Method for efficiently preparing L-xylosone by controlling configuration inversion based on two-step enzymatic method and application of L-xylosone

Abstract

The invention provides a method for efficiently preparing L-xylulose by controlling configuration inversion based on a two-step enzymatic method and application of the method, and belongs to the technical field of bioengineering. According to the invention, two key enzymes 2-PsXDH and 4-PaXDH capable of mediating directional conversion of D-xylulose into L-xylulose are determined through in-vitro screening and catalytic verification, and a system for efficiently preparing L-xylulose by controlling configuration inversion is constructed based on a two-step enzymatic method. The method for efficiently preparing L-xylulose based on two-step enzymatic control of configuration inversion is constructed by using the system, the method can directionally regulate and control configuration inversion to synthesize L-xylulose, the problems of isomer pollution and the like in chemical synthesis can be effectively solved, subsequent separation and purification of products are greatly facilitated, and the method is suitable for industrial production. Good industrial application potential is realized; the preparation method of the L-xylulose is simple, can be used for catalyzing D-xylulose to convert into the L-xylulose in vitro or in vivo, and has good practicability.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a method for efficiently preparing L-xylulose based on a two-step enzymatic method to control configuration inversion and an application thereof. Background Art

[0002] L-xylulose (CAS: 527-50-4), also known as L-(+) threo-ketopentose, has important applications in the fields of food, chemical industry and medicine. For example, in the field of medicine, L-xylulose is not only used as the main component of hypoglycemic drugs for the treatment of diabetes, but also an important synthetic precursor of antiviral drugs L-nucleosides. In addition, its isomerized products L-xylose and L-ribose can also be used in the production of anticancer drugs. However, sugars in nature are basically D-type, and L-type monosaccharides are very rare, which makes it particularly difficult to obtain L-xylulose through natural extraction. At present, the synthesis of L-xylulose mainly adopts chemical synthesis, but chemical synthesis has problems such as lengthy steps, high energy consumption, and isomer pollution, resulting in a low final yield of L-xylulose, which is in short supply on the market and is also quite expensive.

[0003] Through enzyme-mediated directional catalysis, D-type sugars with a wide range of natural sources are converted into L-configuration xylulose. This process can not only take advantage of the strong specificity and high stereoselectivity of the enzyme to control the precise conversion between configurations to synthesize L-xylulose in a directional and efficient manner, but also conform to the current concept of green synthesis development, and become a popular method for producing chiral drugs and intermediates. D-xylulose, as an enantiomer of L-xylulose, is widely present in the pentose phosphate pathway of prokaryotes, eukaryotes and other microorganisms, and is generally converted after glucose phosphorylation. However, there is no report on how to accurately regulate the isomerization of D-xylulose to L-xylulose. Therefore, it is necessary to develop a method for directional catalysis of D-xylulose to L-xylulose for the specific and efficient synthesis of L-xylulose. Summary of the invention

[0004] In view of some deficiencies in the prior art, the present invention provides a method for efficiently preparing L-xylulose by controlling configuration inversion based on a two-step enzymatic method and its application; the present invention determines two key enzymes 2-PsXDH and 4-PaXDH that can mediate the directional conversion of D-xylulose to L-xylulose through in vitro screening and catalytic verification, and constructs a system for efficiently preparing L-xylulose by controlling configuration inversion based on a two-step enzymatic method, and then uses the system to construct a method for efficiently preparing L-xylulose by controlling configuration inversion based on a two-step enzymatic method, the method can synthesize L-xylulose by directional regulation of configuration conversion, can effectively overcome the problems of isomer contamination in chemical synthesis, greatly facilitates the subsequent separation and purification of the product, and has good industrial application potential; the preparation method of L-xylulose according to the present invention is simple, can be used to catalyze the conversion of D-xylulose to L-xylulose in vitro or in vivo, and has good practicality.

[0005] In order to achieve the above technical objectives, the present invention adopts the following technical means:

[0006] The present invention first provides a system for efficiently preparing L-xylulose based on a two-step enzymatic method to control configuration inversion, wherein the system comprises any of the following:

[0007] (i) xylitol-2-dehydrogenase 2-PsXDH and xylitol-4-dehydrogenase 4-PaXDH;

[0008] (ii) a genetically engineered bacterium expressing xylitol-2-dehydrogenase 2-PsXDH and a genetically engineered bacterium expressing xylitol-4-dehydrogenase 4-PaXDH;

[0009] (iii) A genetically engineered bacterium that simultaneously expresses xylitol-2-dehydrogenase 2-PsXDH and xylitol-4-dehydrogenase 4-PaXDH.

