2 mm, 2.3 mm, 2.4 mm, 2.5 mm, 2.6 mm, 2.7 mm, 2.8 mm, 2.9 mm, 3 mm, or a range or value between any two values. Exemplarily, the particle size of the lysis medium contained in the kit includes one or more of the following ranges: 0.1 mm to 0.3 mm, 0.3 mm to 0.5 mm, 0.5 mm to 0.7 mm, 0.7 mm to 1 mm, and 1 mm to 3 mm. In some embodiments, the diameter of the lysis medium ranges from 0.1 mm to 0.3 mm.

[0050] In some embodiments, the pre-packed mass of the lysis medium in the grinding tube is in the range of 0.2 g to 1 g. This content can be used as the amount of a reaction unit. If it is specially stated that the amount of the following lysis solution, precipitation solution, etc. is also the amount in a reaction unit. It should be understood that the packing mass range can be adjusted according to the content of the complex sample. In some embodiments, the pre-packed mass of the lysis medium in the grinding tube is 0.45 g.

[0051] Unless otherwise specified, the term "reaction unit" in this application refers to processing samples or generating reactions in a single space, such as a grinding tube or a centrifuge tube. The reaction unit is dynamic, for example, when mechanical grinding is performed, a grinding tube is a reaction unit. When the resulting lysis mixture is spatially transferred for subsequent PCR inhibitor precipitation treatment, it is also an independent reaction unit, and so on.

[0052] The lysis buffer plays at least a dual role. Its first purpose is at least to cooperate with the grinding medium to provide the high salt environment, detergent and pH buffer system required for the lysis process, thereby disrupting the cell and subcellular structure of the biomass and promoting the separation of DNA / RNA from the binding protein. Its second purpose is at least to provide a solubilization environment to shield the charge on the RNA base side, thereby increasing the hydrophilicity of the RNA and increasing the solubility of the RNA.

[0053] The components of the lysate include buffer salts, chaotropic salts, detergents and RNA solubilizing agents. Among them, the purpose of the buffer salt is at least to stabilize the pH value of the lysis system after the sample is added. In the present application, the types of buffer salts may include one or more of the following: tris(hydroxymethylaminomethane)-hydrochloric acid buffer salt, tris(hydroxymethylaminomethane)-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt, sodium citrate-citric acid buffer salt. In some embodiments, the above-mentioned buffer salt is disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt. In some embodiments, the concentration of the above-mentioned buffer salt in the lysate is 10 mmol / L~100 mmol / L. Exemplarily, the concentration of the buffer in the lysate is 10 mmol / L, 15 mmol / L, 20 mmol / L, 25 mmol / L, 30 mmol / L, 35 mmol / L, 40 mmol / L, 45 mmol / L, 50 mmol / L, 55 mmol / L, 60 mmol / L, 65 mmol / L, 70 mmol / L, 75 mmol / L, 80 mmol / L, 85 mmol / L, 90 mmol / L, 95 mmol / L, 100 mmol / L, or a range or value between any two values. In one embodiment, the concentration combination of the above-mentioned buffer salt is 80 mmol / L of disodium hydrogen phosphate and 20 mmol / L of sodium dihydrogen phosphate. The pH range of the binding solution stabilized by the above-mentioned buffer salt can be 5.5~8.5, exemplarily, 5.5, 6, 6.5, 7, 7.5, 8 or 8.5. In some embodiments, the pH of the binding solution stabilized by the above-mentioned buffer salt is 7.0. The purpose of the chaotropic salt is at least to create a high-salt lysis environment to denature proteins and destroy potential nucleases. In the present application, the types of chaotropic salts may include one or more of the following: guanidine isothiocyanate, sodium isothiocyanate, potassium isothiocyanate, ammonium isothiocyanate, guanidine hydrochloride, ammonium sulfate, sodium chloride, potassium chloride, lithium chloride or other monovalent salt solutions. In some embodiments, the monovalent salt includes one or more of sodium chloride, potassium chloride and lithium chloride. In some embodiments, the above-mentioned chaotropic salt is a mixture of guanidine isothiocyanate and sodium chloride. In the present application, the concentration of the above-mentioned chaotropic salt in the lysate may be 1 mol / L ~4 mol / L. Exemplarily, the concentration of the chaotropic salt in the lysate is 1 mol / L, 1.5 mol / L, 2mol / L, 2.5 mol / L, 3 mol / L, 3.5 mol / L, 4 mol / L, or a range or value between any two values. In some embodiments, the lysate comprises guanidine thiocyanate and sodium chloride, wherein the concentration of guanidine thiocyanate in the lysate is 3 mol / L, and the concentration of sodium chloride in the lysate is 1 mol / L.The purpose of the detergent is at least to dissolve the nucleocapsid of the cell membrane or virus, and to destroy the binding of DNA / RNA to the binding protein, thereby releasing the nucleic acid in the free state. In the present application, the type of detergent may include one or more of the following: sodium dodecyl sulfate, sodium dodecyl sulfonate, sodium dodecylbenzene sulfonate, sodium lauryl sarcosine, Tween-20, Tween-80, Triton X-100 and other anionic or non-ionic surfactants. In some embodiments, the above-mentioned detergent is a mixture of sodium dodecyl sulfate and Tween-20. In the present application, the concentration of the above-mentioned detergent in the lysate may be 0.01 wt%~1 wt%. In some embodiments, the detergent is a mixture of sodium dodecyl sulfate and Tween-20, and the concentration of sodium dodecyl sulfate in the lysate is 0.2 wt%, and the concentration of Tween-20 in the lysate is 0.02 wt%. The purpose of the RNA solubilizer is at least to shield the charge on the RNA base side, thereby improving the hydrophilicity of RNA. In the present application, the types of RNA solubilizing agents may include one or more of the following: small molecule organic acid salts such as ammonium acetate, sodium acetate, potassium acetate, ammonium formate, sodium formate, potassium formate. In some embodiments, the above-mentioned RNA solubilizing agent is ammonium acetate. Further, the concentration of the above-mentioned RNA solubilizing agent in the lysate is 0.5 mol / L~3 mol / L. Exemplarily, the concentration of the RNA solubilizing agent in the lysate is 0.5 mol / L, 1 mol / L, 1.5 mol / L, 2 mol / L, 2.5 mol / L, 3mol / L, or a range or value between any two values. In some embodiments, the concentration of the RNA solubilizing agent in the lysate is 0.5 mol / L~1 mol / L. In some embodiments, the concentration of the RNA solubilizing agent in the lysate is 0.5 mol / L.

[0054] The purpose of the precipitate is at least to produce a large amount of positively charged metal hydroxide colloids. After contacting the lysate, the metal hydroxide colloids will selectively adsorb PCR inhibitors such as proteins, humic acid, heme and plant-derived polysaccharides, but the adsorption effect on DNA and RNA protected by solubilization is poor, thereby achieving selective PCR inhibitor removal. In the present application, the main components of the precipitate may include one or more of the following: aluminum sulfate, potassium aluminum sulfate dodecahydrate, ammonium aluminum sulfate dodecahydrate, basic aluminum sulfate, aluminum chloride, basic aluminum chloride, ferric chloride and lanthanum chloride. In some embodiments, the precipitant used for the precipitate is potassium aluminum sulfate dodecahydrate. In some embodiments, the concentration of the precipitant in the precipitate is 0.01 mol / L ~ 0.5 mol / L. Exemplarily, the concentration of the precipitant in the precipitate is 0.01 mol / L, 0.02 mol / L, 0.05 mol / L, 0.07 mol / L, 0.09 mol / L, 0.1 mol / L, 0.15 mol / L, 0.2 mol / L, 0.25 mol / L, 0.3 mol / L, 0.35 mol / L, 0.4 mol / L, 0.45 mol / L, 0.5 mol / L, or a range or value between any two values. In some embodiments, the concentration of the precipitant in the precipitate is 0.05 mol / L.

[0055] The purpose of the binding solution is at least to supplement the ionic strength reduced after the precipitation solution acts, and to provide an additional organic solvent, thereby reducing the solubility of DNA / RNA, so as to facilitate the adsorption and capture of magnetic beads. The components of the binding solution include buffer salts, chaotropic salts, organic solvents and surfactants. Among them, the purpose of the buffer salt is at least to stabilize the pH value of the system during the nucleic acid binding process to be weakly acidic to promote nucleic acid adsorption. In the present application, the types of buffer salts may include one or more of the following: tris-hydrochloric acid buffer salt, tris-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt and sodium citrate-citric acid buffer salt. In some embodiments, the above-mentioned buffer salt is tris-ethylenediaminetetraacetic acid buffer salt. In the present application, the concentration of the above-mentioned buffer salt in the binding solution may be 10 mmol / L~100 mmol / L. In some embodiments, the concentration combination of the above-mentioned buffer salt is tris 50 mmol / L and ethylenediaminetetraacetic acid 50 mmol / L. In some embodiments, the pH range of the binding solution stabilized by the above-mentioned buffer salt is 4.5~7.0. Exemplarily, the pH of the binding solution is stabilized at 4.5, 5, 5.5, 6, 6.5, 7, or a range or value between any two values. In some embodiments, the pH of the binding solution stabilized by the above-mentioned buffer salt is 6.0. The purpose of the chaotropic salt is at least to provide the ionic strength necessary for nucleic acid adsorption to promote nucleic acid adsorption. In the present application, the type of chaotropic salt may include one or more of the following: guanidine isothiocyanate, sodium isothiocyanate, potassium isothiocyanate, ammonium isothiocyanate, guanidine hydrochloride, ammonium sulfate, sodium chloride, potassium chloride or other monovalent salt solutions. In some embodiments, the above-mentioned chaotropic salt is guanidine isothiocyanate. In the present application, the concentration of the above-mentioned chaotropic salt in the binding solution may be 1 mol / L~5 mol / L. For example, the concentration of the chaotropic salt in the binding solution is 1 mol / L, 1.5 mol / L, 2 mol / L, 2.5 mol / L, 3 mol / L, 3.5 mol / L, 4 mol / L, 4.5 mol / L, 5 mol / L, or a range or value between any two values. In some embodiments, the concentration of the chaotropic salt in the tuberculosis fluid is 3 mol / L. The purpose of the organic solvent is at least to reduce the solubility of the nucleic acid in the aqueous solution, thereby promoting the precipitation of the nucleic acid from the solution and being captured by the magnetic beads. In the present application, the type of organic solvent may include one or more of the following: ethanol, isopropanol, polyethylene glycol, formamide or dimethylformamide. In some embodiments, the above-mentioned organic solvent is isopropanol. In the present application, the volume fraction of the above-mentioned organic solvent in the binding solution may be 10 wt%~30 wt%. In some embodiments, the volume fraction of the above-mentioned organic solvent in the binding solution is 25 wt%. The role of the surfactant is at least to stabilize the suspension state of the nucleic acid and the magnetic beads to prevent the nucleic acid from directly settling.In the present application, the types of surfactants may include one or more of the following: Tween-20, Tween-40, Tween-60, Tween-80, Triton X-100, NP-40, polyethylene glycol. In some embodiments, the above-mentioned surfactant is Tween-20. In the present application, the mass fraction of the above-mentioned surfactant in the binding liquid may be 0.1 wt%~5 wt%. Exemplarily, the mass fraction may be 0.1 wt%, 0.2 wt%, 0.3 wt%, 0.4 wt%, 0.5 wt%, 0.6 wt%, 0.7 wt%, 0.8 wt%, 0.9 wt%, 1 wt%, 1.5 wt%, 2 wt%, 2.5 wt%, 3 wt%, 3.5 wt%, 4 wt%, 4.5 wt%, 5wt%, or a range or value between any two values. In some embodiments, the mass fraction of the above-mentioned surfactant in the binding liquid is 2 wt%.

