Lambda Red two-step homologous recombination method for knocking out yciC gene of klebsiella pneumoniae

Abstract

The invention discloses a lambda Red two-step homologous recombination method for knocking out a Klebsiella pneumoniae ycC gene. According to the invention, three plasmids are used, one is a homologous recombinant plasmid pACBSR-Hyg, and the gene expression of Red recombinase is controlled under the induction of an arabinose promoter. The other plasmid pKD4-Kan contains a kanamycin drug resistance box and is used as a PCR (Polymerase Chain Reaction) template of a resistance gene box, and the last plasmid is a resistance gene elimination plasmid pFLP-Hyg which contains recombinase and is used for eliminating homologous recombination resistance genes on chromosomes. The Klebsiella pneumoniae ycC gene can be knocked out, so that the specific function of the ycC can be clarified. The system for targeted knockout of the Klebsiella pneumoniae ycC gene through the lambda Red two-step homologous recombination method can effectively knock out the ycC gene of a strain, and is high in specificity, simple in method and easy to popularize.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and specifically relates to a method for knocking out Klebsiella pneumoniae yciC Two-step homologous recombination method for λRed gene. Background Art

[0002] carbapenem-resistant Klebsiella pneumoniae klebsiella pneumoniae The emergence of CRKP has brought great challenges to clinical treatment. Polymyxin has been reactivated as the "last line" antibiotic. However, with the widespread use of polymyxin in recent years, the resistance rate of CRKP to polymyxin has been on the rise. The all-cause mortality rate of bloodstream infection in polymyxin-resistant CRKP is extremely high, reaching more than 50% in some reports, which poses a new threat to the safety of patients' lives. In previous studies, we found that polymyxin-resistant CRKP appeared more frequently. yciC Mutations. yciC Encodes a novel GTP cyclohydrolase that is postulated to function as a metallochaperone, currently unknown YciC The specific mechanism of action of the protein.

[0003] In 2000, some scholars developed a method to use the lambda phage homologous recombination system to achieve recombination between exogenous linear double-stranded DNA and chromosomal DNA homologous sequences in Escherichia coli. In actual operation, the genes of three red proteins (Gam, Exo, Beta) are placed on the expression vector. Once the exogenous dsDNA is electroporated into the cell, there is a probability that homologous recombination will occur in the same genomic target sequence, replacing the gene to be knocked out.

[0004] The λRed two-step homologous recombination method is to pre-introduce the plasmid pACBSR-Hyg with Red recombinase into the target strain, and then use pKD4 and the target strain DNA as templates to synthesize the PCR gene targeting fragment product, which contains the kanamycin resistance gene cassette, flippase recognition target (FRT) at both ends, and a target gene homologous sequence of about 500bp. The targeting fragment is electroporated into the target strain containing the pACBSR-Hyg plasmid. Under the induction of arabinose, the Red recombinase encoded by the pACBSR-Hyg plasmid is expressed, and the linear targeting DNA fragment introduced into the bacteria undergoes homologous recombination with the corresponding sequence of the chromosome. The target gene is replaced by the resistance gene. Then the pFLP-Hyg plasmid is introduced into the recombinant strain, and the FLP flippase expressed by it can bind to the FRT site to eliminate the resistance gene fragment. After culturing at 42°C for more than 24 hours, the pFLP-Hyg plasmid is removed, and the target gene is knocked out.

[0005] Compared with traditional gene knockout methods, the λRed two-step homologous recombination method is simple to operate, has a short experimental cycle, and a wide range of applications. In this experiment, extending the length of the homologous arm to 500bp significantly improved the success rate of gene knockout. Summary of the invention

[0006] In order to overcome the shortcomings of the prior art, the present invention aims to provide a method for knocking out Klebsiella pneumoniae. yciC Two-step homologous recombination method for λRed gene.

[0007] Klebsiella pneumoniae knockout yciC Targeting sequences include yciC LF and yciC LR, kan-F and kan-R, yciC RF and yciC RR; among them, yciC LF is SEQ ID NO.1, yciC LR is SEQ ID NO.2; kan-F is SEQ ID NO.3, and kan-R is SEQ ID NO.4; yciC RF is SEQ ID NO.5, yciC RR is SEQ ID NO.6.

