Multiplex fluorescent PCR kit and method for simultaneously detecting multiple pathogenic microorganisms and drug-resistant genes

Abstract

The invention discloses a multiplex fluorescent PCR (polymerase chain reaction) kit and a detection method for multiple pathogenic microorganisms and drug-resistant genes. The kit comprises a primer and a fluorescent probe which are used for detecting target pathogenic microorganisms and drug-resistant genes, a PCR reaction premix solution, a positive quality control product and a negative quality control product. A plurality of fluorescent channels are used for respectively marking corresponding detection targets, and the amplification conditions of different targets are monitored by monitoring the change conditions of fluorescent signals in different fluorescent channels, so that the detection of 96 pathogenic microorganisms and drug-resistant genes is realized. The multiplex fluorescent PCR kit disclosed by the invention can be used for simultaneously detecting various pathogenic microorganisms and drug-resistant genes, and is high in accuracy, strong in specificity, high in sensitivity, rapid and reliable in result.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a multiplex fluorescent PCR kit and method for simultaneously detecting multiple pathogenic microorganisms and drug-resistant genes. Background Art

[0002] The incidence of infectious diseases has increased globally, and the types of pathogens are becoming more diverse and complex. The widespread abuse of antibiotics has led to bacterial resistance through gene or chromosome mutations, making it possible for a variety of infectious diseases to have no suitable antibiotics to treat them, posing a huge threat to human health.

[0003] Drug-resistant gene: a nucleotide sequence that encodes the drug-resistant traits of microorganisms. Like other genetic materials, it can be replicated during bacterial division and proliferation, causing the microorganisms to become resistant to the corresponding antibiotics.

[0004] Fluorescence PCR: A fluorescent reporter group is introduced into the PCR amplification reaction system. As each round of PCR reaction proceeds, the fluorescent signal emitted by the fluorescent reporter group will continue to accumulate. By monitoring the changes in the fluorescent signal through an instrument, the PCR reaction process can be monitored in real time.

[0005] Multiplex fluorescence PCR: Based on fluorescence PCR, multiple distinguishable fluorescent reporter groups are introduced into the same reaction system. By monitoring the changes in different fluorescent signals, multiple PCR reaction processes can be monitored simultaneously, thereby achieving the purpose of simultaneously detecting multiple targets.

[0006] At present, fluorescent PCR kits have a small number of detection targets, cannot indicate the relevant drug resistance information of pathogenic microorganisms, and cannot meet clinical testing needs. Specifically, they basically only detect pathogen nucleic acids, do not involve the detection of drug-resistant genes, and cannot indicate the relevant drug resistance information of pathogenic microorganisms in a single test; fluorescent PCR kits that detect a single target, such as human cytomegalovirus fluorescent PCR detection kits, can only detect whether there is human cytomegalovirus nucleic acid in the sample to be tested, but other viruses, such as respiratory syncytial virus and influenza A virus, cannot be detected. As a result, if this type of fluorescent PCR kit is used clinically to identify infectious pathogens, multiple tests are required to determine the true pathogenic microorganism. Most of the existing fluorescent PCR detection kits are single-target detection and do not involve the detection of drug-resistant genes. The pathogen information obtained through a single test is relatively small. Summary of the invention

[0007] In view of the above-mentioned defects in the prior art, the present invention provides a multiplex fluorescent PCR kit for simultaneously detecting multiple pathogenic microorganisms and drug-resistant genes. Based on multicolor fluorescent channels, PCR amplification is performed on specific conserved regions of pathogenic microorganisms and drug-resistant genes in the target respectively, and multiple fluorescent channels are used to mark corresponding detection targets respectively, and the amplification of different targets is monitored. It can realize the simultaneous detection of dozens of pathogens and drug-resistant genes in one machine process, and has high accuracy, strong specificity, high sensitivity, rapidity and reliable results.

[0008] Based on the results of bioinformatics analysis, four pairs of primers and fluorescent probes that would not cause non-specific cross-amplification were combined together. Eventually, 24 combinations were formed, each of which detected four targets, and a total of 96 pathogens and drug-resistant genes could be detected, greatly increasing the amount of sample pathogen information obtained.

[0009] The present invention provides a multiplex fluorescent PCR kit for simultaneously detecting multiple pathogenic microorganisms and drug-resistant genes, comprising primers and fluorescent probes for detecting target pathogenic microorganisms and drug-resistant genes, a PCR reaction premix, a positive quality control product, and a negative quality control product.