[0010] Preferably, in the system, xylitol-2-dehydrogenase 2-PsXDH is derived from Pichia stipitis, and the nucleotide sequence encoding xylitol-2-dehydrogenase 2-PsXDH is shown in SEQ ID No: 1;

[0011] Xylitol-4-dehydrogenase 4-PaXDH is derived from Pantoea ananatis, and the nucleotide sequence encoding xylitol-4-dehydrogenase 4-PaXDH is shown in SEQ ID No:2.

[0012] The present invention also provides application of the above system in converting D-xylulose to prepare L-xylulose.

[0013] The present invention also provides a method for efficiently preparing L-xylulose based on a two-step enzymatic method to control configuration inversion, wherein the method utilizes the above system to convert D-xylulose into L-xylulose.

[0014] Preferably, when the system comprises (i), the method comprises:

[0015] (1) Using D-xylulose as the reaction substrate, 2-PsXDH is used to catalyze D-xylulose to produce xylitol;

[0016] (2) Using xylitol in (1) as the reaction substrate, 4-PaXDH was used to catalyze the conversion of xylitol into L-xylulose.

[0017] Preferably, in step (1), the catalytic reaction system comprises: 5mmol / L NADH, 10mmol / L D-xylulose, 25mmol / L Tris-HCl buffer and an appropriate amount of 2-PsXDH;

[0018] After adding 2-PsXDH, the mixture was reacted at 30°C and 120 rpm for 12 h.

[0019] Preferably, in step (2), the catalytic reaction system includes: 5mmol / L NAD + , 30mmol / L xylitol, 50mmol / L Gly-NaOH buffer (pH 10) and appropriate amount of 4-PaXDH;

[0020] After adding 4-PaXDH, the mixture was reacted at 30°C and 120 rpm for 8 to 12 hours.

[0021] Preferably, when the system includes (ii), the method for constructing the genetically engineered bacteria expressing xylitol-2-dehydrogenase 2-PsXDH includes:

[0022] Amplifying the xylitol-2-dehydrogenase gene psxdh2 and connecting it with the linearized plasmid vector pET-30a to obtain the recombinant expression plasmid pET-psxdh2, which was then transformed into Escherichia coli to obtain a genetically engineered bacterium expressing xylitol-2-dehydrogenase 2-PsXDH;

[0023] The method for constructing the genetically engineered bacteria expressing xylitol-4-dehydrogenase 4-PaXDH comprises:

[0024] The xylitol-4-dehydrogenase gene paxdh4 was amplified and connected to the linearized plasmid vector pET-30a to obtain the recombinant expression plasmid pET-paxdh4, which was transformed into Escherichia coli to obtain a genetically engineered bacterium expressing xylitol-4-dehydrogenase 4-PsXDH.

[0025] Preferably, when the system includes (ii), the method for preparing L-xylulose includes any one of the following:

[0026] (a) Inducing the expression of a genetically engineered bacterium expressing xylitol-2-dehydrogenase 2-PsXDH to obtain 2-PsXDH, and inducing the expression of a genetically engineered bacterium expressing xylitol-4-dehydrogenase 4-PaXDH to obtain 4-PaXDH; using 2-PsXDH and 4-PaXDH to catalyze the conversion of D-xylulose into L-xylulose in vitro;

[0027] (b) The genetically engineered bacteria expressing xylitol-2-dehydrogenase 2-PsXDH and the genetically engineered bacteria expressing xylitol-4-dehydrogenase 4-PaXDH are activated and protein-induced to express, and then the whole cells are collected. Then, the two kinds of whole cells obtained are added to a reaction system with D-xylulose as a substrate according to different stoichiometric ratios for catalytic reaction.

[0028] Preferably, in (b), the ratio of whole cells of genetically engineered bacteria expressing xylitol-2-dehydrogenase 2-PsXDH to whole cells of genetically engineered bacteria expressing xylitol-4-dehydrogenase 4-PaXDH is 1-2:2-1.