[0008] A knockout Klebsiella pneumoniae yciC The λRed two-step homologous recombination method includes the following steps: (1) Pre-introduce the plasmid pACBSR-Hyg containing Red recombinase into the target strain; (2) knocking out Klebsiella pneumoniae yciC Genetic yciC LF and yciC LR, kan-F and kan-R, yciC RF and yciC RR fusion PCR obtains a gene targeting fragment product, which contains a kanamycin resistance gene cassette, flippase recognition target (FRT) sites at both ends, and a target gene homologous sequence of about 500 bp; (3) The targeting fragment is electroporated into the target strain containing the pACBSR-Hyg plasmid. Under the induction of arabinose, the Red recombinase encoded by the pACBSR-Hyg plasmid is expressed, and the linear targeting DNA fragment introduced into the bacteria undergoes homologous recombination with the corresponding sequence of the chromosome, and the target gene is replaced by the resistance gene. The pFLP-Hyg plasmid is then introduced into the recombinant strain, and the FLP flippase expressed by it binds to the FRT site to eliminate the resistance gene fragment. The strain is cultured at 42°C for more than 24 hours, the pFLP-Hyg plasmid is removed, and the target gene is knocked out.

[0009] Application of the λRed two-step homologous recombination method for targeted knockout of Klebsiella pneumoniae yciC Gene.

[0010] The beneficial effects of the present invention are as follows: The present invention discloses an application of a two-step homologous recombination method of λRed for knocking out the gene of Klebsiella pneumoniae. The present invention uses three plasmids, one of which is a homologous recombination plasmid pACBSR-Hyg, which controls the gene expression of Red recombinase under the induction of its arabinose promoter. Another plasmid pKD4-Kan contains a kanamycin resistance gene cassette and is used as a PCR template for the resistance gene cassette. The last plasmid is a resistance gene elimination plasmid pFLP-Hyg, which contains a recombinase and is used to eliminate the resistance gene of homologous recombination on the chromosome. Klebsiella pneumoniae can be knocked out. yciC genes, thus helping to elucidate yciC specific functions.

[0011] The λRed two-step homologous recombination method of the present invention targets and knocks out Klebsiella pneumoniae yciC Gene system can effectively knock out the strain yciC Gene, high specificity, simple method and easy to promote. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a graph showing the results of PCR detection by electrophoresis in an embodiment of the present invention.

[0013] Figure 2 This is the detection of metal ions in bacteria in the embodiments of the present invention. DETAILED DESCRIPTION

[0014] The present invention will be described in detail below according to the accompanying drawings and preferred embodiments, and the purpose and effect of the present invention will become more clear. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0015] The principle of synthetic targeting sequence is as follows: yciC LF and yciC LR, kan-F and kan-R,yciC RF and yciC The gene targeting fragment product was obtained by RR fusion PCR, which contained a kanamycin resistance gene cassette, flippase recognition target (FRT) sites at both ends, and a target gene homologous sequence of about 500 bp.

[0016] The targeting fragment is electroporated into the competent target strain containing the pACBSR-Hyg plasmid. Under the induction of arabinose, the Red recombinase encoded by the pACBSR-Hyg plasmid is expressed, and the linear targeting DNA fragment introduced into the bacteria undergoes homologous recombination with the corresponding sequence of the chromosome. The target gene is replaced by the resistance gene. Then the pFLP-Hyg plasmid is introduced into the recombinant strain, and the FLP flippase expressed by it can bind to the FRT site to eliminate the resistance gene fragment. After culturing at 42°C for more than 24 hours, the pFLP-Hyg plasmid is removed, and the target gene is knocked out. Hygromycin / kanamycin resistance screening is added, monoclonal bacteria are selected, genomic DNA is extracted, and the gene fragment containing the target sequence is amplified by PCR using its genomic DNA as a template, and the capsule gene cluster is confirmed to have been knocked out and the knocked-out bacteria are obtained by whole genome sequencing. The specific preparation method is as follows: S1: Prepare 10 MHA solid plates containing hygromycin 100 μg / ml and kanamycin hygromycin 50 μg / ml respectively. S2: Make competent bacteria of target strain S2.1: Columbia blood agar plates were inoculated with the target bacteria in four zones.