[0056] The purpose of the magnetic beads is at least to utilize the chemical functional groups modified on the surface of the magnetic beads to adsorb and capture DNA / RNA under conditions of high ionic strength and the presence of organic solvents. In the present application, the magnetic beads may include one or more of the following: ferroferric oxide magnetic beads wrapped in hydroxyl-modified silica, ferroferric oxide magnetic beads wrapped in epoxy-modified silica, and ferroferric oxide magnetic beads wrapped in carboxyl-modified silica. In some embodiments, the magnetic beads are ferroferric oxide magnetic beads wrapped in hydroxyl-modified silica. In the present application, the mass concentration of the magnetic beads in the stock solution may be 5 mg / mL to 100 mg / mL. In some embodiments, the mass concentration of the magnetic beads in the stock solution is 10 mg / mL.

[0057] The purpose of the first washing solution is at least to further denature and remove protein contamination bound to the magnetic beads while keeping the DNA / RNA adsorbed on the magnetic beads. The main components of the first washing solution include buffer salts, chaotropic salts, organic solvents and surfactants. Among them, the purpose of the buffer salt is at least to stabilize the pH value of the washing process. The types of buffer salts in the first washing solution may include one or more of the following: tris-hydrochloric acid buffer, tris-ethylenediaminetetraacetic acid buffer, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer, sodium citrate-citric acid buffer. In some embodiments, the buffer salt is tris-hydrochloric acid buffer. In the present application, the concentration of the buffer salt in the first washing solution may be 10 mmol / L~100 mmol / L. In some embodiments, the concentration combination of the buffer salt is tris 20 mmol / L and hydrochloric acid 20 mmol / L. Further, the pH range of the binding solution stabilized by the buffer salt is 6.0~8.0. In some embodiments, the pH of the first washing solution stabilized by the buffer salt is 6.8 to 7.4. The purpose of the chaotropic salt is at least to further denature and wash out the protein contamination remaining on the magnetic beads. Optionally, the type of chaotropic salt includes one or more of the following: guanidine isothiocyanate, sodium isothiocyanate, potassium isothiocyanate, ammonium isothiocyanate, guanidine hydrochloride, ammonium sulfate, sodium chloride, potassium chloride or other monovalent salt solutions. In some embodiments, the chaotropic salt is guanidine hydrochloride. In the present application, the concentration of the chaotropic salt in the first washing solution may be 0.05 mol / L to 2 mol / L. Exemplarily, the concentration of the chaotropic salt in the first washing solution is 0.05 mol / L, 0.06 mol / L, 0.08 mol / L, 0.09 mol / L, 0.1 mol / L, 0.15 mol / L, 0.2 mol / L, 0.25 mol / L, 0.3 mol / L, 0.35 mol / L, 0.4 mol / L, 0.5 mol / L, 1 mol / L, 1.1 mol / L, 1.2 mol / L, 1.3 mol / L, 1.4 mol / L, 1.5 mol / L, 1.6 mol / L, 1.7 mol / L, 1.8 mol / L, 1.9 mol / L, 2 mol / L, or a range or value between any two values. In some embodiments, the concentration of the chaotropic salt in the first washing solution is 2 mol / L. The purpose of the organic solvent is at least to stabilize the adsorption state of the nucleic acid on the magnetic beads. In the present application, the type of organic solvent may include one or more of the following: ethanol, isopropanol, polyethylene glycol, formamide or dimethylformamide. In some embodiments, the organic solvent is ethanol. In the present application, the volume fraction of the organic solvent in the first washing liquid may be 30% to 80%, and in some embodiments, the volume fraction of the organic solvent in the first washing liquid is 40%.The purpose of the surfactant is at least to promote the elution effect of the denatured protein from the magnetic beads and to increase the accessible surface area of ​​the solution of the magnetic beads. In the present application, the types of surfactants used in the first washing solution may include one or more of the following: Tween-20, Tween-40, Tween-60, Tween-80, Triton X-100, NP-40 and polyethylene glycol. In some embodiments, the above-mentioned surfactant is Tween-20. In the present application, the mass fraction of the above-mentioned surfactant in the first washing solution may be 0.1% to 5%. In some embodiments, the mass fraction of the above-mentioned surfactant in the first washing solution is 1%.

[0058] The purpose of the second washing solution is at least to rinse and remove the salt ions remaining on the magnetic beads. The main components of the second washing solution include buffer salts and organic solvents. Among them, the purpose of the buffer salt is at least to stabilize the pH value of the washing process. In the present application, the types of buffer salts used for the second washing solution may include one or more of the following: tris-hydrochloric acid buffer salt, tris-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt, sodium citrate-citric acid buffer salt. In some embodiments, the above-mentioned buffer salt is tris-hydrochloric acid buffer salt. In the present application, the concentration of the above-mentioned buffer salt in the second washing solution may be 10 mmol / L~100 mmol / L, and in some embodiments, the concentration combination of the above-mentioned buffer salt is tris 10 mmol / L, hydrochloric acid 10 mmol / L. Further, the pH range of the binding solution stabilized by the above-mentioned buffer salt may be 6.0~8.0. In some embodiments, the pH of the second washing solution stabilized by the above-mentioned buffer salt is 6.8~7.4. The purpose of the organic solvent is at least to stabilize the adsorption state of the nucleic acid on the magnetic beads. In the present application, the type of organic solvent used for the second washing solution may include one or more of the following: ethanol, isopropanol, polyethylene glycol, and formamide or dimethylformamide. In some embodiments, the above-mentioned organic solvent is ethanol. In the present application, the volume fraction of the above-mentioned organic solvent in the second washing solution may be 50% to 90%, and in some embodiments, the volume fraction of the above-mentioned organic solvent in the second washing solution is 80%.

[0059] The purpose of the eluent is at least to elute the nucleic acid from the magnetic beads, and the main components of the eluent include buffer salts and surfactants. Among them, the purpose of the buffer salt is at least to stabilize the pH value of the washing process. In the present application, the types of buffer salts used for the eluent may include one or more of the following: tris(hydroxymethylaminomethane)-hydrochloric acid buffer salt, tris(hydroxymethylaminomethane)-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt and sodium citrate-citric acid buffer salt. In some embodiments, the above-mentioned buffer salt is tris(hydroxymethylaminomethane)-ethylenediaminetetraacetic acid buffer salt. In the present application, the concentration of the above-mentioned buffer salt in the eluent may be 1 mmol / L~100 mmol / L. Illustratively, it is 1 mmol / L, 2 mmol / L, 3 mmol / L, 5 mmol / L, 7 mmol / L, 9 mmol / L, 10 mmol / L, 12 mmol / L, 15 mmol / L, 18 mmol / L, 20 mmol / L, 25 mmol / L, 30 mmol / L, 35 mmol / L, 40 mmol / L, 45 mmol / L, 50 mmol / L, 55mmol / L, 60 mmol / L, 65 mmol / L, 70 mmol / L, 75 mmol / L, 80 mmol / L, 85 mmol / L, 90 mmol / L, 95 mmol / L, 100 mmol / L, or a range or value between any two values.

[0060] In some embodiments, the concentration combination of the above-mentioned buffer salt in the eluent is 10 mmol / L of tris(hydroxymethyl)aminomethane and 0.1 mmol / L of ethylenediaminetetraacetic acid. In some embodiments, the pH range of the binding solution stabilized by the above-mentioned buffer salt is 6.0~8.0. In some embodiments, the pH of the eluent stabilized by the above-mentioned buffer salt is 7.4~7.6. The role of the surfactant is at least to shield the charge on the surface of the magnetic beads, thereby improving the elution effect of the nucleic acid. In some embodiments, the types of surfactants include one or more of the following: Tween-20, Tween-40, Tween-60, Tween-80, Triton X-100, NP-40 and polyethylene glycol. In some embodiments, the above-mentioned surfactant is Tween-20. In some embodiments, the mass fraction of the above-mentioned surfactant in the eluent is 0.01%~1%. In some embodiments, the mass fraction of the above-mentioned surfactant in the eluent is 0.05%.

[0061] The second aspect of the embodiments of the present application provides a nucleic acid extraction method based on the above-mentioned kit for efficient and simultaneous extraction of DNA and / or RNA from complex samples including sewage, soil, feces, sediment, sludge, water filter membranes, etc., which specifically includes mechanical grinding and lysis, shielding agent precipitation, nucleic acid binding, impurity rinsing and nucleic acid elution.

[0062] In some embodiments, the method comprises:

[0063] Mechanical grinding: the lysis medium, the lysis solution and the sample to be tested are mixed and ground by mechanical vibration to obtain a lysis mixture; wherein the relative amount of the lysis solution and the liquid sample to be tested in each reaction unit is (400 μL ~ 700 μL): (50 μL ~ 300 μL), and the relative amount of the lysis solution and the solid sample to be tested is (400 μL ~ 700 μL): (25 mg ~ 300 mg);

[0064] PCR inhibitor precipitation: centrifuge the lysis mixture at 5000 g ~ 15000 g to obtain a supernatant, mix the supernatant with the precipitate in a relative amount of (500 μL ~ 650 μL): (50 ~ 250 μL), invert several times, and centrifuge at 5000 g ~ 15000 g to obtain a supernatant;

[0065] Nucleic acid binding: the supernatant, binding solution and magnetic beads are mixed to allow the magnetic beads to adsorb nucleic acids, and the supernatant is removed to obtain magnetic beads bound with nucleic acids; the volume ratio of the supernatant to the binding solution is 1:0.8-1:3, and the amount of magnetic beads used in each reaction unit is 5 μg-50 μg;

[0066] Rinsing impurities: using the first washing solution and the second washing solution to wash the magnetic beads bound with nucleic acid in sequence to remove impurities, so as to obtain only magnetic beads bound with nucleic acid; the impurities include at least one of proteins, small molecules and salts;

[0067] Nucleic acid elution: Mix the magnetic beads bound only to nucleic acids with the elution buffer, incubate and centrifuge to obtain the supernatant containing the target DNA and / or RNA.

[0068] Step 1: Mechanical grinding and lysis (only for illustrative purposes)

[0069] The purpose of mechanical grinding and lysis is at least to mix the sample to be extracted with the lysis solution and the lysis medium in the grinding tube, and to break the higher-order structure of the sample to be extracted through physical and chemical dual effects under the condition of external mechanical vibration, and to lyse the bacterial cell wall / membrane and the viral nucleocapsid, thereby releasing nucleic acids. In some embodiments, the operation steps of mechanical grinding and lysis include:

[0070] 1. Add a certain volume of lysate to a grinding tube pre-filled with grinding media. The volume of the above lysate added to a single grinding tube is 400 μL, 450 μL, 500 μL, 550 μL, 600 μL, 650 μL or 700 μL. In some embodiments, the volume of the above lysate is 500 μL. It should be noted that the optimal amount of lysate should be dynamically adjusted according to the amount and properties of the sample. When the sample has a high solid content and a large volume, a larger volume of lysate (such as 650 μL or 700 μL) should be selected.