[0029] Preferably, in (b), the reaction system with D-xylulose as substrate comprises: 5 mmol / L NAD + , 5mmol / LNADH, 10mmol / L D-xylulose, 25mmol / L phosphate buffer (pH 7.0).

[0030] Preferably, in (b), the catalytic reaction conditions include: reacting at 30° C. and 180 rpm for 24-36 hours.

[0031] Preferably, when the system includes (iii), the method for preparing L-xylulose includes:

[0032] The L-xylulose is obtained by using D-xylulose as a substrate and inducing a genetically engineered bacterium that simultaneously expresses xylitol-2-dehydrogenase 2-PsXDH and xylitol-4-dehydrogenase 4-PaXDH to ferment.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] Compared with the existing methods for producing L-xylulose by chemical synthesis, which have the problems of large environmental pollution, high energy consumption, and contamination by various isomers, and it is difficult to obtain high-purity L-xylulose and the low yield, the present invention can produce L-xylulose without isomer pollution by means of the specific catalytic characteristics of biological enzymes, and the whole process is environmentally friendly, low in energy consumption, and the L-xylulose yield is relatively high.

[0035] The present invention adopts genetic engineering technology and enzyme engineering thinking, and cleverly designs a two-step simple enzyme catalytic reaction, which can directionally and efficiently convert D-xylulose widely present in prokaryotic, eukaryotic and other microbial cells into L-xylulose, providing a new strategy for the production of L-xylulose.

[0036] The present invention utilizes the advantages of specificity and stereoselectivity of biological enzymes to directionally regulate the isomerization of D-xylulose into L-xylulose, thereby overcoming the isomer contamination problem currently faced in the production process of L-xylulose, greatly facilitating the subsequent separation and purification of the product, and having good industrial application potential.

[0037] The two-step enzyme-controlled configuration inversion proposed in the present invention can convert D-xylulose into L-xylulose. This idea is helpful to further guide the construction of a de novo synthesis pathway for L-xylulose in vivo, so as to produce L-xylulose on a large scale through a sustainable fermentation method. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is the recombinant expression plasmid pET-psxdh2; (a) is the map of the recombinant expression plasmid pET-psxdh2; (b) is the electrophoresis diagram of the PCR verification of the psxdh2 gene.

[0039] Figure 2 It is the recombinant expression plasmid pET-paxdh4; (a) is the map of the recombinant expression plasmid pET-paxdh4; (b) is the electrophoresis diagram of the paxdh4 gene PCR verification.

[0040] Figure 3 This is the protein induced expression diagram of 2-PsXDH and 4-PaXDH.

[0041] Figure 4 The in vitro catalytic results of 2-PsXDH and 4-PaXDH are shown in Figure 1. (a) shows the in vitro catalytic results of 2-PsXDH; (b) shows the in vitro catalytic results of 4-PaXDH.

[0042] Figure 5 The diagram shows the whole-cell combined catalytic conversion results of the engineered bacteria E. coli BL21-2-PsXDH and E. coli BL21-4-PaXDH; (a) is the mass spectrometry analysis result of the catalytic product; (b) is the optical rotation detection result of the catalytic product. DETAILED DESCRIPTION

[0043] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto.

[0044] In the following examples, if no specific conditions are specified, all are carried out according to conventional known conditions or conditions recommended by the manufacturer. If no manufacturer is specified for the reagents or instruments used, all are conventional products that can be purchased commercially. Unless otherwise specified, the present invention adopts the prior art in this field.

[0045] Example 1: Construction of recombinant expression plasmid pET-psxdh2

[0046] (1) Based on the restriction sites on plasmid pET30a and the sequence of the xylitol-2-dehydrogenase gene (psxdh2) from Pichia stipitis, primers PsX-F1 / PsX-R1 were designed using Oligo 7.0 software to amplify the psxdh2 gene. The primers were synthesized by Shanghai Biotechnology.

[0047] PsX-F1: CGGAATTCatgactgctaacccttccttgg (SEQ ID No: 3);

[0048] PsX-R1: GCGTCGACttactcagggccgtcaatgagac (SEQ ID No: 4).

[0049] (2) Single restriction sites EcoRⅠ and SalI were selected to perform double restriction digestion on plasmid pET30a. The size of the restriction digestion results was preliminarily verified by DNA gel electrophoresis, and the correct gel was then excised and recovered.