[0017] S2.2: Weigh 1.9g Mueller-Hinton (MH) medium in 50ml distilled water, autoclave at 121℃ for 20 minutes. After the autoclave is over, place in a 4℃ refrigerator for later use; S2.3: Pick a single colony and add it to 5 ml liquid culture medium, amplify it at 220 rpm and 37°C overnight. On the next day, take 500 μL and add it to 50 ml MH liquid culture medium, amplify it at 220 rpm and 37°C for 2.5 hours to culture the bacteria.

[0018] S2.4: Use a centrifuge to collect the bacteria, and the centrifuge setting conditions are 5000 rpm for 5 minutes; S2.5: Rinse the bacteria with 15 ml of double distilled water (ddH2O) precooled at 4°C and resuspend the bacteria.

[0019] S2.6: Repeat step S2.5.

[0020] S2.7: Use the same centrifugation conditions as S2.4 again to collect the bacteria by centrifugation, wash the bacteria with 1 ml of 10% glycerol solution by volume, and resuspend the bacteria.

[0021] S2.8: Repeat step S2.7.

[0022] S2.9: Dispense into 1.5 ml EP test tubes, 100 μL per tube, and store at -80℃ until use.

[0023] S3: Construction of DNA targeting sequence: S3.1: Synthesize the following 6 primer sequences (1) yciC LF: gggtaattttccgttcggtc (SEQ ID NO.1) (2) yciC LR:GAAGCAGCTCCAGCCTACACAggtgttcttttcatagcatccg (SEQ ID NO.2) (3) kan-F: cggatgctatgaaaagaacaccTGTGTAGGCTGGAGCTGCTTC (SEQ ID NO.3) (4) kan-R: taacataacatcatctgtcgctCATATGAATATCCTCCTTAG (SEQ ID NO.4) (5) yciC RF: CTAAGGAGGATATTCATATGagcgacagatgatgttatgtta (SEQ ID NO.5) (6) yciC RR: ggccaccgctttatttctt (SEQ ID NO. 6).

[0024] S3.2: Dilute the two sequences to 100 μmol / L using ddH2O according to the synthesized concentration.

[0025] S3.3: According to the following conditions, anneal the three sequences and synthesize them into a targeting sequence.

[0026] (1) Add a, b, c, d, and e to a 0.2 ml PCR tube to synthesize the upstream homology arm a.1μl yciC LF solution b.1μl yciC LR solution c. 3 μl bacterial suspension of target strain d.21 μl PRIMER STAR PCR MIX e. 30 μl ddHO 2 O.

[0027] (2) Add a, b, c, d, and e to a 0.2 ml PCR tube to synthesize the downstream homology arm a.1μl yciC RF Solution b.1μl yciC RR solution c. 3 μl bacterial suspension of target strain d.21 μl PRIMER STAR PCR MIX e. 30 μl ddHO 2 O.

[0028] (3) Add a, b, c, d, and e to a 0.2 ml PCR tube to synthesize the resistance gene cassette a. 1 μl kan-F solution b. 1 μl kan-R solution c.3 pKD4-kan d.21 μl PRIMER STAR PCR MIX e. 30 μl ddHO 2 O.

[0029] (4) Purify the PCR products synthesized in (1), (2), and (3) and store at 4°C until ready for use.

[0030] S3.4: Use fusion PCR to connect the upstream homology arm, the resistance gene cassette and the downstream homology arm, specifically: PCR system: a. 200 ng upstream homology arm b. 200 ng downstream homology arm c.70 ng resistance gene cassette d. 25 μl PRIMER STAR PCR MIX e. Make up with 50 μl ddH 2 O; PCR conditions: 98℃,1min 98℃, 10s, 15X 55℃, 5s, 15X 68℃, 20s, 15X 68℃,5min.