[0071] 2. Add the sample to be tested to the grinding tube that has been filled with lysis solution. When using a single grinding tube and the amount of lysis solution is 400 μL~700 μL, for liquid samples (such as enriched sewage, resuspended sediment, etc.), the recommended sample input amount is 50 μL~300 μL. In some embodiments, the input amount of the above-mentioned types of samples is 200 μL; for solid samples (such as soil, sediment, feces, etc.), the recommended sample input amount is 25 mg~300 mg. In some embodiments, the input amount of fecal samples is 25 mg~50 mg, for example, 25 mg or 50 mg. In other embodiments, the input amount of soil samples is 100 mg~200 mg; for membrane samples (such as enriched water filter membranes), the recommended sample input amount is 1 / 4~1 47 or 50 mm filter membrane. In some embodiments, the input amount of membrane samples is 1 / 2 47 or 50 mm filter membrane. In particular, due to the strong heterogeneity of the above samples, it should be noted that when faced with samples with excessively high organic matter content and high content of potential PCR inhibitors, the sample input amount should be appropriately reduced to ensure the nucleic acid extraction effect.

[0072] 3. After adding the sample, cover the grinding tube cover, fix the grinding tube on the mechanical force oscillation device, and perform mechanical force oscillation grinding according to certain parameters according to the specific type of oscillation device and the purpose of the downstream experiment to promote sample lysis. Optionally, the equipment for mechanical force oscillation includes a vortexer or a grinding homogenizer. In the subsequent embodiments, both mechanical force oscillation methods are involved and are equivalent to a certain extent. The specific oscillation parameters of the two mechanical force oscillation methods need to be selected by comprehensively considering the sample type and the purpose of the downstream experiment. Specifically, when the sample structure is more complex and the particle size is larger, the grinding homogenizer should be preferred for mechanical force oscillation, and when the sample structure is relatively simple, the vortexer can also be selected for mechanical force oscillation. At the same time, if the downstream experiment has high requirements for nucleic acid, especially the integrity of DNA (such as long fragment PCR amplification, third-generation sequencing, etc.), it should be preferred to vortex oscillation or use milder parameters to oscillate, and the requirements for downstream nucleic acid integrity are not high, but the requirements for lysis effect are high, then it is preferred to use a grinding homogenizer and oscillate under more intense parameters. Further, when a vortexer is used for oscillation, the recommended oscillation speed is 800 rpm~3000 rpm, and the oscillation time is 5 min~20 min. In some embodiments, the vortexer is used for oscillation at a speed of 1200 rpm~1500 rpm, and the oscillation time is 10 min; when a grinding homogenizer is used for oscillation, the recommended oscillation speed is 3 m / s~7 m / s, the oscillation time is 15 s~120 s, and the number of oscillation cycles is 2~4 times. In some embodiments, the milder oscillation parameter conditions are an oscillation speed of 4 m / s, an oscillation time of 15 s, and a number of cycles of 2 times, and the more severe oscillation conditions are 6 m / s, an oscillation time of 1 s, and a number of cycles of 1 time.

[0073] It should be noted that complex samples and environmental samples cover a wide range and have different downstream detection purposes. Although most complex samples and environmental samples have a high nucleic acid load, some samples, such as poor soil, enriched surface water / recycled water, and unenriched raw sewage, have a low nucleic acid load despite their complex structure and high inhibitor content. When extracting nucleic acids from such samples, it is necessary to add some necessary chemical additives on the basis of the above process to ensure the extraction and recovery of nucleic acids. The relevant steps and contents are also the substantive discoveries and contributions of this application. For example:

[0074] When the extraction of the above structure is more complex, the inhibitor content is high but the nucleic acid load is small, and the downstream experiment does not include RNA sequencing, in order to ensure the extraction effect, on the basis of the above-mentioned grinding and lysis specific operation method, after a certain volume of lysate is dispensed into the grinding tube, a certain mass of captured RNA should be added to the grinding tube. Specifically, the mass range of captured RNA is 1μg ~10 μg, and the preferred mass range is 2μg ~5 μg. In some embodiments, the amount is 2 μg. Capturing RNA can effectively avoid the loss of nucleic acid caused by nonspecific adsorption during nucleic acid extraction, so it can improve the nucleic acid extraction effect for such special samples, and basically will not cause additional interference to downstream detection experiments including PCR, RT-PCR, qPCR, RT-qPCR and DNA sequencing, but because it itself is a kind of RNA, it will cause greater interference to RNA sequencing, so it is not suitable for downstream related experiments including RNA sequencing.

[0075] When the extraction of the above structure is more complex, the inhibitor content is high but the nucleic acid load is low, and the downstream experiment includes RNA sequencing, in order to ensure the extraction effect, on the basis of the above grinding and lysis specific operation method, after a certain volume of lysate is dispensed into the grinding tube, a certain mass of short RNA with a length of less than 100 nt should be added to the grinding tube. Specifically, the short RNA with a length of less than 100 nt includes yeast tRNA, Escherichia coli tRNA, artificially synthesized short Poly A fragments or short fragments in vitro transcription products, etc. In some embodiments, the above short RNA with a length of less than 100 nt is yeast tRNA, and further, the mass of the short RNA with a length of less than 100 nt added is 5 μg~25 μg. In some embodiments, the added mass concentration is preferably 10 μg~20 μg. Since short RNA <100 nt has the same basic properties of nucleic acid as carrier RNA, it can also effectively avoid nonspecific adsorption of nucleic acid during the extraction process. When RNA library is constructed after the nucleic acid is completed, due to its short length, it will be removed by the sorting magnetic beads after reverse transcription and synthesis of dscDNA, so it will not interfere with subsequent RNA sequencing.

[0076] Step 2: Precipitation of shielding agent (only exemplary operation)

[0077] The purpose of the shielding agent precipitation is at least to selectively precipitate various PCR inhibitors including humic acid, polysaccharides, etc. released after sample lysis using a precipitating liquid. Specifically, the operation steps of grinding and lysis include:

[0078] 1. Place the grinding tube that has completed grinding and lysis in a centrifuge and centrifuge under a certain centrifugal force to separate the grinding medium, cell debris and released dissolved substances. Specifically, the centrifugal force ranges from 5000 g to 15000 g. In some embodiments, the centrifugal force is 10000 g. The centrifugal time ranges from 30 s to 120 s. In some embodiments, the centrifugal time is 60 s.

[0079] 2. Aspirate all the supernatant in the grinding tube after centrifugation and transfer it to a new centrifuge tube, and add a certain volume of precipitation solution thereto. Specifically, the volume of the precipitation solution is 50 μL to 250 μL. In some embodiments, the volume of the precipitation solution is 100 μL.

[0080] 3. Invert the centrifuge tube several times, wait for a period of time, and then place the centrifuge tube in the centrifuge again. Centrifuge under a certain centrifugal force to separate the precipitate and the nucleic acid from which the inhibitor has been removed. In some embodiments, the centrifugal force ranges from 5000 g to 15000 g. In some embodiments, the centrifugal force is 10000 g; the centrifugation time ranges from 30 s to 120 s. In some embodiments, the centrifugation time is 60 s.

[0081] Step 3: Nucleic acid binding (only exemplary operation)

[0082] The purpose of nucleic acid binding is at least to add binding solution and magnetic beads to the nucleic acid from which PCR inhibitors have been removed, to increase the ionic strength and organic solvent ratio in the solution, so that the nucleic acid is adsorbed on the surface of the magnetic beads, thereby achieving the purpose of separating the nucleic acid from other impurities. Specifically, the operation steps of nucleic acid binding include:

[0083] 1. Transfer the supernatant after the shielding agent precipitation to a new centrifuge tube, add a certain proportion of binding solution and a certain mass of silicon hydroxyl magnetic beads according to the volume of the transferred supernatant, specifically, the ratio of the supernatant to the binding solution is in the range of 1:0.8~1:3. In some embodiments, the ratio of the supernatant to the binding solution is preferably 1:1.5, and the amount of the magnetic beads is 5μg~50μg. In some embodiments, the amount of the magnetic beads is 30μg.

[0084] 2. Place the mixture of the supernatant, binding solution and magnetic beads on a vortex and oscillate for a certain period of time to allow the magnetic beads to adsorb nucleic acids. Then briefly centrifuge the centrifuge tube and place it on a magnetic rack. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant.

[0085] Step 4: Rinse impurities (for exemplary operation only)

[0086] The purpose of washing impurities is at least to use washing solutions of different formulas to wash the magnetic beads in sequence, thereby removing protein, small molecule and salt impurities and ensuring that pure nucleic acid is eluted. Specifically, the operation of washing impurities includes:

[0087] 1. Add a certain volume of the first washing solution to the magnetic beads that have bound nucleic acid, fully blow and resuspend the magnetic beads, and then place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume of the first washing solution ranges from 400 to 900 μL. In some embodiments, the volume of the first washing solution is 750 μL.

[0088] 2. Add a certain volume of the second washing solution to the magnetic beads that have been rinsed with the first washing solution, fully blow and resuspend the magnetic beads, and then place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume of the second washing solution ranges from 400 to 900 μL. In some embodiments, the volume of the second washing solution is 750 μL.

[0089] 3. Add a certain volume of the second washing solution to the magnetic beads that have completed the first rinse with the second washing solution, fully blow and resuspend the magnetic beads, and then place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume of the second washing solution ranges from 400 to 900 μL. In some embodiments, the volume of the second washing solution is 750 μL.

[0090] 4. Centrifuge the above centrifuge tube briefly, place it on the magnetic rack again, discard the residual liquid at the bottom again, and air dry it to remove residual ethanol.

[0091] It should be noted that the above impurity rinsing process is a rinsing process when the goal is to recover all DNA / RNA. In some experiments, it is necessary to remove DNA during nucleic acid extraction and retain only RNA. DNA enzyme digestion treatment can be interspersed in the impurity washing step to wash away the DNA adsorbed on the surface of the magnetic beads, thereby retaining only RNA. The relevant steps and contents also belong to the substantial discovery and contribution of this application. Specifically, when it is necessary to remove DNA during the rinsing process and retain only RNA, the operation process of rinsing impurities should be changed to:

[0092] 1. Add a certain volume of the first washing solution to the magnetic beads that have bound nucleic acid, fully blow and resuspend the magnetic beads, and then place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume of the first washing solution ranges from 400 μL to 900 μL. In some embodiments, the volume of the first washing solution is 750 μL.

[0093] 2. Add a certain volume of DNA digestion reaction solution to the magnetic beads that have been rinsed with the first washing solution, fully blow and resuspend the magnetic beads, and then incubate at a certain temperature for a certain time. Specifically, the main components of the above-mentioned DNA digestion reaction solution include: DNA enzyme I (DNase I) and its corresponding reaction buffer, wherein the concentration range of DNA enzyme is 0.01 U / μL~ 0.5 U / μL. In some embodiments, the concentration of the above-mentioned DNA enzyme I is 0.1 U / μL. The above-mentioned incubation temperature ranges from 15°C to 45°C. In some embodiments, the above-mentioned incubation temperature is 37°C. The above-mentioned incubation time ranges from 5 to 60 min. In some embodiments, the above-mentioned incubation time is 15min.

[0094] 3. After the incubation is completed, a certain volume of binding solution is added to the centrifuge tube again. Specifically, the ratio of the supernatant to the binding solution is in the range of 1:0.8 to 1:3. In some embodiments, the ratio of the supernatant to the binding solution is preferably 1:2. The centrifuge tube with the binding solution is placed on a vortex instrument and shaken for a certain period of time to promote the magnetic beads to adsorb nucleic acids. The centrifuge tube is then briefly centrifuged and placed on a magnetic rack. After all the magnetic beads are adsorbed and the supernatant is clarified, all the supernatant is discarded.

[0095] 4. Add a certain volume of the first washing solution to the magnetic beads that have completed DNA digestion, fully blow and resuspend the magnetic beads, and then place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume of the first washing solution ranges from 400 μL to 900 μL. In some embodiments, the volume of the first washing solution is 750 μL.

