SNP (Single Nucleotide Polymorphism) site related to wing width character of bee and application of SNP site

Abstract

The invention relates to the technical field of animal breeding, in particular to an SNP (Single Nucleotide Polymorphism) site related to a bee wing width character and application thereof. The SNP site is located at the 6431988th site of the 12 # chromosome of the bee, and the polymorphism is C / G. The SNP site related to the bee wing width character is screened based on the whole genome association analysis result of bee sample data, and the to-be-detected bee wing width character can be judged based on the detection result of the SNP site. The SNP locus provided by the invention can be applied to molecular marker-assisted breeding of bees, is used for breeding bee species with specific wing width characters, and has important significance in the field of bee breeding.

Description

Technical Field

[0001] The invention relates to the technical field of animal breeding, and in particular to a SNP site related to a honeybee wing width trait and an application thereof. Background Art

[0002] Chinese honey bee ( Apis cerana , referred to as "Chinese bees") have formed rich local resource types (ecotypes) in diverse geographical environments, showing different morphological characteristics, biological characteristics and production performance. Effectively evaluating the morphological traits of Chinese bees is an important means of exploring, protecting, identifying and utilizing bee species resources, and is also a necessary method for evaluating bee species performance in bee production.

[0003] Traditional and classic bee species identification and performance evaluation methods focus on morphological markers. Although morphological markers have advantages such as low cost and easy operation, they have inherent disadvantages and are not applicable to Chinese bees. First, morphological markers are directly related to the individual development of bees and are easily affected by external interference factors such as nutritional conditions during development. Secondly, the morphological measurement of Chinese bees is delicate, and there are strict requirements on the accuracy of measuring instruments and the proficiency of morphological anatomy of measurement personnel. In addition, the workload of bee morphological measurement is huge, and the operability is not strong. Finally, the morphological measurement standards of Chinese bees are not unified, there are artificial differences between measurement personnel, and the phenomenon of human errors affecting the interpretation of results is serious. Wing width is one of the important morphological traits of bees. It affects the flight ability, energy consumption and efficiency of collecting pollen of bees to a certain extent. The development of molecular markers related to wing width traits is conducive to the breeding of high-quality bee species.

[0004] The molecular method of first-generation sequencing is mature and easy to operate. The current market environment can quickly sequence the target gene fragments, with low cost and not easily restricted by technology. Through genome sequencing and GWAS analysis of the wing width trait of Chinese honey bees, the SNP sites associated with the wing width of Chinese honey bees can be found, and the wing width of Chinese honey bees can be identified by first-generation sequencing, replacing the complicated wing width measurement work. However, the SNP sites associated with the wing width of Chinese honey bees are still unclear, and the identification of the wing width trait of Chinese honey bees cannot be achieved through simple first-generation sequencing. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention discloses a SNP site related to the wing width trait of a honey bee and an application thereof.

[0006] In a first aspect, the present invention provides a SNP site, based on the genome version PRJNA738447, wherein the SNP site is located at position 6431988 of chromosome 12 of the honey bee, and the polymorphism is C / G.

[0007] The present invention further provides a SNP site, wherein the SNP site is located at position 125 of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is C / G.

[0008] Such as SEQ ID The nucleotide sequence shown in NO.1 is as follows: TAGCTCGCGTGATAGGATGGTATCAAGCTCGATGAAAAAAGGAAGAAAGAAAAGGAAAGGGAAAAAAAATCTAAAATCTTCCGATACAAAAAGTTGCTCTCGTGTAATCGACTCGATTACAGATGATCGATCAAAACTAGATCGACTCGTGAAAATCTCTTTTCTC CAATTACCAGCATTGGAGGATTTAAATTCGAATCGTGTTTCCCAAGTATCGACGAAAGATTCGGATCTACACGCGCAATCTACCTAATCGTTTACGTATCTCGCGCCAACTACAACAGGATTCCTATTAAAATCTACTCTACATCGCGTACATACGCATCGGTATATTCGCATCGGTGGT.

[0009] In a second aspect, the present invention provides a primer pair comprising the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3.

[0010] The nucleotide sequence shown in SEQ ID NO.2 is as follows: TAGCTCGCGTGATAGGATGG; the nucleotide sequence shown in SEQ ID NO.3 is as follows: ACCACCGATGCGAATATACC.

[0011] In a third aspect, the present invention further provides a kit, which comprises the SNP site or the primer pair.

[0012] In a fourth aspect, the present invention provides the use of the SNP site, or the primer pair, or the kit in identifying the wing width trait of a honey bee.