[0050] (3) The psxdh2 gene fragment amplified in step (1) and the linearized plasmid pET30a recovered in step (2) were seamlessly cloned and connected. The ligase used was 2×MultiF Seamless Assembly Mix. The connection conditions were: 50°C water bath for 25 minutes. The connected product was transformed into competent E.coli DH5α by heat shock method for preservation.

[0051] The plasmid was extracted from E. coli DH5α and sent to Shanghai Sangon Biotechnology for sequencing. The one with correct sequencing was the constructed recombinant expression plasmid pET-psxdh2, and its nucleotide sequence was shown in SEQ ID No:5.

[0052] Figure 1 The recombinant expression plasmid pET-psxdh2; (a) is the map of the recombinant expression plasmid pET-psxdh2; (b) is the electrophoresis diagram of the PCR verification of the psxdh2 gene. It can be seen from the figure that the band position is consistent with the theoretical size of the psxdh2 gene.

[0053] Example 2: Construction of recombinant expression plasmid pET-paxdh4

[0054] (1) Based on the restriction sites on plasmid pET30a and the sequence of the xylitol-4-dehydrogenase gene (paxdh4) from Pantoea ananatis, primers PaX-F1 / PaX-R1 were designed using Oligo 7.0 software to amplify the paxdh4 gene. The primers were synthesized by Shanghai Biotech Biotechnology.

[0055] PaX-F1: CGGGATCcatgagcggtgaatatgacgttaacc (SEQ ID No: 6);

[0056] PaX-R1: CGGAATTCttaccagatggtaaagccaccgtc (SEQ ID No: 7).

[0057] (2) Single restriction sites BamHI and EcoRI were selected to perform double restriction digestion on plasmid pET30a. The restriction digestion results were preliminarily verified by DNA gel electrophoresis, and the correct gel was then excised and recovered.

[0058] (3) The paxdh4 gene fragment amplified in step (1) was seamlessly cloned and connected with the linearized plasmid pET30a recovered in step (2). The ligase used was 2×MultiF Seamless Assembly Mix. The connection conditions were: 50°C water bath for 25 minutes. The ligated product was transformed into competent E.coli DH5α by heat shock method for preservation.

[0059] The plasmid was extracted from E. coli DH5α and sent to Shanghai Biotechnology for sequencing. The one with the correct sequencing result was the constructed recombinant expression plasmid pET-paxdh4, and its nucleotide sequence was shown in SEQ ID No:8.

[0060] Figure 2 Figure 1 is the recombinant expression plasmid pET-paxdh4; (a) is the map of the recombinant expression plasmid pET-paxdh4; (b) is the electrophoresis diagram of the paxdh4 gene PCR verification. It can be seen from the figure that the band position is consistent with the theoretical size of the paxdh4 gene.

[0061] Example 3: Construction of Genetically Engineered Bacteria Expressing Xylitol-2-Dehydrogenase 2-PsXDH and Xylitol-4-Dehydrogenase 4-PaXDH

[0062] (1) The host E. coli DH5α containing the recombinant expression plasmid pET-psxdh2 obtained in Example 1 was activated and cultured, and the constructed recombinant expression plasmids pET-psxdh2 and pET-paxdh4 were extracted. The extracted plasmids were run on agarose gel for preliminary size verification and then sent to Shanghai Sangon Biotechnology for sequencing. The correct recombinant expression plasmids pET-psxdh2 and pET-paxdh4 were transformed into competent E. coli BL21 (DE3) by heat shock method, and then antibiotic plates were coated to select positive transformants.

[0063] (2) The selected transformants were first verified by bacterial liquid PCR of the target gene, and the nucleotide sequence of the primers used for verification was Yxdh-F1 / Yxdh-R1. The plasmids of the transformants that were correct after bacterial liquid PCR verification were further extracted and sent for sequencing. The transformants whose sequencing results were still correct were determined to be the finally constructed genetically engineered bacteria expressing xylitol-2-dehydrogenase 2-PsXDH, and were recorded as E. coli BL21-2-PsXDH.

[0064] Yxdh-F1: TAATACGACTCACTATAGGG (SEQ ID No: 9);

[0065] Yxdh-R1: GCTAGTTATTGCTCAGCGG (SEQ ID No: 10).