[0096] 5. Add a certain volume of the second washing solution to the magnetic beads that have been rinsed with the first washing solution, fully blow and resuspend the magnetic beads, and then place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume of the second washing solution ranges from 400 μL to 900 μL. In some embodiments, the volume of the second washing solution is 750 μL.

[0097] 6. Add a certain volume of the second washing solution to the magnetic beads that have completed the first rinse with the second washing solution, fully blow and resuspend the magnetic beads, and then place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume of the second washing solution ranges from 400 μL to 900 μL. In some embodiments, the volume of the second washing solution is 750 μL.

[0098] 7. Briefly centrifuge the above centrifuge tube, place it on the magnetic rack again, discard the residual liquid at the bottom again, and air dry it to remove residual ethanol.

[0099] Step 5: Nucleic acid elution (for exemplary operation only)

[0100] The purpose of nucleic acid elution is at least to finally use a buffer with low ionic strength to elute the nucleic acid adsorbed on the surface of the magnetic beads, thereby obtaining a pure nucleic acid sample.

[0101] In some embodiments, the step of rinsing impurities comprises:

[0102] Using the first washing solution to wash the magnetic beads bound with the nucleic acid to remove impurities, thereby obtaining washed magnetic beads;

[0103] Adding DNase I and its corresponding reaction buffer to the washed magnetic beads to obtain a digestion reaction system, incubating, and obtaining a digestion product;

[0104] The digestion product and the binding solution are mixed in a volume ratio of 1:0.8 to 1:3 to obtain DNA-digested magnetic beads;

[0105] The DNA-digested magnetic beads are washed sequentially with the first washing solution and the second washing solution.

[0106] Exemplarily, the operation of rinsing impurities includes:

[0107] 1. Add a certain volume of eluent to the magnetic beads that have been rinsed of impurities and dried. Specifically, the volume of the eluent ranges from 50 to 500 μL. In some embodiments, the volume of the eluent is 100 μL.

[0108] 2. Place the centrifuge tube with the eluent incubated at a certain temperature for a certain period of time. Specifically, the incubation temperature is in the range of 40-70°C. In some embodiments, the incubation temperature is 60°C, and the incubation time is in the range of 2-15 min. In some embodiments, the incubation time is 10 min.

[0109] 3. Place the above centrifuge tube on the magnetic rack. After the adsorption is completed, the supernatant is the obtained nucleic acid sample.

[0110] The third aspect of the embodiments of the present application provides a semi-automated operation scheme based on the above-mentioned method for efficient DNA / RNA extraction for complex samples including sewage, soil, feces, sediment, sludge, water filter membranes, etc., specifically including a plate reagent distribution scheme and an automated program operation scheme.

[0111] In some embodiments, an automated nucleic acid extractor is used to extract DNA and / or RNA from a complex sample, and each well in a deep-well plate corresponds to one reaction unit.

[0112] In some embodiments, the heating modules of the automated nucleic acid extractor are located in the 1st, 5th, 7th and 11th columns: the binding solution is dispensed in the 1st, 2nd, 7th and 8th columns of the deep-well plate, the first washing solution is dispensed in the 3rd and 9th columns of the deep-well plate, the second washing solution is dispensed in the 4th and 10th columns of the deep-well plate, the eluent is dispensed in the 5th and 11th columns of the deep-well plate, and the magnetic beads are dispensed in the 6th and 12th columns of the deep-well plate. In some embodiments, the operation procedure is performed with reference to Table 1.

[0113] When it is necessary to digest DNA and retain only RNA, the running program is carried out according to Table 2.

[0114] In other embodiments, the heating modules of the automated nucleic acid extractor are located in columns 1, 6, 7, and 12: the binding solution is dispensed in columns 1, 2, 7, and 8 of the deep well plate, the first washing solution is dispensed in columns 3 and 9 of the deep well plate, the second washing solution is dispensed in columns 4 and 10 of the deep well plate, the magnetic beads are dispensed in columns 5 and 11 of the deep well plate, and the elution solution is dispensed in columns 6 and 12 of the deep well plate.

[0115] Specifically:

[0116] For the plate reagent distribution scheme, taking the common 2.2 mL 96-well deep-well plate on the market as an example, due to the large total volume after mechanical grinding and lysis and removal of the shielding agent, in order to ensure that sufficient binding volume is provided, a certain volume of binding solution is evenly distributed in the 1st, 2nd, 7th and 8th columns of the deep-well plate, so that the binding volume is distributed in two wells, thereby realizing operation in a conventional 96-well deep-well plate. Specifically, the volume range of the above binding solution is 400~700 μL. In some embodiments, the volume of the binding solution distributed in the 1st, 2nd, 7th and 8th columns of the deep-well plate is 550 μL. Further, the 3rd and 9th columns of the deep-well plate are distributed with a certain volume of the first washing solution, specifically, the volume range of the first washing solution is 400~900 μL. In some embodiments, the volume of the first washing solution distributed in the 3rd and 9th columns of the deep-well plate is 750 μL. Further, the 4th and 10th columns of the deep well plate are filled with a certain volume of the second washing solution, specifically, the volume range of the second washing solution is 400~900 μL. In some embodiments, the volume of the second washing solution filled in the 4th and 10th columns of the deep well plate is 750 μL. Further, the 6th and 12th columns of the deep well plate are filled with a certain volume of the second washing solution and a certain volume of magnetic beads, specifically, the volume range of the second washing solution is 400~900 μL. In some embodiments, the volume of the second washing solution filled in the 4th and 10th columns of the deep well plate is 750 μL, and the volume range of the magnetic beads is 10~50 μL. In some embodiments, the volume of the second washing solution filled in the 4th and 10th columns of the deep well plate is 30 μL. Further, the 5th and 11th columns of the deep well plate are filled with a certain volume of eluent, specifically, the volume range of the eluent is 50~200 μL. In some embodiments, the volume of the eluent is 100 μL. In particular, since the heating modules of conventional automated nucleic acid extractors on the market are generally located in columns 1, 5, 7, 11 or 1, 6, 7, 12, the above distribution scheme is based on the heating modules in columns 1, 5, 7, 11. For example, in a nucleic acid extraction ritual using heating modules in columns 1, 6, 7, 12, the eluents in columns 5 and 11 should be swapped with the second washing liquid and magnetic beads in columns 6 and 12, and the packaging volume remains unchanged. The above-mentioned adjustment of the plate distribution method caused by different configurations of nucleic acid extractors is an adjustment that can be made by technicians in this field without creative labor, and therefore also falls within the scope of protection of this application.

[0117] For the automated operation scheme, since mechanical grinding and lysis and shielding agent precipitation require the use of other instruments such as grinders and centrifuges, the above two steps are still manually operated and do not cover the scope of automated operation. The steps that need to be covered in automated operation include nucleic acid binding, impurity rinsing and nucleic acid elution. Specifically, without DNA enzyme treatment, all DNA and RNA are recovered. The parameter characteristics of the above automated operation are detailed in Table 2. Specifically, after the manual mechanical grinding and lysis and shielding agent precipitation operations are completed, the supernatant after shielding agent precipitation is divided into half into the sample wells corresponding to the 1st and 2nd columns or the 7th and 8th columns, and then placed in the automated nucleic acid extraction instrument to run the corresponding program. Further, in the corresponding procedure, the automated nucleic acid extractor first moves the magnetic beads stored in the 6th and 12th columns to the 1st and 7th columns to start the first part of the DNA / RNA binding, and then continues to transfer to the 2nd and 8th columns to complete the second part of the DNA / RNA binding, thereby adsorbing the nucleic acid in all samples. In the subsequent procedure, the magnetic beads complete the washing of the first rinse solution and the second rinse solution twice in the 3rd / 9th, 6th / 12th, and 4th / 10th wells, and finally elute the RNA in the elution solution of the 5th and 11th columns. For the automated operation procedure, it is characterized by referring to Table 1 or Table 2.

[0118] Table 1 Runs without DNA digestion to retain all DNA / RNA

[0119]

[0120] Table 2 Procedure for digesting DNA and leaving only RNA

[0121]

[0122] For the case where DNA enzyme treatment is required to recover RNA, the above automated operation program needs to be improved as follows. First, the operations of moving magnetic beads, binding 1, binding 2 and rinsing 1 in Table 2 still need to be retained, but magnetic suction is not performed after rinsing 1, and the magnetic beads are retained in columns 3 and 9, and then the first pause program is inserted. At this time, the plate reagent is taken out, the remaining binding solution in columns 1, 2, 7, and 8 is sucked out with a pipette, and rinsed once with nuclease-free water to remove residual guanidine salts and organic solvents, and then a certain volume (50 μL in some embodiments) of DNA enzyme digestion solution is added to columns 1 and 7, and a certain volume (750 μL in some embodiments) of the first rinse solution is added to columns 2 and 8, and then the extraction is returned to continue running. In the subsequent program, the magnetic beads will be moved from columns 3 and 9 to the DNA enzyme digestion solution in columns 1 and 8, and DNA digestion is completed at a certain temperature (42°C in some embodiments), and then the second pause program is inserted. At this time, remove the plate reagent and add a certain volume of binding solution (550 μL in some embodiments) to the 1st and 7th columns to inactivate the DNA enzyme and recreate the binding environment, then put it back for extraction and continue running. In the subsequent procedures, the magnetic beads will adsorb RNA again, and complete 1 time of the first rinse solution and 2 times of the second rinse solution in the 2 / 8, 6 / 12, and 4 / 10 wells, and finally elute the RNA in the elution solution in the 5th and 11th columns.

[0123] Some examples are provided below.

[0124] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which the conditions are not specified in the following examples are preferably referred to the guidance given in the present application, and can also be based on the experimental manual or normal conditions in the art, or can also be based on the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.

[0125] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0126] In Examples 1 to 17, unless otherwise specified, the grinding media used were all 0.1 mm acid-washed glass beads pre-packed in 2 mL screw-cap centrifuge tubes, with a mass of 0.7±0.1 g. The specific components of the lysate used were: 3 mol / L guanidine isothiocyanate, 1.5 mol / L sodium chloride, 1 mol / L ammonium acetate, 80 mmol / L disodium hydrogen phosphate, 20 mmol / L sodium dihydrogen phosphate, and 0.2% SDS. The specific components of the precipitate used were 50 mmol / L potassium aluminum sulfate dodecahydrate. The binding solution used was 3 mol / L guanidine isothiocyanate, 50 mmol / L tris(hydroxymethylaminomethane), 50 mmol / L ethylenediaminetetraacetic acid, 25% (w / w) isopropanol, and 2% Tween-20. The magnetic beads used were all hydroxyl-modified magnetic beads with a mass concentration of 10 mg / mL. The first washing solution used was 2 mol / L guanidine hydrochloride, 50 mmol / L Tris, 50 mmol / L hydrochloric acid, 40% (w / w) ethanol, 2% Tween-20. The second washing solution used was 10 mmol / L Tris, 10 mmol / L hydrochloric acid, 80% (w / w) ethanol. The elution solution used was 10 mmol / L Tris, 10 mmol / L hydrochloric acid, 0.1 mmol / L ethylenediaminetetraacetic acid, and 0.05% Tween-20. The above chemical reagents were all analytical grade or molecular biology grade reagents purchased from Shanghai MacLean Biochemical Technology Co., Ltd. and prepared with nuclease-free water. Hydroxyl magnetic beads were purchased from Beijing Tiangen Biochemical Technology Co., Ltd.