[0031] S3.5: After finishing, add 2.5μl to the above system yciC LF and yciC LR primer pair, 25 μl PRIMERSTAR PCR MIX, 20 μl ddH 2 O performs PCR, specifically: PCR conditions: 98℃,2min 98℃, 10s, 33X 55℃, 5s, 33X 72℃, 20s, 33X 72℃,5min.

[0032] S3.6: After PCR, run electrophoresis on the PCR product at 180V for 45min, take the farthest band, cut the gel, recover it, purify it and measure its concentration.

[0033] S4: Electroporate the pACBSR-Hyg plasmid into Klebsiella pneumoniae.

[0034] S4.1: Thaw the competent bacteria stored at -80℃ on ice.

[0035] S4.2: Add 3 μl of pACBSR-Hyg plasmid and mix gently. Note: Do not shake the cells vigorously.

[0036] S4.3: Use Bio-Rad electroporation instrument to transform the pACBSR-Hyg plasmid into competent bacteria (condition: voltage 2500V).

[0037] S4.4: Quickly add 900 μl of SOC (super Optimal Broth) medium (pre-warmed at 37°C) containing L-arabinose.

[0038] S4.5: Cultivate with shaking at 30°C for 1 hour (200 rpm).

[0039] S4.6: Take an appropriate amount of 50 μl and spread it on MHA solid plate culture medium containing 100 μg / ml hygromycin.

[0040] S4.7: Incubate overnight at 37°C.

[0041] S5: Introduce the targeting sequence into Klebsiella pneumoniae containing the pACBSR-Hyg plasmid, following the same steps as S4.

[0042] S6: Elimination of pACBSR-Hyg plasmid.

[0043] S6.1: Streak the strain successfully recombined in the previous step on a 50 μg / ml kanamycin-resistant LB plate and incubate it in a 42°C incubator. After 24 hours, spot the obtained single colonies one by one on a hygromycin-resistant plate and a kanamycin-resistant plate, one by one, and culture them at 37°C overnight.

[0044] S6.2: Observe the plates the next day: select the colonies that do not grow on the hygromycin-resistant plates but grow on the corresponding positions on the kanamycin-resistant plates, and perform PCR tests to yciC LF and yciC RR was used as primer, homologous recombination fragment DNA was used as positive control, sterile deionized water was used as negative control, PCR amplification was performed, and the obtained product was identified by agarose gel electrophoresis. The bands that were consistent with the positive control were positive clones. At the same time, pACBSR-Hyg-F and pACBSR-Hyg-R were used as primers, pACBSR-Hyg plasmid DNA was used as positive control, and sterile deionized water was used as negative control for PCR amplification. The clones with positive results for homologous recombination fragment DNA PCR and negative results for pACBSR-Hyg plasmid PCR were clones from which pACBSR-Hyg plasmid had been removed.

[0045] S6.3: Expand the clone on a kanamycin-resistant LB plate and store it in BHI broth. Write the date and label it and store it in a -80°C refrigerator.

[0046] S7: Introduce the pFLP-Hyg plasmid into the Klebsiella pneumoniae, following the same steps as S4.

[0047] S8: Elimination of pFLP-Hyg plasmid.

[0048] S8.1: Pick 12-15 single clones on the plate, streak them on a kanamycin resistance plate, and then streak them on an LB plate without antibiotics (the order cannot be changed), and culture them in a 37°C incubator for 24 hours.

[0049] S8.2: The clones that can only grow on the antibiotic-free plate but not on the kanamycin resistance plate are suspected to be colonies that have successfully removed the kanamycin resistance gene cassette. Perform colony PCR, use Kan-F and Kan-R as primers, pKD4 as a positive control, and sterile deionized water as a negative control, perform PCR amplification, and identify the obtained products by agarose gel electrophoresis. The clones with negative PCR results are the clones that have removed the kanamycin resistance gene cassette.

[0050] S8.3: The above single clones that have successfully removed the kanamycin resistance gene cassette are streaked on a hygromycin resistance plate and then on an LB plate without antibiotics (the order cannot be changed), and placed in a 37°C incubator for 24 hours. Observe the plates the next day: select colonies that do not grow on the hygromycin resistance plate but grow on the corresponding position of the antibiotic-free plate, and perform PCR detection using pFLP-Hyg-F and pFLP-Hyg-R as primers, pFLP-Hyg plasmid DNA as a positive control, and sterile deionized water as a negative control, and perform PCR amplification. The clones with negative PCR results are clones that have removed the pFLP-Hyg plasmid.