[0066] (3) Similarly, according to the methods described in steps (1) and (2), a genetically engineered bacterium expressing xylitol-4-dehydrogenase 4-PaXDH was constructed and recorded as E. coli BL21-4-PaXDH.

[0067] Example 4: 2-PsXDH, 4-PaXDH protein induction expression and in vitro catalysis

[0068] In this example, the expression of E. coli BL21-2-PsXDH and E. coli BL21-4-PaXDH obtained in Example 3 was induced respectively, and the pure enzymes 2-PsXDH and 4-PaXDH were extracted. The pure enzymes 2-PsXDH and 4-PaXDH were used to form a system for efficiently preparing L-xylulose based on a two-step enzymatic method to control the configuration inversion, so as to investigate the in vitro catalysis of D-xylulose to produce xylitol by the system. The specific steps are as follows.

[0069] (1) Activate E. coli BL21-2-PsXDH and E. coli BL21-4-PaXDH and wait until OD 600When the concentration reaches 0.6-0.8, 1mmol / L IPTG is added to the cultured bacterial solution to induce protein expression. The induction temperature is 20-26°C, the induction time is 8-12h, and the rotation speed is 160rpm.

[0070] (2) Collect the induced bacteria, wash them twice with phosphate buffer (pH 7.0), resuspend them in 10-15 mL of buffer, and then perform cell ultrasonic disruption on ice to dissolve the expressed protein. After stopping the disruption, centrifuge at low temperature to collect the supernatant, which is the crude enzyme solution.

[0071] (3) The crude enzyme solution is further treated with Ni 2+ Column purification, specifically: the crude enzyme solution passes through a 0.45 μm filter membrane and slowly flows through the Ni 2+ Column, so that the target protein is attached to Ni as much as possible 2+ The impurities were then eluted with 50 mM imidazole, and then the target protein was eluted with 500 mM imidazole. The target protein was collected in an EP tube, and the concentration was measured with a BCA protein concentration determination kit. SDS-PAGE was further run to detect the protein size and purification effect. The results are as follows Figure 3 shown.

[0072] from Figure 3 It can be seen that 2-PsXDH and 4-PaXDH were successfully expressed, and their sizes were consistent with the theoretical values.

[0073] (4) Using the 2-PsXDH and 4-PaXDH proteins obtained in step (3) for in vitro catalysis, the specific steps are as follows:

[0074] In vitro catalysis of S1.2-PsXDH:

[0075] 10-20 μL of pure enzyme 2-PsXDH was added to 1 mL of reaction system, and the reaction was carried out at 30°C and 120 rpm for 12 hours. After centrifugation, the supernatant was collected and the catalytic conversion of D-xylulose to xylitol by 2-PsXDH was determined by high performance liquid chromatography. The specific composition of the reaction system is: 5 mmol / L NADH, 10 mmol / L D-xylulose, 25 mmol / L Tris-HCl buffer (pH 5.0).

[0076] The specific detection conditions are: RID detector, Hi-Plex Ca 7.7x 300mm chromatographic column, column temperature 65℃, detector temperature 40℃, pure water as mobile phase, flow rate 0.6mL / min, and the content of each component is calculated based on the peak area. The results are as follows: Figure 4 shown.

[0077] from Figure 4It can be seen that no xylitol was produced in the blank control without enzyme, while the experimental group with pure enzyme 2-PsXDH successfully catalyzed D-xylulose to produce xylitol.

[0078] In vitro catalysis of S2.4-PaXDH:

[0079] Take 10-20 μL of pure enzyme 4-PaXDH and add it to 1 mL of reaction system. React at 30°C and 120 rpm for 8-12 hours. After centrifugation, take the supernatant to determine the conversion of xylitol to L-xylulose catalyzed by 4-PaXDH. The results are as follows: Figure 4 As shown. The specific composition of the reaction system is: 5mmol / L NAD + , 30mmol / L xylitol, 50mmol / L Gly-NaOH buffer (pH 10).

[0080] from Figure 4 It can be seen that the blank control did not detect the production of L-xylulose because the enzyme 4-PaXDH was not added, while the experimental group with pure enzyme 4-PaXDH successfully detected L-xylulose.

