Csacs6 gene and application in improving citrus canker resistance

Abstract

The application discloses a CsACS6 gene and application thereof in improving citrus canker resistance, relates to the field of agricultural biotechnology, and discloses that the coding sequence of the CsACS6 gene is shown in SEQ ID NO.1, and the protein coded by the CsACS6 gene is ACC synthase. The application constructs an overexpression vector of the coding sequence of the CsACS6 gene, transforms citrus epicotyl by using an agrobacterium tumefaciens mediation method, successfully improves the expression level of the CsACS6 in the transgenic citrus, and obtains a transgenic plant with obviously enhanced citrus canker resistance. The application has great application value for citrus canker resistance breeding, lays a foundation for citrus canker resistance genetic breeding, and vigorously promotes the development and application of citrus canker resistance genetic engineering.

Description

TECHNICAL FIELD

[0001] The application relates to the field of agricultural biotechnology, and particularly relates to a CsACS6 gene and application thereof in improving resistance to citrus canker. BACKGROUND

[0002] Citrus is the first largest fruit in the south of China and is also an important economic crop in the world. However, citrus canker seriously hinders the healthy development of the citrus industry (Hu Junhua et al., 2015). Citrus canker is caused by Xanthomonas citri subsp. citri (Xcc), which originates from India, Java and other places (Hu Junhua et al., 2015). The main citrus producing areas in China, such as Fujian, Hunan and Guangdong, are seriously affected by citrus canker. The canker bacteria mainly infect citrus leaves, branches and fruits, and the seedlings and young trees are more seriously affected (He Xiuling et al., 2007). The diseased trees will appear leaf fall, branch dieback, tree vigor weakening and fruit drop, which seriously affects the yield and quality of citrus. There are dozens of Rutaceae plants affected by citrus canker, most of which are economic cultivars. It has been found that sweet orange is most susceptible to the disease, followed by sour orange and grapefruit (Yuan Chengdong et al., 1997; Li Min et al., 2013).

[0003] Currently, integrated control strategies are typically employed to control the damage caused by citrus canker, primarily with chemical control supplemented by biological control. However, chemical control measures are environmentally unfriendly, highly polluting, and require significant human and material resources. Biological control is ineffective and costly, leading to an urgent need to cultivate new resistant varieties to reduce the losses caused by canker (Chen Li et al., 2008; Zhu Xuemei et al., 2017). The long hybrid breeding cycle results in low breeding efficiency. With the rise of molecular biology, research has begun on genetic engineering of disease resistance, focusing on both the pathogen itself and the plant's defense response. Genetic engineering has also been explored in canker resistance research (Duan Minjie et al., 2016; Jia Ruirui et al., 2017), resulting in the production of some transgenic materials resistant to canker. For example, Chen Shanchun et al. obtained transgenic Jincheng, Xinhuicheng, and Navelcheng lines that were resistant to citrus canker by carrying the antimicrobial peptide D gene from the silkworm (Chen Shanchun et al., 1996); the exogenous genes NLS, chit42, Xa21, and PthA conferred resistance to citrus canker after being transferred to Bingtangcheng, Ponkan, and Sweet Orange (Mendes et al., 2010; Yang et al., 2011); CsBZIP40 is an important transcription factor that responds to citrus canker infection and is speculated to affect the resistance of citrus varieties through the SA pathway (Li et al., 2017); the CsLOB1 gene, as a target protein of the canker pathogen gene PthA, makes citrus more sensitive to canker (Li et al., 2014); CRISPR / Cas9 targeted knockout of the promoter of the citrus canker susceptibility gene CsLOB1 can produce plants with improved resistance to citrus canker (Penget et al., 2014). al., 2017).

[0004] ACC synthase (ACS), encoded by the ACS gene family, is the rate-limiting enzyme in the ethylene biosynthesis pathway in plants. Its activity directly affects the rate of ethylene production in plants (Tsuchisaka et al., 2004), playing an important role in plant growth, development, and response to abiotic and biotic stresses. For example, inhibiting the transcription of ACS1 in rice inhibits ethylene biosynthesis and promotes taproot elongation (Qin et al., 2019); salt stress induces a significant burst of salt-ethylene biosynthesis and expression of the ACS2 gene in Solanum nigrum (Gharbi et al., 2016); and infection with Botrytis cinerea induces the expression of ACS2, ACS6, ACS7, ACS8, and ACS11 in Arabidopsis thaliana (Li et al., 2012).