[0013] The present invention further provides the use of the SNP site, the primer pair, or the kit in the breeding of bees with different wing width traits.

[0014] Furthermore, the bee is Apis mellifera.

[0015] In a fifth aspect, the present invention provides a method for identifying the characteristics of bee wings, comprising: The DNA of the bee to be tested is used as a template, and the primer pair is used for amplification, and the wing width of the bee to be tested is determined according to the amplification result.

[0016] Further, based on a total system of 25 μL, the amplification system includes: Template DNA 1~2μL, upstream primer 1~2μL, downstream primer 1~2μL, Dntp mix 1~2μL, 10×TaqBuffer 2~4μL, Taq enzyme 0.2~0.4μL, the balance is water; The amplification procedure includes: Pre-denaturation at 95℃ for 5-10min; Denaturation at 92-96°C for 30-60s, annealing at 62-65°C for 30-60s, extension at 70-74°C for 30-60s, cycle 10-15 times, with the annealing temperature decreasing by 0.4-0.6°C each time; Denaturation at 93-96°C for 30-60s, annealing at 56-60°C for 30-60s, extension at 70-74°C for 30-60s, cycle 25-35 times; Repair was extended at 70~74℃ for 10~15min.

[0017] Further, judging the wing width of the bee to be tested according to the amplification result includes: In the amplification results, the primer pair identified that bees with genotype GG have longer wing width than bees with genotype GC.

[0018] The present invention has the following beneficial effects: The present invention is based on the wing width data of multiple Chinese honey bees, and a SNP site is screened through genome data association analysis. The SNP site is related to the wing width trait of the honey bee. Through the detection of the SNP site, the identification of the wing width trait of the honey bee can be achieved. The SNP site provided by the present invention can be used for the breeding of bees with specific wing width traits, which is of great significance in the field of cultivating high-quality honey bee germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 This is a comparison chart of the wing widths of individuals with different genotypes at the Chr12_6431988 locus of the Chinese honey bee provided in Example 2 of the present invention.

[0021] Figure 2 This is a gel electrophoresis diagram of the amplification result of the primer pair provided in Example 3 of the present invention (targeting the 6431988th site of chromosome 12 of the honey bee); the left band is the marker, and the right three bands are the amplification products. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0024] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0025] Example 1

[0026] The present invention provides a SNP site (Chr12_6431988) obtained by screening, and the screening process is as follows: 1. The present invention is based on 110 groups of Chinese honey bees. One worker bee is selected from each group to measure the width of its forewing. For the above-mentioned dissected worker bees, the genomic DNA of the worker bee chest tissue is extracted, and then the library is constructed using the Truseq Nano DNA HT kit (Illumina, USA). The DNA is randomly broken into 350bp fragments, and the DNA library is obtained through end repair, ployA tailing, sequencing adapter addition, amplification, purification and other steps. The insert size of the library is quality inspected using Agilent 2100, and the effective concentration of the library is accurately quantified using the qPCR method. The DNA library construction is completed after the quality meets the standard.

[0027] 2. Genome sequencing, alignment and SNPs identification: After the sample library was successfully constructed, the sample library was sequenced based on the Illumina HiseqPE150 platform (Illumina, USA). During the sequencing process, low-quality reads were deleted to ensure the quality of the results [quality control standards: delete reads containing more than 10% unknown nucleotides, delete reads containing adapter sequences, delete reads with low quality (phred quality <5) base content exceeding 50% of the length in the sequencing], and finally a single bee sample generated more than 4.5G high-quality paired-end clean reads, with Q20 and Q30 above 90% and 85%, respectively.

[0028] 3. The obtained high-quality paired-end clean reads were aligned to the reference genome Apis cerana (Genbank accession number: PRJNA738447) using BWA 0.7.8 software. The alignment results were deduplicated using SAMTOOLS 1.15 software, and the average alignment rate of the population samples was guaranteed to be above 95%, and the average sequencing depth of the genome was above 20X.

[0029] 4. The Bayesian model in SAMTOOLS 1.15 software was used to detect group SNPs, and high-quality SNPs were screened according to the quality control standards [delete SNPs with sequencing error rate >1% (Q20 quality control), delete SNPs with base spacing <5 between adjacent SNP sites, delete SNPs with coverage depth exceeding 1 / 3~5 times the average depth]. ANNOVAR 20130520 software was used to annotate the detected SNPs, identify exon regions, intron regions, variable splicing sites, upstream and downstream regions of genes, and intergenic regions, and distinguish between synonymous mutation SNPs and non-synonymous mutation SNPs.