[0081] In this example, the specific rotation of the product catalyzed by 4-PaXDH was measured by a polarimeter. The result showed that the specific rotation value of the product was +29.57°, while the specific rotations of the corresponding standard substances D-xylulose and L-xylulose in the literature were -29.40° and +26.50°, respectively, thus proving that the final product catalyzed by 4-PaXDH was L-xylulose.

[0082] Example 5: Engineering bacteria E. coli BL21-2-PsXDH and E. coli BL21-4-PaXDH jointly catalyze the conversion of D-xylulose into L-xylulose

[0083] In this example, E. coli BL21-2-PsXDH whole cells and E. coli BL21-4-PaXDH whole cells were prepared according to E. coli BL21-2-PsXDH and E. coli BL21-4-PaXDH obtained in Example 3, and the ability of E. coli BL21-2-PsXDH whole cells and E. coli BL21-4-PaXDH whole cells to jointly catalyze the conversion of D-xylulose into L-xylulose was investigated. The specific steps are as follows:

[0084] E. coli BL21-2-PsXDH and E. coli BL21-4-PaXDH were activated and cultured respectively, and the cells were collected by centrifugation and washed twice with phosphate buffer (pH 7.0). Then, different bacterial cell ratios of 1:1, 1:2, and 2:1 between E. coli BL21-2-PsXDH and E. coli BL21-4-PaXDH were added to the reaction system respectively, and reacted at 30°C and 180rpm for 24-36h. The supernatant was then collected by centrifugation and combined with high performance liquid chromatography analysis and specific rotation determination to determine the production of the product L-xylulose. The results are shown in FIG. Figure 5 As shown. Among them, the reaction system composition is: 5mmol / L NAD + , 5mmol / L NADH, 10mmol / L D-xylulose, 25mmol / L phosphate buffer (pH 7.0).

[0085] from Figure 5 The mass spectrometry results show that after the whole cells of E. coli BL21-2-PsXDH and E. coli BL21-4-PaXDH were added in a ratio of 2:1, a higher molecular ion peak m / z = 173.0417 corresponding to xylulose can be detected in the primary mass spectrum, and the standard value is [M+Na] + (m / z=173.0420). The optical rotation of the reaction product was further measured by a polarimeter and it was found that the optical rotation value of the reaction product was +0.25°, which was consistent with the specific rotation value of the corresponding standard L-xylulose in the literature (+). This shows that at this time, not only L-xylulose was produced in the reaction product, but also L-xylulose was the main one, and D-xylulose was mostly converted into L-xylulose.

[0086] In summary, the present invention has determined two key enzymes 2-PsXDH and 4-PaXDH that can mediate the directional conversion of D-xylulose to L-xylulose through in vitro screening and catalytic verification, and has constructed a system for controlling configuration inversion and efficiently preparing L-xylulose based on a two-step enzymatic method; the system can synthesize L-xylulose by directional regulation of configuration conversion, can effectively overcome the problems of isomer contamination in chemical synthesis, greatly facilitates the subsequent separation and purification of the product, and has good industrial application potential; the preparation method of L-xylulose according to the present invention is simple, can be used for in vivo or in vitro catalysis of D-xylulose conversion to L-xylulose, and has good practicality.

[0087] The embodiments are preferred implementations of the present invention, but the present invention is not limited to the above-mentioned implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essential content of the present invention belong to the protection scope of the present invention.

Claims

1. A system for efficiently preparing L-xylulose by controlling configuration inversion based on a two-step enzymatic method, characterized in that: The system includes any of the following: (i) xylitol-2-dehydrogenase 2-PsXDH and xylitol-4-dehydrogenase 4-PaXDH; (ii) a genetically engineered bacterium expressing xylitol-2-dehydrogenase 2-PsXDH and a genetically engineered bacterium expressing xylitol-4-dehydrogenase 4-PaXDH; (iii) A genetically engineered bacterium that simultaneously expresses xylitol-2-dehydrogenase 2-PsXDH and xylitol-4-dehydrogenase 4-PaXDH.

2. The system according to claim 1, characterized in that In the system, xylitol-2-dehydrogenase 2-PsXDH is derived from Pichia stipitis, and the nucleotide sequence encoding xylitol-2-dehydrogenase 2-PsXDH is shown in SEQ ID No: 1; Xylitol-4-dehydrogenase 4-PaXDH is derived from Pantoea ananatis, and the nucleotide sequence encoding xylitol-4-dehydrogenase 4-PaXDH is shown in SEQ ID No:

2.