[0127] In Examples 1 to 17, unless otherwise specified, the grinding homogenizer used is a TGrinder H24 tissue grinder produced by Beijing Tiangen Biochemical Technology Co., Ltd. or a FastPrep-24 5G rapid sample preparation instrument produced by MP. Unless otherwise specified, the working parameters of the grinding homogenizer are: grinding linear speed 6 m / s, grinding time 1 min, and number of cycles 1. The vortexer used is Vortex Genie® 2 produced by Qiagen / MO-BIO. Unless otherwise specified, the working parameters of the vortexer are: maximum speed vortexing, vortexing time 10 min. The centrifuge used is a 5427R desktop high-speed refrigerated centrifuge produced by Eppendorf, Germany. Unless otherwise specified, the centrifugation conditions are all room temperature centrifugation, relative centrifugal force 10,000×g, and centrifugation time 1 min. The automated nucleic acid extractor used is a TGuide S16 fully automatic nucleic acid extraction and purification instrument produced by Beijing Tiangen Biochemical Technology Co., Ltd.

[0128] In Examples 1 to 17, unless otherwise specified, during the nucleic acid extraction process, the sample input amount is 200 μL or 200 mg, the lysis solution amount is 500 μL, the precipitation solution amount is 100 μL, the binding solution amount is 1100 μL, the magnetic beads amount is 30 μL (30 μg), the first rinse solution amount is 750 μL, the rinse times are 1, the second rinse solution amount is 750 μL, the rinse times are 2, and the eluent amount is 100 μL.

[0129] In Examples 1 to 17, unless otherwise specified, the process of nucleic acid extraction using the nucleic acid extraction kit mentioned in the present application is as follows: 1) Take 200 μL or 200 mg of sample, mix with 500 μL of lysis solution, use a grinding homogenizer or a vortexer for mechanical grinding, and then centrifuge at 10,000 × g for 1 min; 2) Take all the supernatant after centrifugation, add 100 μL of precipitation solution, shake at room temperature for 1 min, and then centrifuge again at 10,000 × g for 1 min; 3) Take the supernatant after centrifugation, mix with 1100 binding solution and 30 μL of 10 mg / mL magnetic beads, shake thoroughly for 10 min, place on a magnetic stand, and discard all the supernatant after all the magnetic beads are adsorbed; 4) Add 750 μL of the first washing solution, shake thoroughly for 2 min, place on a magnetic stand, and discard all the supernatant after all the magnetic beads are adsorbed; 5) Add 750 μL of the second washing solution, shake thoroughly for 2 min, place it on the magnetic rack, and discard all the supernatant after all the magnetic beads are adsorbed; 6) add 750 μL of the second washing solution again, shake it thoroughly for 2 min, place it on the magnetic rack, and discard all the supernatant after all the magnetic beads are adsorbed; 7) air dry it for 5 min; 8) add 100 μL of elution solution, shake it thoroughly, incubate it at 60℃ for 10 min, place it on the magnetic rack again, and aspirate the nucleic acid after all the magnetic beads are adsorbed.

[0130] In Example 1 to 17, the one-step reverse transcription real-time fluorescence quantitative kit used to amplify and detect the concentration of target DNA / RNA sequence in the sample is Hieff Unicon® V Universal Multiplex One Step RT-qPCRProbe Kit, purchased from Yishen Biotechnology (Shanghai) Co., Ltd. The forward primer for detecting porcine epidemic diarrhea virus is (SEQ ID No.1): CCGTGGTGAGCGAATTGAA, the reverse primer is (SEQ ID No.2): GGTCCTGTTCCGAGGTATAGAA, and the probe is (SEQ ID No.3): AACCTTCCAATTGGC, wherein the 5' end of the probe is modified with a fluorescent reporter group FAM, and the 3' end is modified with a fluorescent quencher group MGB. The forward primer for detecting norovirus type GII is (SEQ ID No.4): CARGARBCNATGTTYAGRTGGATGAG, the reverse primer is (SEQ ID No.5): TCGACGCCATCTTCATTCACA, and the probe is (SEQ ID No.6): TGGGAGGGCGATCGCAATCT, wherein the 5' end of the probe is modified with a fluorescent reporter group ROX, and the 3' end is modified with a fluorescent quencher group BHQ2. The forward primer for detecting polyoma virus is (SEQ ID No.7): AGTCTTTTAGGGTCTTCTACCTTT, and the reverse primer is (SEQ ID No.8): GGTGCCAACCTATGGAACAG, the probe is (SEQ ID No.9): TCATCACTGGCAAACAT, wherein the 5' end of the probe is modified with a fluorescent reporter group ROX, and the 3' end is modified with a fluorescent quencher group MGB, the artificially synthesized RNA fragment used to detect whether there is reverse transcription and PCR inhibition is (SEQ ID No.10): ATGTTCAAGCTGTTAATATCAATCTCGATAAA CGTGAACAGGCTGTCGGAGCCACAGTTTCGAGACGAGGAGATTTAGAAATGTTGGGATTATTGCATGATAGAATGGTTCAGTGGCAAA, the forward primer used to detect the above artificially synthesized RNA fragment is (SEQ ID No.11): ATGTTCAAGCTGTTAATATCAATCTCG, the reverse primer is (SEQ ID No.12): TTTGCCACTGAACCATTCTATCAT, the probe is (SEQ ID No.13): CTGTCGGAGCCACAGTTTCGAGACG, wherein the 5' end of the probe is modified with a fluorescent reporter group FAM, and the 3' end is modified with a fluorescent quencher group BHQ1.

[0131] In Examples 1 to 17, the real-time fluorescence quantitative PCR program for amplifying and detecting target DNA / RNA sequences in samples is shown in Table 3.

[0132] Table 3 Real-time fluorescence quantitative PCR reaction procedure

[0133]

[0134] To ensure biosafety, all experiments involving extraction and detection of virus-containing samples in Examples 1 to 17 were carried out in a biosafety level P2 laboratory.

[0135] Example 1: Comparison of the effects of mechanical grinding and lysis and enzymatic lysis on complex sample lysis

[0136] In order to verify whether the mechanical grinding lysis method selected in the present invention is the optimal lysis and nucleic acid release method for complex samples including sewage, soil, feces, sediment, sludge, water filter membrane, etc. Direct thermal lysis and protease hydrolysis were selected as comparative examples, nucleic acid was extracted from the enriched sewage samples, and the lysis effects of the three lysis methods were compared by detecting the CT value of the spiked virus.

[0137] The specific experimental steps include:

[0138] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, it was enriched to 1 mL using ultrafiltration.

[0139] 2. Sample lysis: Take 200 μL of the enriched sewage sample, mix it with 500 μL of lysis solution, and use thermal lysis method (place it in a metal bath, heat it at 95℃ for 10 minutes), proteinase K digestion method (add proteinase K to a final concentration of 500 mg / mL, heat it at 65℃ for 10 minutes) and mechanical grinding lysis method (place the sample and lysis solution in the grinding medium, grind and homogenize it on the grinder at 6m / s for 1 minute). Set up 3 technical replicates for each of the three methods.

[0140] 3. Nucleic acid recovery and detection: After the treatment, centrifuge at 10000×g for 1min to remove large particles, take 100μL of supernatant, use 1.8× RNA purification and recovery magnetic beads to purify and recover the RNA fragments released by lysis, and elute to 40 μL with nuclease-free water, and use Qubit RNA HS assay kit to detect RNA concentration to determine the nucleic acid release effect of the three methods. The RNA concentrations under three different lysis methods are shown in Table 4 (RNA concentrations are shown in the form of mean ± SD). It can be seen that the RNA concentration released by mechanical grinding lysis method is the highest, while the concentrations obtained by thermal lysis method and proteinase K digestion method are both low. Therefore, mechanical lysis method is the best lysis method for complex samples including sewage, soil, feces, sediment, sludge, water filter membrane, etc.

[0141] Table 4 Comparison of the effects of different lysis methods on the release of nucleic acids in samples

[0142]

[0143] Example 2: Comparison of the lysis effects of different grinding media on complex samples

[0144] For the mechanical grinding and lysis method, the material of the grinding medium has an important influence on the lysis effect. Therefore, in order to select the best grinding material, 0.1 mm, 0.5 mm, 1 mm acid-washed glass beads and 1 mm zirconium beads were selected as grinding materials, and their nucleic acid extraction effects were compared to select the best grinding material.

[0145] The specific experimental steps include:

[0146] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 50,000 copies / mL and enriched to 1 mL using ultrafiltration.

[0147] 2. Sample lysis: Take 200 μL of the enriched sewage sample, mix it with 500 μL of lysis buffer and place it in a 2 mL screw-cap centrifuge tube. Add 0.7 g of 0.1 mm, 0.5 mm, 1 mm acid-washed glass beads and 1 mm zirconium beads as grinding materials, respectively. Then use a grinding homogenizer to grind it. Set up 3 technical replicates for each condition.

[0148] 3. Nucleic acid extraction and recovery: After grinding, centrifuge at 10,000 × g for 1 min to remove large particles, take 200 μL of supernatant, and use MagMAX Viral / Pathogen Nucleic Acid Isolation Kit produced by Thermo Fisher to extract and recover nucleic acids.

[0149] 4. Sample detection: One-step reverse transcription real-time fluorescence quantitative PCR was used to detect the CT value of spiked PEDV. The results are shown in Table 5 (CT values ​​are presented as mean ± SD). The results show that the use of 0.1 mm acid-washed glass beads as grinding materials for mechanical lysis has a better effect. Therefore, 0.1 mm glass beads were selected as the grinding material in the grinding medium pre-packed in a screw-capped centrifuge tube.

[0150] Table 5 Comparison of mechanical grinding and cracking effects using different grinding materials

[0151]

[0152] Example 3: Comparison of the effects of different chaotropic salt concentrations in lysate on nucleic acid extraction from complex samples

[0153] For complex samples including sewage, soil, feces, sediment, sludge, water filter membranes, etc., which contain a large amount of impurities and nucleases, mechanical lysis can only destroy the higher-level structure of the sample but cannot inactivate the nuclease. In order to ensure the inactivation effect of nucleases, the concentration of the chaotropic salt in the lysis solution is optimized to obtain a lysis system with the best nuclease inactivation effect.

[0154] The specific experimental steps include:

[0155] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL and enriched to 1 mL using ultrafiltration.

[0156] 2. Preparation of lysis buffer: prepare lysis buffer with guanidine thiocyanate concentrations of 1 mol / L, 2 mol / L, and 3 mol / L respectively, and keep the concentrations of other components unchanged.

[0157] 3. Nucleic acid extraction: Except for using lysis buffers with different components, all other operating conditions remained unchanged, and 3 technical replicates were set for each lysis buffer condition.

[0158] 4. Sample detection: One-step reverse transcription real-time fluorescence quantitative PCR was used to detect the CT value of spiked PEDV. The results are shown in Figure 6 (CT value is presented in the form of mean ± SD). The results show that with the increase of guanidine thiocyanate concentration, the CT value of the final sample to be tested gradually decreases, indicating that high concentrations of guanidine thiocyanate are more conducive to sample lysis and nuclease inactivation. Therefore, 3 mol / L was selected as the optimal concentration of guanidine thiocyanate in the lysis buffer.

[0159] Table 6 Comparison of mechanical lysis effects with different lysis buffer chaotropic salt concentrations

[0160]

[0161] Example 4: Comparison of the extraction effect of adding controlled chemical reagents to the optimized lysate

[0162] For the common nucleic acid extraction kits on the market for complex samples including sewage, soil, feces, sediment, sludge, water filter membranes, etc., chemical reagents such as β-mercaptoethanol, phenol: chloroform: isoamyl alcohol = 25:24:1 are often added during lysis to enhance the lysis effect. However, since these reagents are highly toxic or regulated chemicals, they may affect the health of operators and make it difficult for a large number of experimenters to purchase them. Therefore, in order to verify whether the lysis solution prepared in this application needs to add the above chemicals, nucleic acid extraction is carried out with and without the addition of the above hazardous chemicals to verify the relevant extraction effect.