[0051] S8.4: Expand the clone on LB plates without antibiotics and store it in BHI broth. Write the date and label it and store it in a -80℃ freezer.

[0052] S9: PCR verification of target gene knockout S9.1: Use the genomic DNA of the suspected knockout strain as a template. yciC LF and yciC RR was used as primer, genomic DNA of wild strain was used as positive control, and sterile deionized water was used as negative control for PCR amplification, and the obtained products were identified by agarose gel electrophoresis. After electrophoresis, the band amplified by the suspected mutant in the PCR result was smaller than the band amplified by the wild genome, and the DNA fragment amplified by the knockout strain was sent to the company for sequencing to confirm again that it was a knockout strain. A single colony was selected and stored in a glycerol broth medium with a volume ratio of 30%, and stored at -80℃ for use.

[0053] like Figure 1 The figure shows the PCR results of electrophoresis detection in this example, wherein M is a marker, 8 is the original strain, and 1-7 are knockout strains.

[0054] S10: Comparison of metal ion concentrations in bacteria S10.1: Pick a single clone and culture it in LB medium, shaking at 37°C overnight.

[0055] S10.2: Centrifuge at 4000 g for 5 min, wash the resulting bacterial pellet twice with PBS, freeze dry it using a freeze dryer, and record its mass.

[0056] S10.3: Add 50% nitric acid and boil at 95°C for 1 h, and adjust the volume to 10 mL with sterile water. Elemental quantification Elan DRCII ICP-MS equipped with AS-93 autosampler was used to determine the content of each metal ion in the analytical sample.

[0057] Figure 2 The comparison of metal ion concentrations in bacteria before and after strain knockout is given.Figure 2 The results showed that the concentration of zinc ions in the bacteria increased after knockout.

[0058] Those skilled in the art can understand that the above are only preferred examples of the invention and are not intended to limit the invention. Although the invention is described in detail with reference to the above examples, those skilled in the art can still modify the technical solutions recorded in the above examples or replace some of the technical features therein with equivalents. Any modification, equivalent replacement, etc. made within the spirit and principle of the invention shall be included in the protection scope of the invention.

Claims

1. Knockout of Klebsiella pneumoniae yC The targeting sequence is characterized in that include yC LF and yC LR, kan-F and kan-R, yC RF and yC RR; among them, yC LF is SEQ ID NO.1, yC LR is SEQ ID NO.2; kan-F is SEQ ID NO.3, and kan-R is SEQ ID NO.4; yC RF is SEQ ID NO.5, yC RR is SEQ ID NO.

6.

2. A Knockout Klebsiella pneumoniae yC The λ Red two-step homologous recombination method is characterized by: The steps include: (1) Pre-introduce the plasmid pACBSR-Hyg containing Red recombinase into the target strain; (2) The knockout Klebsiella pneumoniae of claim 1 yC Genetic yC LF and yC LR, kan-F and kan-R, yC RF and yC RR fusion PCR obtains a gene targeting fragment product, which contains a kanamycin resistance gene cassette, flippase recognition target (FRT) sites at both ends, and a target gene homologous sequence of about 500 bp; (3) The targeting fragment is electroporated into the target strain containing the pACBSR-Hyg plasmid. Under the induction of arabinose, the Red recombinase encoded by the pACBSR-Hyg plasmid is expressed, and the linear targeting DNA fragment introduced into the bacteria undergoes homologous recombination with the corresponding sequence of the chromosome, and the target gene is replaced by the resistance gene. The pFLP-Hyg plasmid is then introduced into the recombinant strain, and the FLP flippase expressed by it binds to the FRT site to eliminate the resistance gene fragment. The strain is cultured at 42°C for more than 24 hours, the pFLP-Hyg plasmid is removed, and the target gene is knocked out.

3. An application of the λRed two-step homologous recombination as claimed in claim 1, characterized in that: For targeted knockout of Klebsiella pneumoniae yC Gene.

Images