[0010] Preferably, the target pathogenic microorganisms and drug resistance genes include Staphylococcus aureus, Streptococcus pneumoniae, Enterococcus faecalis, Enterococcus faecium, Pneumococcus resistance, Mycoplasma pneumoniae, Mycobacterium avium complex, Stenotrophomonas maltophilia, Legionella pneumophila, Moraxella catarrhalis, Pseudomonas aeruginosa, Acinetobacter baumannii, Haemophilus influenzae, Escherichia coli, Klebsiella pneumoniae, Epstein-Barr virus, Aspergillus fumigatus, Aspergillus flavus, human cytomegalovirus, influenza A virus, white Candida, tropical Candida, Whipple's Trophic Barrier, human bocavirus, Mycobacterium tuberculosis, novel coronavirus, influenza B virus, human metapneumovirus, Chlamydia psittaci, rhinovirus, internal reference gene, respiratory syncytial virus, Listeria monocytogenes, Streptococcus pyogenes, Streptococcus agalactiae, Mycobacterium chelonae, Nocardia asteroides, Fusobacterium nucleatum, Orientia tsutsugamushi, Bartonella henselae, Burkholderia glanders, Neisseria meningitidis, Enteric sand , Proteus mirabilis, Burkholderia cepacia, Serratia marcescens, Klebsiella aerogenes, Nocardia mallei, Aspergillus niger, Aspergillus terreus, Brucella melitensis, Morganella morganii, Candida glabrata, Candida parapsilosis, Mycoplasma hominis, Chlamydia trachomatis, Candida krusei, Candida dubliniensis, Chlamydia pneumoniae, Treponema pallidum, Cryptococcus neoformans, Trichosporon asahii, Bacteroides fragilis, Brucella spp., Talaromyces marneffei, Pneumocystis jiroveci Sporobacterium, Bordetella pertussis, Aeromonas hydrophila, Rhizopus microsporus, Fusarium spp., Citrobacter freundii, Nocardia otitidis caviae, human herpesvirus 1, human herpesvirus 2, human herpesvirus 3 (VZV), human herpesvirus 6, human herpesvirus 7, Streptococcus suis, Mycobacterium intracellulare, Nocardia gelsenkirchen, adenovirus 3, adenovirus 4, adenovirus 7, adenovirus 21, Hantavirus, mecA, bla KPC, NDM, OXA-48, VIM, IMP, vanA, ampC, OXA-23, SHV, MCR-1;

[0011] Preferably, the primers of the target pathogenic microorganism and drug-resistant gene and the upstream primer sequence, downstream primer sequence and nucleic acid sequence of the fluorescent probe are as follows:

[0012] For the detection of Staphylococcus aureus, the nucleic acid sequence of the upstream primer is: GGCGGCGTGCCTAATA; the nucleic acid sequence of the downstream primer is: CTAACATCAGAGAAGCAAGC; the nucleic acid sequence of the fluorescent probe is: GCAAGTCGAGCGAACGGACGAG;

[0013] For the detection of Streptococcus pneumoniae, the nucleic acid sequence of the upstream primer is: CTTATGGGCGCCAAGTCTA; the nucleic acid sequence of the downstream primer is: AAGCTTCAAAAGCAGCCTCTA; the nucleic acid sequence of the fluorescent probe is: AAGTTGGAAACCACGAGTAAGAGTGATGA;

[0014] For the detection of Enterococcus faecalis, the nucleic acid sequence of the upstream primer is: ATGCCGCGTTCATTTA; the nucleic acid sequence of the downstream primer is: TTCTTGTAATTTTTCACGATCAA; the nucleic acid sequence of the fluorescent probe is: ACCAAATCGGCGAAACAACGTCTG;

[0015] For the detection of Enterococcus faecium, the nucleic acid sequence of the upstream primer is: GTATCAAGATCGTTGTTCGTGCTT; the nucleic acid sequence of the downstream primer is: TGATCCTTCATAACCAGCGTTT; the nucleic acid sequence of the fluorescent probe is: AAGAACCAATTCGTCAAATCGCTG;

[0016] Used to check the drug resistance of bronchitis, the nucleic acid sequence of the upstream primer is: AATCCAGGTACGGGTGAAGACA; the nucleic acid sequence of the downstream primer is: TGCTCCTACCTATTCTCTACATGATAATG; the nucleic acid sequence of the fluorescent probe is: AACGGGACGGGAAGAC;

[0017] For the detection of Mycoplasma pneumoniae, the nucleic acid sequence of the upstream primer is: GCCACACCAATGCCATCA; the nucleic acid sequence of the downstream primer is: GAGGGAGGAAAAGCTCGTGTT; the nucleic acid sequence of the fluorescent probe is: CGCGCTTAACCGTGAACG;

[0018] For the examination of Mycobacterium avium complex, the nucleic acid sequence of the upstream primer is: CATCGAGAGCCGATGAAG; the nucleic acid sequence of the downstream primer is: GATCAATGCTCGGTTGAC; the nucleic acid sequence of the fluorescent probe is: ACGTGGGAGGCTGCGATATGC;