[0163] The specific experimental steps include:

[0164] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL and enriched to 1 mL using ultrafiltration.

[0165] 2. Nucleic acid extraction: After mixing 200 μL of sample with 500 μL of lysis buffer, add mercaptoethanol to a final concentration of 1% (w / w) and β-mercaptoethanol, phenol: chloroform: isoamyl alcohol = 25:24:1 to a final concentration of 20% (w / w), and set up a sample with only lysis buffer added as a control without adding other chemicals. Set up 3 technical parallels for each condition, and keep the other conditions unchanged.

[0166] 3. Sample testing: One-step reverse transcription real-time fluorescence quantitative PCR was used to detect the CT value of spiked PEDV, and the results are shown in Table 7 (CT values ​​are presented as mean ± SD). It can be seen that regardless of whether the above-mentioned hazardous chemicals or controlled reagents are added, the CT of the spiked virus in the extracted nucleic acid is not significantly affected. Therefore, the lysis solution and lysis system involved in this application can achieve efficient lysis of complex samples such as sewage, soil, feces, sediment, sludge, water filter membranes, etc. without the need to add other hazardous chemicals or chemical reagents of concern, which can greatly expand the scope of application of the kit and protect the health of operators.

[0167] Table 7 Comparison of the effects of adding other chemical reagents on the extraction effect

[0168]

[0169] Example 5: Comparison of the pyrolysis effects of different mechanical grinding methods on complex samples

[0170] At present, there are two common mechanical grinding and lysis methods on the market: lysis using a high-speed grinding homogenizer and lysis using a vortex instrument. In order to verify whether the lysis system involved in this application is compatible with both lysis methods and whether the results of the two lysis methods are consistent, the same sample was used for testing using different mechanical lysis methods.

[0171] The specific experimental steps include:

[0172] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL and enriched to 1 mL using ultrafiltration.

[0173] 2. Nucleic acid extraction: 200 μL of sample was mixed with 500 μL of lysis buffer and transferred into lysis medium. The samples were homogenized for 1 min using a grinder at a linear speed of 6 m / s and for 10 min using a vortexer at the highest speed. Three technical replicates were set for each condition, and the other conditions remained unchanged.

[0174] 3. Sample testing: One-step reverse transcription real-time fluorescence quantitative PCR was used to detect the CT value of spiked PEDV, and the results are shown in Table 8 (CT values ​​are presented as mean ± SD). It can be seen that regardless of whether a grinding homogenizer or a vortex instrument is used, under the above-mentioned mechanical force disruption conditions, the CT value of the spiked virus in the final extracted nucleic acid remains basically consistent, indicating that the lysis system involved in the present application has a certain consistency in the results of the two lysis methods of the grinding homogenizer and the vortex instrument, and can be compatible with two different mechanical force lysis modes.

[0175] Table 8 Effects of different mechanical force lysis modes on extraction effect

[0176]

[0177] Example 6: Comparison of the effects of different mechanical lysis intensities on the integrity of extracted nucleic acids

[0178] In practical applications, after nucleic acid extraction from complex samples such as sewage, soil, feces, sediment, sludge, and water filter membranes, a wide range of downstream experiments are conducted, including third-generation sequencing or long-fragment PCR, which may require high DNA or RNA integrity. In this case, it is necessary to balance the effect of mechanical force action time on DNA and RNA integrity. To evaluate this effect, the action parameters of the two mechanical force grinding methods, the grinding homogenizer and the vortex instrument, are optimized to ensure that relevant solutions for maintaining DNA and RNA integrity are provided under certain requirements.

[0179] The specific experimental steps include:

[0180] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, it was enriched to 1 mL using ultrafiltration.

[0181] 2. Nucleic acid extraction: 200 μL of sample was mixed with 500 μL of lysis buffer and transferred into lysis medium. The samples were homogenized at a linear speed of 6 m / s for 1 min or at a linear speed of 4 m / s for 15 s and repeated for 2 cycles. The samples were also homogenized at the highest speed using a vortex machine for 5 min and 10 min. The other conditions remained unchanged.

[0182] 3. Sample digestion: For the extracted nucleic acids, use RNase A to digest RNA and DNase I to digest DNA, and then use DNA or RNA recovery and purification magnetic beads to recover DNA or RNA.

[0183] 4. The DIN and RIN values ​​of the recovered DNA and RNA were determined using an Agilent 4200 capillary electrophoresis analyzer. The results are shown in Table 9. It can be seen that, in general, different mechanical lysis methods have little effect on the RIN value (i.e., RIN integrity), but have a relatively large effect on DNA integrity. Among them, the DNA integrity when mechanically lysed using a vortexer is better than that of a grinding homogenizer. Based on the above results, it is recommended that when the downstream experiment of nucleic acid extraction has high requirements for DNA integrity, a vortexer can be used for mechanical lysis, or for samples with complex advanced structures, the parameters of the grinding homogenizer can be changed to homogenize at a linear speed of 4 m / s for 15s and repeat 2 cycles.

[0184] Table 9 Effects of different mechanical forces on the integrity of DNA and RNA

[0185]

[0186] Example 7: Comparison of the effect of different solubilizing agent concentrations in lysate on the ability of the precipitate to retain RNA

[0187] Since the aluminum hydroxide colloid formed during the precipitation process will indifferently adsorb negatively charged biomacromolecules in the solution, especially RNA molecules, in order to ensure that the PCR inhibitors are removed while avoiding the loss of DNA and RNA molecules as much as possible when adding the precipitation solution, a solubilizer needs to be added to the lysate to enhance the hydrophilicity of DNA and RNA molecules, thereby increasing the nucleic acid yield. Therefore, it is necessary to optimize whether to add a solubilizer and the type of solubilizer.

[0188] The specific experimental steps include:

[0189] 1. Preparation of lysis buffer: prepare lysis buffers containing ammonium acetate at final concentrations of 0 mol / L, 0.2 mol / L and 0.5 mol / L respectively, and keep the concentrations of other components unchanged.

[0190] 2. Simulated precipitation experiment: Yeast RNA and herring sperm DNA were added to the lysate to a final concentration of 20 ng / μL and 10 ng / μL, respectively. 200 μL of nuclease-free water was added instead of the sample, followed by 100 μL of precipitation solution. The mixture was thoroughly mixed and centrifuged. Three technical replicates were set for each condition.

[0191] 3. Sample monitoring: Take the supernatant after centrifugation, use Qubit dsDNA HS assay kit and QubitRNA HS assay kit to detect the concentration of DNA and RNA in the supernatant after precipitation, and calculate the proportion of DNA and RNA still suspended in the supernatant after precipitation. The results are shown in Table 10 (the proportion is shown in the form of mean ± SD). It can be seen that when no solubilizer is added, nearly 80% of DNA and almost 100% of RNA will be precipitated after adding the precipitation solution. Therefore, a solubilizer must be added to ensure that the PCR inhibitor is removed while retaining the nucleic acid. As the concentration of the solubilizer increases, when the ammonium acetate concentration rises to 0.5 mol / L, the proportion of DNA and RNA in the supernatant can reach more than 70%. Therefore, 0.5 mol / L is selected as the optimal final concentration of ammonium acetate.

[0192] Table 10 The proportion of nucleic acids in the supernatant after precipitation at different solubilizer concentrations

[0193]

[0194] Example 8: Comparison of the effects of different eluents on nucleic acid extraction

[0195] When eluting nucleic acids, it is necessary to comprehensively consider the effects of pH value, ionic strength and trace surfactants to ensure the effective elution of nucleic acids from the surface of magnetic beads as much as possible and provide a certain inhibitory effect on nucleases. Therefore, different nucleic acid elution solutions were optimized to determine the optimal type of nucleic acid elution solution.

[0196] The specific experimental steps include:

[0197] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, it was enriched to 1 mL using ultrafiltration.

[0198] 2. Preparation of eluents: Use nuclease-free water to prepare 10 mmol / L tris-hydrochloric acid (eluent A), 10 mmol / L tris-hydrochloric acid + 0.05% Tween-20 (eluent B), 10 mmol / L tris-hydrochloric acid + 1 mmol / L ethylenediaminetetraacetic acid (eluent C), 10 mmol / L tris-hydrochloric acid + 1 mmol / L ethylenediaminetetraacetic acid (eluent D) + 0.05% Tween-20 (eluent E), 10 mmol / L tris-hydrochloric acid + 0.1 mmol / L ethylenediaminetetraacetic acid (eluent F), 10 mmol / L tris-hydrochloric acid + 0.1 mmol / L ethylenediaminetetraacetic acid + 0.05% Tween-20 solution (elution buffer G) and 7 elution buffers were used, and the pH value of the solution was adjusted to 8.0±0.2. At the same time, nuclease-free water was used as a control (elution buffer CK).

[0199] 3. Nucleic acid extraction: Perform nucleic acid extraction according to the conventional procedure until the magnetic beads are dried, then add 6 different elution buffers or nuclease-free water to the magnetic beads to elute the nucleic acids. Set up 3 technical parallels for each different condition.

[0200] 4. The DNA concentration in different elution solutions was determined using the Qubit dsDNA HS assay kit, and the results are shown in Table 11 (the concentration is presented as mean ± SD). In general, the DNA concentration eluted by each elution solution was higher than that of the nuclease water, indicating that the weakly alkaline pH value is conducive to the elution of nucleic acids. At the same time, the elution effect of the elution solution containing Tween-20 was slightly improved compared with the elution solution without Tween-20, but the effect of whether ethylenediaminetetraacetic acid was contained on the elution effect was not obvious. Considering that ethylenediaminetetraacetic acid has a certain protective effect on the long-term storage of nucleic acids, but high concentrations of ethylenediaminetetraacetic acid may inhibit some downstream reactions, 10 mmol / L tris(hydroxymethyl)aminomethane-hydrochloric acid + 0.1 mmol / L ethylenediaminetetraacetic acid + 0.05% Tween-20 solution was selected as the preferred elution solution for the kit in this application, taking into account the effects of all aspects.

[0201] Table 11 Nucleic acid concentrations eluted with different elution buffers

[0202]

[0203] Example 9: Verification of RT-qPCR inhibition of samples extracted by optimized extraction method

[0204] Since complex samples including sewage, soil, feces, sediment, sludge, water filter membranes, etc. contain a large number of inhibitors, they may interfere with downstream reverse transcription and PCR reactions. In order to verify whether the nucleic acid extraction kit and the corresponding nucleic acid extraction method involved in this application can effectively remove various inhibitors in complex samples, artificially synthesized non-natural RNA fragments are used for spiking to verify whether the extracted nucleic acid samples have RT-qPCR inhibition.

[0205] The specific experimental steps include:

[0206] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, it was enriched to 1 mL using ultrafiltration.

[0207] 2. Nucleic acid extraction: Extract nucleic acids according to conventional procedures.

[0208] 3. For the addition and detection of exogenous artificial fragments, an artificial non-natural RNA fragment (SEQID No. 10) synthesized by full chemical synthesis was used as an exogenous addition fragment. Specifically, 40,000 copies of the fragment were added to 20 μL of extracted nucleic acid sample and 20 μL of nucleic acid eluate, and the CT value of the artificial exogenous non-natural sequence was detected by one-step reverse transcription real-time fluorescence quantitative PCR, with 6 technical parallels for each detection. The CT values ​​of the added exogenous RNA fragments are shown in Table 12 (CT values ​​are displayed in the form of mean ± SD). It can be seen that the CT values ​​of the exogenous added sequences with the same copy number are basically the same in the extracted nucleic acid sample and the blank eluate, indicating that the nucleic acid sample extracted according to the nucleic acid extraction kit and the corresponding nucleic acid extraction method involved in this application contains almost no RT-qPCR inhibitors, that is, no serious reverse transcription or PCR amplification inhibition will occur.