3. Use of the system according to claim 1 or 2 in converting D-xylulose to prepare L-xylulose.

4. A method for efficiently preparing L-xylulose by controlling configuration inversion based on a two-step enzymatic method, characterized in that: The method utilizes the system described in claim 1 or 2 to convert D-xylulose into L-xylulose.

5. The method according to claim 4, characterized in that When the system comprises (i), the method comprises: (1) Using D-xylulose as the reaction substrate, 2-PsXDH is used to catalyze D-xylulose to produce xylitol; (2) Using xylitol in (1) as the reaction substrate, 4-PaXDH was used to catalyze the conversion of xylitol into L-xylulose.

6. The method according to claim 5, characterized in that In step (1), the catalytic reaction system includes: 5mmol / L NADH, 10mmol / L D-xylulose, 25mmol / L Tris-HCl buffer and an appropriate amount of 2-PsXDH; After adding 2-PsXDH, the reaction was carried out at 30 °C and 120 rpm for 12 h; In step (2), the catalytic reaction system includes: 5mmol / L NAD + , 30mmol / L xylitol, 50mmol / L Ly-NaOH buffer (pH 10) and appropriate amount of 4-PaXDH; After adding 4-PaXDH, the mixture was reacted at 30°C and 120 rpm for 8 to 12 hours.

7. The method according to claim 4, characterized in that When the system includes (ii), the method for constructing the genetically engineered bacteria expressing xylitol-2-dehydrogenase 2-PsXDH includes: Amplifying the xylitol-2-dehydrogenase gene psxdh2 and connecting it with the linearized plasmid vector pET-30a to obtain the recombinant expression plasmid pET-psxdh2, which was then transformed into Escherichia coli to obtain a genetically engineered bacterium expressing xylitol-2-dehydrogenase 2-PsXDH; The method for constructing the genetically engineered bacteria expressing xylitol-4-dehydrogenase 4-PaXDH comprises: The xylitol-4-dehydrogenase gene paxdh4 was amplified and connected to the linearized plasmid vector pET-30a to obtain the recombinant expression plasmid pET-paxdh4, which was transformed into Escherichia coli to obtain a genetically engineered bacterium expressing xylitol-4-dehydrogenase 4-PsXDH.

8. The method according to claim 4, characterized in that When the system includes (ii), the method for preparing L-xylulose includes any one of the following: (a) Inducing the expression of a genetically engineered bacterium expressing xylitol-2-dehydrogenase 2-PsXDH to obtain 2-PsXDH, and inducing the expression of a genetically engineered bacterium expressing xylitol-4-dehydrogenase 4-PaXDH to obtain 4-PaXDH; using 2-PsXDH and 4-PaXDH to catalyze the conversion of D-xylulose into L-xylulose in vitro; (b) The genetically engineered bacteria expressing xylitol-2-dehydrogenase 2-PsXDH and the genetically engineered bacteria expressing xylitol-4-dehydrogenase 4-PaXDH are activated and protein-induced to express, and then the whole cells are collected. Then, the two kinds of whole cells obtained are added to a reaction system with D-xylulose as a substrate according to different stoichiometric ratios for catalytic reaction.

9. The method according to claim 8, characterized in that In (b), the ratio of whole cells of genetically engineered bacteria expressing xylitol-2-dehydrogenase 2-PsXDH to whole cells of genetically engineered bacteria expressing xylitol-4-dehydrogenase 4-PaXDH is 1-2:2-1; The reaction system with D-xylulose as substrate includes: 5mmol / L NAD + , 5mmol / L NADH, 10mmol / L D-xylulose, 25mmol / L phosphate buffer; The conditions of the catalytic reaction include: reacting at 30° C. and 180 rpm for 24-36 hours.

10. The method according to claim 4, characterized in that When the system includes (iii), the method for preparing L-xylulose includes: The L-xylulose is obtained by using D-xylulose as a substrate and inducing a genetically engineered bacterium that simultaneously expresses xylitol-2-dehydrogenase 2-PsXDH and xylitol-4-dehydrogenase 4-PaXDH to ferment.

Images