[0005] At present, there is no research and application on using ACS genes to improve the resistance of citrus to citrus canker. Summary of the Invention

[0006] The application aims to provide a CsACS6 gene and application thereof in improving citrus canker resistance, and by integrating the CsACS6 gene into citrus using an expression vector, transgenic plants with obviously enhanced citrus canker resistance are obtained, which has great application value for citrus canker resistance breeding.

[0007] The application is achieved by the following technical solutions.

[0008] The first object of the application is to provide a CsACS6 gene, and the coding sequence of the CsACS6 gene is shown in SEQ ID NO. 1.

[0009] The second object of the application is to provide an ACC synthase encoded by the CsACS6 gene.

[0010] The third object of the application is to provide application of the CsACS6 gene or the ACC synthase in improving citrus canker resistance.

[0011] Further, the specific method of the application is as follows.

[0012] (1) cloning the CsACS6 coding sequence;

[0013] (2) constructing a CsACS6 overexpression vector;

[0014] (3) transforming citrus with the CsACS6 overexpression vector to obtain transgenic plants with improved canker resistance.

[0015] Further, in step (1), the cloning method of the CsACS6 coding sequence is as follows.

[0016] Total RNA of citrus is extracted, and reverse transcribed into cDNA as a template, and the primer OE-CsACS6-F and OE-CsACS6-R are used for PCR amplification and recovery of the CsACS6 coding sequence DNA fragment;

[0017] The nucleotide sequences of the primers OE-CsACS6-F and OE-CsACS6-R are shown in SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

[0018] Further, in step (2), the CsACS6 overexpression vector is pLGNe-CsACS6.

[0019] Further, in step (2), the construction method of the CsACS6 overexpression vector is as follows.

[0020] The CsACS6 coding sequence DNA fragment recovered by digestion with KpnⅠ and SalI was ligated to the pLGNe vector recovered by digestion with KpnⅠ and SalI to construct the overexpression vector pLGNe-CsACS6.

[0021] Furthermore, in step (3), the method for transforming citrus with the CsACS6 overexpression vector is:

[0022] The CsACS6 overexpression vector was transformed into Agrobacterium tumefaciens by electroporation, and then transformed into citrus epicotyls mediated by Agrobacterium tumefaciens. Transgenic plants were obtained after GUS staining, PCR identification, and qRT-PCR analysis of CsACS6 expression levels.

[0023] Furthermore, the primers for PCR identification of transgenic plants are: ID-CsACS6-F and ID-CsACS6-R. ID-CsACS6-F is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsACS6-R is designed based on the terminal sequence of the CsACS6 gene. The nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0024] Furthermore, the primers for qRT-PCR analysis of CsACS6 expression were: RT-CsACS6-F and RT-CsACS6-R, and the nucleotide sequences were shown in SEQ ID NO. 6 and SEQ ID NO. 7, respectively.

[0025] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0026] The present invention clones the citrus CsACS6 coding sequence, constructs an overexpression vector, and then transforms the citrus to obtain transgenic plants. The expression level of CsACS6 in the transgenic citrus is successfully increased, and the resistance of the citrus to canker disease is effectively improved. The severity of canker disease can be reduced to a maximum of 34.0% (disease index) and 41.9% (affected area) of existing citrus. This can significantly reduce the severity of canker disease and the area of ​​lesions, and has great application value for breeding citrus varieties resistant to canker disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the examples. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be considered as limiting the scope. A person of ordinary skill in the art can also derive other relevant drawings based on these drawings without inventive effort. In the drawings:

[0028] Figure 1PCR electrophoresis diagram of CsACS6 gene cloning of the application, wherein M represents DNA molecular weight marker;