[0030] 5. Genome-wide association analysis: Genome-wide association studies (GWAS) were conducted based on mrMLM 1.3 software to clarify the association between wing width trait and SNPs loci. The SNPs quality control standard was MAF>5%, and the multi-locus random mixed linear model was selected as the model.

[0031] Finally, a SNP site Chr12_6431988 was screened, which is located at position 6431988 on chromosome 12 of the honey bee, with a polymorphism of C / G. The polymorphism of this site is highly correlated with the wing width trait of the honey bee.

[0032] Example 2

[0033] The present invention selects 107 Chinese honey bee samples to carry out verification work, verifies the effect of the SNP site involved in Example 1, specifically sequences the 107 Chinese honey bees, and uses a microscopic measurement system to measure the wing width of the 107 honey bees to obtain the wing width data and SNP data of the 107 honey bees; The genotypes at the SNP loci were grouped, and the wing width data of different groups were analyzed for significant differences using SPSS 16.0 software to compare whether there were differences in wing width among different genotypes.

[0034] Finally, 16 Chinese bees showed C / C genotype, 53 Chinese bees showed G / C genotype, and 38 Chinese bees showed G / G genotype. Figure 1 As shown in the figure, there was a significant difference in wing width between the G / C genotype and the G / G genotype (P<0.05), and the wing width of the G / C genotype bees was significantly smaller than that of the G / G genotype bees.

[0035] Table 1 Comparison of wing width of individuals with different genotypes at Chr12_6431988 in A. cerana

[0036] *express P <0.05, the difference is significant.

[0037] Example 3

[0038] The present invention further amplifies the SNP sites involved in Example 1 for three samples, specifically including: 1. Primer pairs are as follows: Upstream primer: 5'-TAGCTCGCGTGATAGGATGG-3',

[0039] Downstream primer: 5′-ACCACCGATGCGAATATACC-3′.

[0040] 2. The PCR system is as follows:

[0041] The PCR program is as follows:

[0042] 3. Test results

[0043] The results are as follows Figure 2 As shown, it can be seen from the results that the electrophoresis bands of the amplified DNA fragments are clear and bright, without any mixed bands, indicating that the primers, amplification system and program have strong specificity, and can achieve the purpose of detecting the polymorphism of the target SNP site in combination with sequencing and other methods.

[0044] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP site, characterized in that: Based on the genome version PRJNA738447, the SNP site is located at position 6431988 of chromosome 12 of the honey bee, and the polymorphism is C / G.

2. A SNP site, characterized in that: The SNP site is located at position 125 of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is C / G.

3. A primer pair, characterized in that: It includes the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. A kit, characterized in that: It comprises the SNP site described in claim 1 or 2, or the primer pair described in claim 3.

5. Use of the SNP site described in claim 1 or 2, or the primer pair described in claim 3, or the kit described in claim 4 in identifying the wing width trait of a honey bee.

6. Use of the SNP site according to claim 1 or 2, or the primer pair according to claim 3, or the kit according to claim 4 in the breeding of bees with different wing width traits.

7. The use according to claim 5 or 6, characterized in that: The honey bee is an oriental honey bee.

8. A method for identifying the characteristics of bee wings, characterized in that: include: The DNA of the bee to be tested is used as a template, and the primer pair described in claim 3 is used for amplification, and the wing width of the bee to be tested is determined according to the amplification result.

9. The method according to claim 8, characterized in that Taking the total system as 25 μL, the amplification system includes: Template DNA 1~2μL, upstream primer 1~2μL, downstream primer 1~2μL, Dntp mix 1~2μL, 10×Taq Buffer 2~4μL, Taq enzyme 0.2~0.4μL, and the balance is water; The amplification procedure includes: Pre-denaturation at 95℃ for 5-10min; Denaturation at 92-96°C for 30-60s, annealing at 62-65°C for 30-60s, extension at 70-74°C for 30-60s, cycle 10-15 times, with the annealing temperature decreasing by 0.4-0.6°C each time; Denaturation at 93-96°C for 30-60s, annealing at 56-60°C for 30-60s, extension at 70-74°C for 30-60s, cycle 25-35 times; Repair was extended at 70~74℃ for 10~15min.

10. The method according to claim 8 or 9, characterized in that: Determining the wing width of the bee to be tested according to the amplification result includes: In the amplification results, the primer pair identified that bees with genotype GG have longer wing width than bees with genotype GC.

Images