[0019] For the detection of Stenotrophomonas maltophilia, the nucleic acid sequence of the upstream primer is: GCCGAAAGCCCAAGGTTT; the nucleic acid sequence of the downstream primer is: CGACTTTCGTCCTCGCCTTA; the nucleic acid sequence of the fluorescent probe is: CGCAACGTTAATCGGCGCAGG;

[0020] For the detection of Legionella pneumophila, the nucleic acid sequence of the upstream primer is: TGCCAAGTGGTTTGCAATACAA; the nucleic acid sequence of the downstream primer is: TTCGACAGTGACTGTATCCGATTT; the nucleic acid sequence of the fluorescent probe is: AATCAATTCTGGAAATGGTGTGTTAAACCCGG;

[0021] For the detection of Moraxella catarrhalis, the nucleic acid sequence of the upstream primer is: GGTGAGTGCCGCTTTTACAAC; the nucleic acid sequence of the downstream primer is: TGTATCGCCTGCCAAGACAA; the nucleic acid sequence of the fluorescent probe is: TGCTTTTGCAGCTGTTAGCCAGCCTAAG;

[0022] For the examination of Pseudomonas aeruginosa, the nucleic acid sequence of the upstream primer is: AGCCTTCCTGGTCCCCTTAC; the nucleic acid sequence of the downstream primer is: CCTAATGAACCCCAGTGTATAAGTTTG; the nucleic acid sequence of the fluorescent probe is: TGAACTGACGGTCGCCAACGGTT;

[0023] For the detection of Acinetobacter baumannii, the nucleic acid sequence of the upstream primer is: TCTTGGTGGTCACTTGAAGCC; the nucleic acid sequence of the downstream primer is: ACTCTTGTGGTTGTGGAGCAA; the nucleic acid sequence of the fluorescent probe is: TGTAGTAGAAGTTGCTCCAGTTGAACCAACTC;

[0024] For the detection of Haemophilus influenzae, the nucleic acid sequence of the upstream primer is: AGCTTGTAGTTCATCTAACA; the nucleic acid sequence of the downstream primer is: CAGAGTAACCGCCAAAAGTT; the nucleic acid sequence of the fluorescent probe is: CGATGCTGCAGGCAATGGTGCT;

[0025] For detecting Escherichia coli, the nucleic acid sequence of the upstream primer is: CGGCGTGGTGTAGAGCATT; the nucleic acid sequence of the downstream primer is: GCAGTCTTACTTCCATGATTTCTTTAAC; the nucleic acid sequence of the fluorescent probe is: CGCTGCGATGGATCCCGG;

[0026] For the detection of Klebsiella pneumoniae, the nucleic acid sequence of the upstream primer is: CGGGCGTAGCGCGTAA; the nucleic acid sequence of the downstream primer is: GATACCCGCATTCACATTAAACAG; the nucleic acid sequence of the fluorescent probe is: CCCGGCATGGATCGTTCCGA;

[0027] For detecting Epstein-Barr virus, the nucleic acid sequence of the upstream primer is: GGCCGTGATGGAGGCTA; the nucleic acid sequence of the downstream primer is: AGACAGAGGCCACCACG; the nucleic acid sequence of the fluorescent probe is: ACCTTTGGCTCGGCCTCCTGC;

[0028] For the detection of Aspergillus fumigatus, the nucleic acid sequence of the upstream primer is: GAAGACCCCAACATG; the nucleic acid sequence of the downstream primer is: CGGAACCAAGAGATCCGTTGT; the nucleic acid sequence of the fluorescent probe is: ACGCTGTTCTGAAAGTATGCAG;

[0029] For checking Aspergillus flavus, the nucleic acid sequence of the upstream primer is: GTCCGATCCTCGAGCGTATG; the nucleic acid sequence of the downstream primer is: TTGATTTGCGTTCGGCAAG; the nucleic acid sequence of the fluorescent probe is: CCCGCTCTGTAGGCCCGGCC;

[0030] For the detection of human cytomegalovirus, the nucleic acid sequence of the upstream primer is: CTAGTGTGATGCTGCCAA; the nucleic acid sequence of the downstream primer is: TTCATGCAGATCTCCTCAATG; the nucleic acid sequence of the fluorescent probe is: CCTGAGGTTATCAGTGTAATGAAGC;

[0031] For the detection of influenza A virus, the nucleic acid sequence of the upstream primer is: GTCAGGCCCCCTCAAA; the nucleic acid sequence of the downstream primer is: TGTGTTCTTCCCTGCAAAGA; the nucleic acid sequence of the fluorescent probe is: AGATCGCGCAGAGACTTGAAGA;