[0029] Figure 2 Structure diagram of CsACS6 plant overexpression vector of the application, wherein GUS:NPTII represents fusion gene of beta-glucuronidase gene and neomycin phosphotransferase gene, P 35S represents plant constitutive promoter derived from cauliflower mosaic virus, and NOS represents nopaline synthase gene terminator;

[0030] Figure 3 Flow chart of citrus genetic transformation of the application;

[0031] Figure 4 GUS staining diagram of transgenic plants of the application, wherein OE-ACS6-1, OE-ACS6-2, OE-ACS6-3 and OE-ACS6-4 respectively represent four transgenic plants, and WT represents wild type late brocade orange plant;

[0032] Figure 5 PCR identification diagram of transgenic plants of the application, wherein OE-ACS6-1, OE-ACS6-2, OE-ACS6-3 and OE-ACS6-4 respectively represent four transgenic plants, WT represents wild type late brocade orange plant, + represents plasmid pLGNe-CsACS6, and M represents DNA molecular weight marker;

[0033] Figure 6 CsACS6 expression quantity analysis diagram of transgenic plants of the application;

[0034] Figure 7 Phenotype diagram of transgenic plants of the application;

[0035] Figure 8 Symptom diagram of transgenic plant leaves inoculated with bacterial wilt pathogen for 10 days of the application;

[0036] Figure 9 Statistical diagram of lesion size of transgenic plant leaves inoculated with bacterial wilt pathogen for 10 days of the application;

[0037] Figure 10 Statistical diagram of disease index of transgenic plant leaves inoculated with bacterial wilt pathogen for 10 days of the application. DETAILED DESCRIPTION

[0038] In order to make the purpose, technical scheme and advantages of the embodiments of the application clearer, the technical scheme of the embodiments of the application will be described clearly and completely below with reference to the drawings of the embodiments of the application. Obviously, the described embodiments are part of the embodiments of the application, rather than all the embodiments of the application.

[0039] The following detailed description of embodiments of the application provided in the accompanying drawings is not intended to limit the scope of the application as claimed, but merely represents selected embodiments of the application. Based upon the embodiments in the application, all other embodiments obtained by those of ordinary skill in the art without creative work are within the scope of protection of the application.

[0040] The technical solutions of the application are further described in detail below in combination with embodiments.

[0041] It should be noted that the embodiments of the application take late Jin orange as the test object, and the method can also be used to improve the resistance of other citrus varieties to bacterial wilt in actual application. The experimental methods used in the embodiments are conventional methods unless otherwise specified. The materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by commercial channels by those skilled in the art.

[0042] Example 1

[0043] Cloning of citrus CsACS6 coding sequence

[0044] 1. RNA extraction and cDNA synthesis

[0045] Total RNA of citrus (late Jin orange) leaves was extracted using a plant total RNA extraction kit (Aidley, CAT: RN09), and the quality of the RNA was verified by agarose gel electrophoresis, and its concentration was determined by concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A).

[0046] 2. PCR amplification of CsACS6 coding sequence

[0047] The DNA fragment of CsACS6 coding sequence was amplified from citrus cDNA using primers OE-CsACS6-F (SEQ ID NO. 2), OE-CsACS6-R (SEQ ID NO. 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q), and the length of the fragment was 1464 bp (containing enzyme cutting site) Figure 1 ), and the amplified DNA fragment was sequenced to determine the coding sequence of citrus CsACS6 gene (SEQ ID NO. 1). Under the ultraviolet lamp, the agarose gel block containing the target fragment was cut off with a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1).

[0048] PCR amplification procedure: 98℃, 5min; 98℃, 30s, 56℃, 30s, 72℃, 1.5min, 35 cycles; 72℃ extension for 10min.