[0209] Table 12 RT-qPCR inhibition of samples extracted by the optimized extraction method

[0210]

[0211] Example 10: Comparison of the nucleic acid extraction method proposed in this application with other commercial kits at home and abroad in extracting complex samples

[0212] In order to determine the improvement in the effect of the nucleic acid extraction kit and the corresponding nucleic acid extraction method involved in this application compared with the existing products on the market, three clinical nucleic acid sample extraction kits and two other nucleic acid extraction kits for complex environmental samples were selected for comparison to verify the advanced nature of the nucleic acid extraction kit involved in this application.

[0213] The specific experimental steps include:

[0214] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL and enriched to 1 mL using ultrafiltration.

[0215] 2. Nucleic acid extraction: The nucleic acid extraction kits involved in this application perform nucleic acid extraction according to conventional procedures. Three clinical sample nucleic acid extraction kits and two environmental sample nucleic acid extraction kits are additionally selected for comparison. The sample extraction volume of each kit is 200 μL and the elution volume is 100 μL. The extraction process of other kits is carried out with reference to the instructions of the corresponding kits.

[0216] 3. Sample testing: One-step reverse transcription real-time fluorescence quantitative PCR was used to detect the CT value of spiked PEDV, and the CT value of endogenous Norovirus GII and polyomavirus in sewage was also detected. The results are shown in the attached Figure 1 As shown in the attached figure, it can be seen that when the same sample is extracted again, the CT values ​​of the three viruses extracted by the kit involved in the present application are the lowest, indicating that the kit involved in the present application is more advanced than existing market products in terms of the effect of extracting complex samples.

[0217] Example 11: Verification of the effect of optimization and improvement for samples with high complexity and low nucleic acid content

[0218] Since complex samples including sewage, soil, feces, sediment, sludge, water filter membrane, etc. have great diversity, some samples have high inhibitor content but low nucleic acid content. For such samples, it is necessary to add a certain type and concentration of nucleic acid precipitation aid to the lysate according to the purpose of downstream experiments to ensure the extraction effect. Therefore, whether to add nucleic acid precipitation aid and the effect of adding are verified.

[0219] The specific experimental steps include:

[0220] 1. Sample collection and enrichment: The reclaimed water (effluent from a sewage treatment plant) to be tested was taken from a large reclaimed water plant in Beijing. After 1000 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 5 copies / mL and enriched to 0.5 mL using the ferric chloride flocculation method.

[0221] 2. Nucleic acid extraction: 200 μL of sample was mixed with 500 μL of lysis buffer and transferred into lysis medium. 2 μg of captured RNA (PolyA) and 10 μg of yeast tRNA were added respectively. A sample without any additional precipitation agent was set as a control. Three technical parallels were set for each condition. The rest of the operation was carried out according to the conventional procedure for nucleic acid extraction, except that yeast tRNA was added to the eluate of the 10 μg yeast tRNA group to 20 ng / μL.

[0222] 3. Sample detection: One-step reverse transcription real-time fluorescence quantitative PCR was used to detect the CT value of spiked PEDV. The results are shown in Table 13 (CT values ​​are presented in the form of mean ± SD). It can be seen that for samples with high inhibitor content but low nucleic acid content in enriched recycled water, if no additional precipitation aid is added, a large amount of nucleic acid will be non-specifically adsorbed during grinding and precipitation, thereby interfering with the effect of nucleic acid recovery. The addition of two different nucleic acid precipitation aids can significantly improve the recovery of trace nucleic acids in such samples. However, since the captured RNA (Poly A) is a long nucleic acid, it will occupy a large amount of data when RNA sequencing is required in downstream experiments, while short nucleic acids such as yeast tRNA that are less than 100nt can be removed after synthesizing dscDNA, which theoretically will not affect sequencing. To verify the above hypothesis, the nucleic acid sample was taken, and a total RNA library was constructed after DNaseI treatment. PE150 sequencing was performed using the Illumina platform. The sequencing results were analyzed to confirm that there was no yeast tRNA sequence, indicating that the above design idea is feasible. Therefore, when using the kit involved in this application to extract samples with high inhibitor content but low nucleic acid content, it is recommended to add captured RNA (without RNA library construction) or short RNA < 100 nt (with RNA library construction) as a precipitation aid to ensure the nucleic acid extraction effect according to the purpose of the downstream experiment.

[0223] Table 13 Effect of adding precipitation aid on the extraction of samples with high inhibitor content but low nucleic acid content

[0224]

[0225] Example 12: Verification of the feasibility of DNA digestion during the impurity washing process

[0226] The present application provides a method for nucleic acid extraction involving digesting DNA during rinsing and retaining only RNA samples, thereby avoiding digestion after nucleic acid extraction and simplifying the experimental process. To determine the feasibility of the scheme, the enzymatic effect of DNA on real samples was verified.

[0227] The specific experimental steps include:

[0228] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, it was enriched to 1 mL using ultrafiltration.

[0229] 2. Nucleic acid extraction: After mechanical grinding and lysis, shielding agent precipitation, nucleic acid binding and first washing solution rinsing according to the conventional procedures, add 50 μL of DNA digestion working solution with a DNase I concentration of 0.5 U / μL, an RNase Inhibitor concentration of 2U / μL, and a DNase I reaction solution concentration of 1× to the magnetic beads, and place them at 37°C for digestion for 15 min. After the digestion reaction is completed, add 450 μL of binding solution again and shake it thoroughly for 5 min, place it on the magnetic stand, discard the supernatant, and continue to rinse with the first washing solution, rinse with the second washing solution, and dry and elute according to the conventional process. In addition, set up samples for DNA / RNA co-extraction completely according to the conventional procedures as controls, and set up 3 technical replicates for each condition.

[0230] 3. Sample detection: Qubit dsDNA HS assay kit and Qubit RNA HS assay kit were used to detect the DNA and RNA concentrations of the extracted nucleic acids, and the results are shown in Table 14. It can be seen that after DNA enzyme digestion, more than 90% of the extracted DNA can be removed, while more than 70% of the RNA can be retained, indicating that inserting DNA enzyme digestion during the impurity rinsing process can effectively remove DNA in the sample and retain RNA, thereby simplifying the experimental process.

[0231] Table 14 Verification of the feasibility of DNA enzyme digestion during the rinse process

[0232]

[0233] Example 13: Verification of the consistency of semi-automated nucleic acid extraction and manual nucleic acid extraction

[0234] The present application provides a semi-automatic nucleic acid extraction scheme in combination with a commonly available fully-automatic nucleic acid extraction instrument on the market, which relates to a nucleic acid extraction kit and a nucleic acid extraction method. That is, after mechanical grinding and crushing and shielding agent precipitation, subsequent operations are performed using reagents pre-packaged in a 96-well deep-well plate. In order to verify the consistency of the semi-automatic scheme and the fully manual scheme, the same sample is used for manual and semi-automatic nucleic acid extraction, thereby comparing the consistency of the results.

[0235] The specific experimental steps include:

[0236] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL and enriched to 1 mL using ultrafiltration.

[0237] 2. Nucleic acid extraction: The fully manual method was used to extract nucleic acid according to conventional procedures. The semi-automatic method was used to mechanically grind and crush the nucleic acid and remove the shielding agent according to the conventional process. Then, the nucleic acid was extracted using plate reagents pre-packed in 96-well deep-well plates and a fully automatic nucleic acid extractor according to the procedures shown in Table 3. In order to compare the consistency of the effects of manual and automatic extraction, 8 technical parallels were set for both methods.

[0238] 3. Sample testing: One-step reverse transcription real-time fluorescence quantitative PCR was used to detect the CT value of spiked PEDV. The results are shown in Table 15 (CT values ​​are presented as mean ± SD). It can be seen that the CT values ​​of the final test using the fully manual method or semi-automatic nucleic acid extraction are basically the same, indicating that the nucleic acids extracted by the two methods are consistent, that is, the nucleic acid extraction kit and nucleic acid extraction method involved in this application can be combined with the existing common nucleic acid extraction instruments on the market to achieve semi-automatic nucleic acid extraction, thereby reducing the number of necessary manual operations, reducing the pressure on detection personnel and improving sample parallelism.

[0239] Table 15 Comparison of the consistency of results between manual and semi-automatic nucleic acid extraction

[0240]

[0241] Example 14: Verification of the applicability of the nucleic acid extraction method proposed in this application to extract enriched sewage samples

[0242] In order to verify the applicability of the nucleic acid extraction kit and nucleic acid extraction method involved in this application for sewage samples enriched by different pretreatment methods, sewage samples enriched by three methods, namely polyethylene glycol precipitation, aluminum salt flocculation and ultrafiltration separation, were selected to verify the applicability of the nucleic acid extraction method.

[0243] The specific experimental steps include:

[0244] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL. The samples were concentrated and enriched to 1 mL using polyethylene glycol precipitation, aluminum salt flocculation, and ultrafiltration separation methods.

[0245] 2. Nucleic acid extraction: Extract nucleic acids according to conventional procedures.

[0246] 3. Sample testing: One-step reverse transcription real-time fluorescence quantitative PCR was used to detect the CT value of spiked PEDV, and the standard curve was used for quantification to calculate the recovery rate of the entire process from enrichment to extraction of the spiked virus. The results are shown in Table 16 (the recovery rate is presented in the form of mean ± SD). The results show that the nucleic acid extraction kit involved in this application can achieve good nucleic acid extraction effect and recovery rate for sewage samples enriched by three methods, indicating that the nucleic acid extraction kit and method involved in this application are suitable for sewage samples enriched by different pre-treatment methods.

[0247] Table 16 Recovery rates of spiked viruses in the whole process of sewage samples enriched by different pre-treatment methods

[0248]

[0249] Example 15: Verification of the applicability of the nucleic acid extraction method proposed in this application to extract soil samples

[0250] In order to verify the applicability of the nucleic acid extraction kit and the nucleic acid extraction method involved in the present application to soil samples, three different soil samples were selected to verify the applicability of the nucleic acid extraction method.

[0251] The specific experimental steps include:

[0252] 1. Sample collection and processing: Three soil samples were collected from farmland, forests and ornamental plant pots around Beijing. Before nucleic acid extraction, 10 g of soil was washed three times with 20 mL of PBS buffer to remove inorganic minerals by taking advantage of the different sedimentation coefficients of soil mineral particles and biomass, thereby retaining the biomass-rich part for nucleic acid extraction.

[0253] 2. Nucleic acid extraction: Extract nucleic acids according to conventional procedures.

[0254] 3. Sample testing: Qubit dsDNA HS assay kit and Qubit RNA HS assay kit were used to detect the DNA and RNA concentrations of the extracted nucleic acids, and Nanodrop 2000 was used to detect the purity of the extracted samples. The results are shown in Table 17. The results show that the nucleic acid extraction kit involved in the present application can effectively extract nucleic acids with high purity from the three types of soil samples, indicating that the nucleic acid extraction kit and method involved in the present application are suitable for soil samples.