[0049] Example 2

[0050] Construction of CsACS6 overexpression vector and transformation of Agrobacterium

[0051] 1. Construction of overexpression vector

[0052] The CsACS6 coding sequence DNA fragment and the overexpression vector pLGNe were double-digested with restriction enzymes Kpnl and Sail (ThermoFisher) and then gel-recovered and ligated overnight at 16℃, using T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into E. coli DH5a, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the overexpression vector pLGNe-CsACS6 (pLGNe-CsACS6) of CsACS6. Figure 2

[0053] 2. Transformation of Agrobacterium with overexpression vector

[0054] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method was as follows: the frozen Agrobacterium competent cells EHA105 (50 μL) were thawed on ice in advance; 2 μL of the overexpression vector plasmid was added to the competent cells, mixed well by blowing, and then placed on ice for 5 min; the mixed solution was transferred to the bottom of the previously dried electroporation cup, the electroporation cup was placed in the correct position by adjusting the slot, the electroporation device was adjusted to "Agr" mode, the electroporation button was pressed, and the electroporation data was checked to ensure successful electroporation; 1 mL of LB liquid medium was added to the electroporation cup, mixed well by blowing with a pipette, transferred to a sterile centrifuge tube, and incubated at 260 r / min and 28℃ on a shaking table for 60 min; the bacterial solution was centrifuged at 10000 r / min for 1 min, and the supernatant (about 100 μL of resuspended bacterial bodies) was discarded. After resuspension, it was plated and incubated at 28℃ in the dark for 2 days; after the bacterial colonies grew, single colonies were verified by PCR using primers OE-CsACS6-F (SEQ ID NO. 2) and OE-CsACS6-R (SEQ ID NO. 3).

[0055] PCR reaction conditions: 94℃, 3min; 94℃, 30s; 58℃, 30s; 72℃, 30s; 30 cycles; 72℃, 10min.

[0056] Example 3

[0057] Genetic transformation of citrus with CsACS6 overexpression vector ​

[0058] According to Figure 3 The citrus genetic transformation was carried out according to the flowchart shown in the figure, and the specific operation was as follows:

[0059] 1. Obtaining of citrus epicotyls

[0060] Fresh citrus fruits were washed and surface sterilized with 75% alcohol, and the seeds were taken out under sterile conditions, the seed coat was peeled off, and the seeds were germinated on the seed germination medium, and then cultured in the dark at 28°C for 2 weeks, and then cultured under the condition of 16h light / 8h dark for 1 week; the epicotyls of the germinated seedlings were taken out under sterile conditions, cut into 1cm stem segments, and used for Agrobacterium tumefaciens-mediated genetic transformation.

[0061] 2. Preparation of Agrobacterium tumefaciens liquid

[0062] Before transfection, the Agrobacterium (containing pLGNe-CsACS6 vector) used for transfection was streaked on LB solid medium containing 50mg / L kanamycin; a single colony was picked and inoculated into 25mL LB liquid medium containing the same antibiotic, and cultured at 28°C with shaking overnight; after the bacterial liquid was diluted to OD=0.1, it was continued to be cultured to OD=0.5, centrifuged at 5000r / min for 10min, the supernatant was discarded, and the bacterial liquid was resuspended with MS liquid medium at pH 5.4 for transfection.

[0063] 3. Transformation of citrus epicotyls

[0064] The citrus epicotyl stem segments were soaked in the Agrobacterium liquid for 10min, then dried, and the stem segments were transferred to the co-culture medium and cultured in the dark at 28°C for 2 days; after the co-culture was completed, the epicotyls were transferred to the selection medium and cultured in the dark at 28°C for 7 days, and the epicotyls were cultured under the condition of 16h light / 8h dark at 28°C, subcultured every two weeks, and then GUS staining was performed for identification.

[0065] 4. Plantlet culture of transformants

[0066] When the seedlings grew to more than 1cm, they were cut off and grafted onto sterile cultured Citrus sinensis cv. Late Kinkan yellowing seedlings, and cultured in the plantlet culture medium; when the seedlings grew to about 5cm, they were grafted onto Citrus aurantium seedlings and cultured in a 28°C greenhouse.

[0067] The culture media used in this example are as follows:

[0068] Seed germination medium: MS+30g / L sucrose+2.5g / L Gelrite, pH 5.8.

[0069] Co-culture medium: MS+2mg / L BA+0.5mg / L IAA+1mg / L 2,4-D+100μmol AS+30g / L sucrose+2.5g / L Gelrite, pH 5.8.

[0070] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0071] Plantlet regeneration medium: MS + 30 g / L sucrose, PH 5.8.

[0072] Example 4

[0073] Verification of CsACS6 overexpression transgenic plants

[0074] 1. Identification of transgenic plants by GUS staining

[0075] The leaves of the transgenic plants obtained by the primary screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The edges of the leaf discs of the positive plants were obviously blue, while the leaf discs of the WT plants were not obviously blue. Figure 4 ).

[0076] 2. PCR identification of transgenic plants

[0077] Genomic DNA was extracted from 100 mg of the leaves of the transgenic plants using a DNA extraction kit (Aidley, CAT: DN15), and PCR was performed to detect the integration of the CsACS6 coding sequence in the citrus genome. The detection primers were ID-CsACS6-F (SEQ ID No. 4) and ID-CsACS6-R (SEQ ID No. 5). A 1647 bp amplification fragment was obtained for the positive plants, while no amplification was observed for the WT plants. Figure 5 ).

[0078] PCR reaction conditions: 94°C, 3 min; 94°C, 30 s; 58°C, 30 s; 72°C, 30 s; 30 cycles; 72°C, 10 min.

[0079] 3. qRT-PCR analysis of transgenic plants

[0080] Total RNA was extracted from the leaves of the transgenic plants (Aidley, CAT No: RN09), and cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsACS6-F (SEQ ID No. 6) and RT-CsACS6-R (SEQ ID No. 7). The expression level of the target gene was calculated using the 2 -△△CtThe relative expression of CsACS6 gene in the transgenic plants was calculated: the sample treated with water was defined as the reference factor, and the expression level of CsACS6 thereof was 1, and then the fold of the relative reference factor gene expression in the transgenic citrus was calculated -△△Ct , and the relative expression thereof. The results showed that the CsACS6 gene had a high level of expression in the transgenic plants compared with the wild-type plants (up to 50 times of the control) Figure 6 ).

[0081] The qRT-PCR reaction conditions were as follows: 95℃, 3 min, 94℃, 10 s; 56℃, 10 s; 72℃, 10 s, 40 cycles; and 72℃, 10 min.

[0082] 4. Phenotype observation of the transgenic plants

[0083] The phenotypes of four transgenic plants were observed, and no obvious abnormalities in appearance and growth were found Figure 7 . This indicated that overexpression of the CsACS6 gene did not have a significant impact on the phenotype and development of the plants.

[0084] Example 5

[0085] Resistance evaluation of the CsACS6 overexpression transgenic plants

[0086] After cleaning, the mature leaves of the transgenic plants were sterilized with 75% alcohol and washed with sterile water, and placed on a clean bench. The leaves were pricked with a needle, seven needles for a group, two groups on each side, and the bacterial solution was spotted with a pipette, 1 μL (1 X 10 5 CFU / mL) per needle hole; and cultured in a constant temperature and light incubator (16 h light / 8 h dark) at 28℃; the leaves were photographed after being cultured for 10 days after being spotted with bacteria, and the lesion area was calculated using Image J V1.47 software.

[0087] According to the lesion area, the disease was divided into 0-7 levels, and the lesion area was represented by the letter R, 0 level (R≤0.5mm 2 ), 1 level (0.5mm 2 <R≤1mm 2 ), 2 level (1mm 2 <R≤1.5mm 2 ), 3 level (1.5mm 2 <R≤2mm 2 ), 4 level (2mm 2 <R≤2.5mm 2 ), 5 level (2.5mm 2 <R≤3mm 2 ), 6 level (3mm 2 <R≤3.5mm 2 ), and 7 level (R>3.5mm2 ); according to the formula to calculate disease index: DI = 100 X Σ

each level of lesion number X corresponding level value

[0088] The results show that after inoculation of X. axonopodis pv. citri for 10 days, the overexpression plants and the wild type plants grafted at the same period all have different degrees of disease in the plants inoculated with X. axonopodis pv. citri, and the lesion sizes are different. Figure 8 ) After statistics and analysis, it is found that the lesion area of the transgenic plants is significantly smaller than that of the wild type control, which is 41.9%-64.8% of the control ( Figure 9 ) The disease index of the transgenic plants is significantly smaller than that of the wild type control, which is 34.0%-65.4% of the control ( Figure 10 ) Therefore, overexpression of CsACS6 can significantly reduce the lesion area of citrus bacterial canker and reduce the disease degree of citrus canker.