[0255] Table 17 Nucleic acid concentration and purity results of different soil samples

[0256]

[0257] Example 16: Verification of the applicability of the nucleic acid extraction method proposed in this application to extract fecal samples

[0258] In order to verify the applicability of the nucleic acid extraction kit and the nucleic acid extraction method involved in the present application to soil samples, three different feces samples were selected to verify the applicability of the nucleic acid extraction method.

[0259] The specific experimental steps include:

[0260] 1. Sample collection and processing: Three fecal samples were collected from three different experimental mice. Fecal samples were immediately stored in RNAlater protective solution and stored at -80°C until extraction.

[0261] 2. Nucleic acid extraction: Extract nucleic acids according to conventional procedures.

[0262] 3. Sample testing: Qubit dsDNA HS assay kit and Qubit RNA HS assay kit were used to detect the DNA and RNA concentrations of the extracted nucleic acids, and Nanodrop 2000 was used to detect the purity of the extracted samples. The results are shown in Table 18. The results show that the nucleic acid extraction kit involved in the present application can effectively extract nucleic acids with high purity from fecal samples, indicating that the nucleic acid extraction kit and method involved in the present application are suitable for fecal samples.

[0263] Table 18 Nucleic acid concentration and purity results of different fecal samples

[0264]

[0265] Example 17: Verification of the applicability of the nucleic acid extraction method proposed in this application to extract sediment samples

[0266] In order to verify the applicability of the nucleic acid extraction kit and the nucleic acid extraction method involved in the present application to sediment samples, three different sediment samples were selected to verify the applicability of the nucleic acid extraction method.

[0267] The specific experimental steps include:

[0268] 1. Sample collection and processing: Three sediment samples were collected from digested sludge sediments of three anaerobic digestion plants in Beijing. Before nucleic acid extraction, 10 mL of each sediment was placed in a centrifuge tube and centrifuged at 8000×g for 15 min. The precipitate was then taken for nucleic acid extraction.

[0269] 2. Nucleic acid extraction: Extract nucleic acids according to conventional procedures.

[0270] 3. Sample testing: Qubit dsDNA HS assay kit and Qubit RNA HS assay kit were used to detect the DNA and RNA concentrations of the extracted nucleic acids, and Nanodrop 2000 was used to detect the purity of the extracted samples. The results are shown in Table 19. The results show that the nucleic acid extraction kit involved in the present application can effectively extract nucleic acids with high purity from sediment samples, indicating that the nucleic acid extraction kit and method involved in the present application are suitable for sediment samples.

[0271] Table 19 Nucleic acid concentration and purity results of samples extracted from different sediment types

[0272]

[0273] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0274] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description and drawings may be used to interpret the contents of the claims.

[0275] The above-described embodiments only express several implementation methods of the present application, which is convenient for understanding the technical solution of the present application in detail, but it cannot be understood as a limitation on the scope of protection of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present application, several deformations and improvements can be made, which all belong to the protection scope of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, the technicians in this field can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by the technicians in this field through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the protection scope of the claims attached to the present application. Therefore, the protection scope of the patent of the present application shall be based on the content of the attached claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. A kit for efficiently extracting DNA and / or RNA from complex samples, characterized in that: It includes a lysis medium, a lysis solution, a precipitation solution, a binding solution, a magnetic bead storage solution, a first washing solution, a second washing solution and an elution solution; wherein: The cracking medium comprises hard particles, and the particle size of the cracking medium is 0.1 mm to 3 mm; The lysate comprises 10 mmol / L to 100 mmol / L buffer salt, 1 mol / L to 4 mol / L chaotropic salt, 0.01 wt% to 1wt% detergent and 0.5 mol / L to 3 mol / L RNA solubilizing agent; The precipitant used in the precipitating solution includes one or more of aluminum sulfate, potassium aluminum sulfate dodecahydrate, ammonium aluminum sulfate dodecahydrate, basic aluminum sulfate, aluminum chloride, basic aluminum chloride, ferric chloride and lanthanum chloride, and the concentration of the precipitant in the precipitating solution is 10 mmol / L to 500 mmol / L; The binding solution comprises 10 mmol / L to 100 mmol / L buffer salt, 1 mol / L to 5 mol / L chaotropic salt, 10 wt% to 30 wt% organic solvent and 0.1 wt% to 5 wt% surfactant; The magnetic beads in the magnetic bead storage solution include one or more of ferroferric oxide magnetic beads wrapped by hydroxyl-modified silica, ferroferric oxide magnetic beads wrapped by epoxy-modified silica, and ferroferric oxide magnetic beads wrapped by carboxyl-modified silica, and the concentration of the magnetic beads in the magnetic bead storage solution is 50 mg / mL to 100 mg / mL; The first washing solution comprises 10 mmol / L to 100 mmol / L buffer salt, 0.05 mol / L to 2 mol / L chaotropic salt, 30% (v / v) to 80% (v / v) organic solvent and 0.1 wt% to 5 wt% surfactant, and the pH is 6.0 to 8.0; The second washing solution comprises 10 mmol / L to 100 mmol / L buffer salt and 50% (v / v) to 90% (v / v) organic solvent, and the pH value is 6.0 to 8.0; The eluent contains 1 mmol / L to 100 mmol / L buffer salt and 0.01 wt% to 1 wt% surfactant, and the pH is 6.0 to 8.

0.

2. The kit according to claim 1, characterized in that It satisfies one or more of the following conditions 1) to 7): 1) The buffer salts in the lysate, the binding solution, the first washing solution, the second washing solution and the eluent independently include one or more of tris(hydroxymethylaminomethane)-hydrochloric acid buffer salt, tris(hydroxymethylaminomethane)-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt, sodium citrate-citric acid buffer salt; 2) the chaotropic salts in the lysate, the binding solution and the first washing solution independently include one or more of guanidine isothiocyanate, sodium isothiocyanate, potassium isothiocyanate, ammonium isothiocyanate, guanidine hydrochloride, ammonium sulfate and monovalent salts; 3) The detergent includes one or more of sodium dodecyl sulfate, sodium dodecyl sulfonate, sodium dodecylbenzene sulfonate, sodium lauryl sarcosinate, Tween-20, Tween-80 and Triton X-100; 4) The RNA solubilizing agent includes one or more of ammonium acetate, sodium acetate, potassium acetate, ammonium formate, sodium formate and potassium formate; 5) The surfactants in the binding solution, the first washing solution and the elution solution independently include one or more of Tween-20, Tween-40, Tween-60, Tween-80, Triton X-100, NP-40 and polyethylene glycol; 6) the organic solvents in the combined solution, the first washing solution and the second washing solution independently include one or more of ethanol, isopropanol, polyethylene glycol, formamide and dimethylformamide; and, 7) The complex sample includes one or more of sewage, soil, feces, sediment, activated sludge and water filter membrane.

3. A method for extracting DNA and / or RNA from a complex sample using the kit according to claim 1 or 2, characterized in that: The method comprises: Mechanical grinding: the lysis medium, the lysis solution and the sample to be tested are mixed and ground by mechanical vibration to obtain a lysis mixture; wherein the relative amount of the lysis solution and the liquid sample to be tested in each reaction unit is (400μL ~700μL): (50μL ~ 300μL), and the relative amount of the lysis solution and the solid sample to be tested is (400μL ~ 700μL): (25 mg ~ 300 mg); PCR inhibitor precipitation: centrifuge the lysis mixture at 5000 g ~ 15000 g to obtain a supernatant, mix the supernatant with the precipitate in a relative amount of (500 μL ~ 650 μL): (50 ~ 250 μL), invert several times, and centrifuge at 5000 g ~ 15000 g to obtain a supernatant; Nucleic acid binding: the supernatant, binding solution and magnetic beads are mixed to allow the magnetic beads to adsorb nucleic acids, and the supernatant is removed to obtain magnetic beads bound with nucleic acids; the volume ratio of the supernatant to the binding solution is 1:0.8-1:3, and the amount of magnetic beads used in each reaction unit is 5 μg-50 μg; Rinsing impurities: using the first washing solution and the second washing solution to wash the magnetic beads bound with nucleic acid in sequence to remove impurities, so as to obtain only magnetic beads bound with nucleic acid; the impurities include at least one of proteins, small molecules and salts; Nucleic acid elution: Mix the magnetic beads bound only to nucleic acids with the elution buffer, incubate and centrifuge to obtain the supernatant containing the target DNA and / or RNA.

4. The method according to claim 3, characterized in that The mechanical grinding step satisfies one or more of the conditions i) to iii): i) The solid sample to be tested is a soil sample, and the relative amount of the lysate and the soil sample is (400 μL~700 μL): (100 mg~200 mg); The solid sample to be tested is a stool sample, and the relative amount of the lysate and the stool sample is (400 μL~700 μL): (25 mg~ 50 mg); or, The solid sample to be tested is a membrane filter sample, and the relative amount of the lysate and the membrane filter sample is (400 μL~700 μL): (1 / 4~1 47 mm or 50 mm membrane filter); ii) mechanical shaking using a vortexer at a speed of 800 rpm to 3000 rpm for 5 min to 20 min; and, iii) Use a grinding homogenizer for mechanical oscillation at a speed of 3 m / s~7 m / s, an oscillation time of 15 s~120 s, and 2~4 oscillation cycles.

5. The method according to claim 3 or 4, characterized in that The mechanical grinding steps also include the following operations: After grinding, capture RNA or short RNA less than 100 nt is added to reduce nonspecific adsorption; In each reaction unit: the amount of the captured RNA is 1 μg to 10 μg, and the amount of the short RNA below 100 nt is 5 μg to 25 μg.

6. The method according to claim 3 or 4, characterized in that The method extracts only RNA from a complex sample, and the steps of washing out impurities include: Using the first washing solution to wash the magnetic beads bound with the nucleic acid to remove impurities, thereby obtaining washed magnetic beads; Adding DNase I and its corresponding reaction buffer to the washed magnetic beads to obtain a digestion reaction system, incubating, and obtaining a digestion product; The digestion product and the binding solution are mixed in a volume ratio of 1:0.8 to 1:3 to obtain DNA-digested magnetic beads; The DNA-digested magnetic beads are washed sequentially with the first washing solution and the second washing solution.

7. The method according to claim 6, characterized in that The concentration of the DNase I in the digestion reaction system is 0.01 U / μL to 0.5 U / μL, and the incubation conditions are: 15° C. to 45° C., and 5 min to 60 min.

8. The method according to claim 3 or 4, characterized in that In the nucleic acid elution step, the incubation conditions are: 40°C~70°C, 2 min~15 min.

9. The method according to claim 3 or 4, characterized in that DNA and / or RNA from complex samples are extracted using an automated nucleic acid extractor. Each well in the deep-well plate corresponds to one reaction unit.

10. The method according to claim 9, characterized in that The heating modules of the automated nucleic acid extractor are located in columns 1, 5, 7 and 11: The binding solution is dispensed into the 1st column, the 2nd column, the 7th column and the 8th column of the deep well plate, the first washing solution is dispensed into the 3rd column and the 9th column of the deep well plate, the second washing solution is dispensed into the 4th column and the 10th column of the deep well plate, the elution solution is dispensed into the 5th column and the 11th column of the deep well plate, and the magnetic beads are dispensed into the 6th column and the 12th column of the deep well plate; or, The heating modules of the automated nucleic acid extractor are located in columns 1, 6, 7 and 12: The binding solution was dispensed into the 1st, 2nd, 7th and 8th columns of the deep well plate, the first washing solution was dispensed into the 3rd and 9th columns of the deep well plate, the second washing solution was dispensed into the 4th and 10th columns of the deep well plate, the magnetic beads were dispensed into the 5th and 11th columns of the deep well plate, and the elution solution was dispensed into the 6th and 12th columns of the deep well plate.

Images