[0089] Therefore, overexpression of CsACS6 can greatly reduce the lesion area of canker and reduce the disease degree of canker. The gene can be used independently for disease resistance molecular breeding, or it can be used together with other disease resistance or disease susceptible genes for citrus canker resistance molecular breeding.

[0090] The following is the nucleotide sequence involved in the application:

[0091] SEQ ID NO. 1

[0092]

[0093] SEQ ID NO. 2

[0094] GGGGTACCCCATGGCCTTCGCGTTGAGTAAC

[0095] SEQ ID NO. 3

[0096] GCGTCGACGTCTTGGCCATAGCGGCCGCGGTTAAGTCCGGGCCTGAACAAG

[0097] SEQ ID NO. 4

[0098] GCAAGTTCCTTAAGTAGCATCACAC

[0099] SEQ ID NO. 5

[0100] GTCGACTCTAGATTATGGCAAGTGATAATTAAC

[0101] SEQ ID NO. 6

[0102] GTGGAAGCCAAGGTGCCTAA

[0103] SEQ ID NO. 7

[0104] TCGAGATGACATGCTGAGCC

[0105] Finally, it should be noted that the above specific examples are only used to explain the purpose, technical solutions and beneficial effects of the present application in detail. It should be understood that the above description is only a specific embodiment of the present application and is not used to limit the protection scope of the present application. Although the present application has been described in detail with reference to the foregoing specific embodiments, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement, improvement, etc. to some or all of the technical features. These modifications, equivalent replacements, improvements, etc. do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application, and they should be covered in the scope of the claims and the description of the present application.

Claims

1. Application of the CsACS6 gene in improving resistance to citrus canker, characterized in that: The coding sequence of the CsACS6 gene is shown in SEQ ID NO. 1, and the specific method of the application is: (1) Cloning of the CsACS6 coding sequence; (2) Construction of CsACS6 overexpression vector; (3) The CsACS6 overexpression vector was used to transform citrus, and transgenic plants with improved resistance to canker disease were obtained through identification.

2. The use according to claim 1, characterized in that In step (1), the cloning method of the CsACS6 coding sequence is: Total RNA was extracted from citrus, reverse transcribed into cDNA as template, and PCR amplified using primers OE-CsACS6-F and OE-CsACS6-R to recover the CsACS6 coding sequence DNA fragment; The nucleotide sequences of primers OE-CsACS6-F and OE-CsACS6-R are shown in SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

3. The use according to claim 1, characterized in that In step (2), the CsACS6 overexpression vector is pLGNe-CsACS6.

4. The use according to claim 3, characterized in that In step (2), the method for constructing the CsACS6 overexpression vector is as follows: The CsACS6 coding sequence DNA fragment recovered by digestion with KpnⅠ and SalI was ligated into the pLGNe vector recovered by digestion with KpnⅠ and SalI to construct the overexpression vector pLGNe-CsACS6.

5. The use according to claim 1, characterized in that In step (3), the method for transforming citrus with the CsACS6 overexpression vector is as follows: The CsACS6 overexpression vector was transformed into Agrobacterium tumefaciens by electroporation, and then transformed into citrus epicotyls mediated by Agrobacterium tumefaciens. Transgenic plants were obtained after GUS staining, PCR identification, and qRT-PCR analysis of CsACS6 expression levels.

6. The use according to claim 5, characterized in that The primers used for PCR identification of transgenic plants are: ID-CsACS6-F and ID-CsACS6-R, and the nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

7. The use according to claim 5, characterized in that The primers used for qRT-PCR analysis of CsACS6 expression were RT-CsACS6-F and RT-CsACS6-R, and the nucleotide sequences were shown in SEQ ID NO. 6 and SEQ ID NO. 7, respectively.

Images