[0032] For the examination of Candida albicans, the nucleic acid sequence of the upstream primer is: TTTGGTGTTGAGCAATACGA; the nucleic acid sequence of the downstream primer is: AGCGATCCCGCCTTACC; the nucleic acid sequence of the fluorescent probe is: GGTTTGCTTGAAAGACGGTAG;

[0033] For the examination of Candida tropicalis, the nucleic acid sequence of the upstream primer is: CTTGGTATTTTGTATGTTACTTCTTCGG; the nucleic acid sequence of the downstream primer is: GGCTGGCAGTATCGACGAAGG; the nucleic acid sequence of the fluorescent probe is: CTCTACAGTTTATCGGGCCAGCAT;

[0034] For detecting Trophophora whipplei, the nucleic acid sequence of the upstream primer is: TTTTGTACTGCTTGTAACAGGATCT; the nucleic acid sequence of the downstream primer is: GCTCTATCCCTCCTATCATC; the nucleic acid sequence of the fluorescent probe is: AGATACATTTGTGTTAGTTGTTACA;

[0035] For the detection of human bocavirus, the nucleic acid sequence of the upstream primer is: GACAAGTCAGCTGTGAAATTG; the nucleic acid sequence of the downstream primer is: CCGAGTGCAGTATGTCTTCTTT; the nucleic acid sequence of the fluorescent probe is: CAACAAAGAACTGGCGTCCA;

[0036] For the detection of Mycobacterium tuberculosis, the nucleic acid sequence of the upstream primer is: GGATAGGGGATCTCAGTAC; the nucleic acid sequence of the downstream primer is: GTCTCGGCTAGTGCATTGTC; the nucleic acid sequence of the fluorescent probe is: CCGACCGCTCCGACCGAC;

[0037] For testing the novel coronavirus, the nucleic acid sequence of the upstream primer is: CTGTGGGTTTTACACTTAAA; the nucleic acid sequence of the downstream primer is: CGATTGTGCATCAGCTGA; the nucleic acid sequence of the fluorescent probe is: TCTGCGGTATGTGGAAAGGTTATGG;

[0038] For detecting influenza B virus, the nucleic acid sequence of the upstream primer is: GAACAAGACCAGAGGGAAACTATG; the nucleic acid sequence of the downstream primer is: CTGCCTAAGGCCACATCCA; the nucleic acid sequence of the fluorescent probe is: CCAACCTGCCTCAACTGCACAGA;

[0039] For detecting human metapneumovirus, the nucleic acid sequence of the upstream primer is: TGGCCAATTGCCCCAAT; the nucleic acid sequence of the downstream primer is: TTCCGATTATGCCTAGACCTGAA; the nucleic acid sequence of the fluorescent probe is: TTTGCTAGTGTTGTTCTTGGCAATGC;

[0040] For the detection of Chlamydia psittaci, the nucleic acid sequence of the upstream primer is: GAGGCATCTTGTAGTAGAGAA; the nucleic acid sequence of the downstream primer is: TATCGGCACTACTTCTAACA; the nucleic acid sequence of the fluorescent probe is: ACTACCCTCCTCAGGGACCACT;

[0041] For detecting rhinovirus, the nucleic acid sequence of the upstream primer is: GCCCCTGAATGCGGCTAA; the nucleic acid sequence of the downstream primer is: GAAACACGGACACCCAAAGTAGT; the nucleic acid sequence of the fluorescent probe is: TAATGAGCAATTGCGGGATGGGACC;

[0042] For checking the internal reference gene, the nucleic acid sequence of the upstream primer is: CAGGTGGTCTCCTCTGACTTC; the nucleic acid sequence of the downstream primer is: GGTCGTTGAGGGCAATG; the nucleic acid sequence of the fluorescent probe is: AGCGACCACCCACTCCTCCACCTT;

[0043] For detecting respiratory syncytial virus, the nucleic acid sequence of the upstream primer is: TGGAGGAAATCCAACTAATCACAA; the nucleic acid sequence of the downstream primer is: AAGGCCAGAATTTGCTTGAGA; the nucleic acid sequence of the fluorescent probe is: ACATAGACAAGTCAACACGCCAGGCA;

[0044] For the examination of Listeria monocytogenes, the nucleic acid sequence of the upstream primer: TGGCACCACCAGCATCT; the nucleic acid sequence of the downstream primer: CCGCGTGTTTCTTTTCGA; the nucleic acid sequence of the fluorescent probe: CCTGCAAGTCCTAAGACGCCA;

[0045] For the examination of Streptococcus pyogenes, the nucleic acid sequence of the upstream primer is: GGGACACGTACCCAAAATGTAGGA; the nucleic acid sequence of the downstream primer is: TCTTGAGCTCTTTGTTCGGTATAG; the nucleic acid sequence of the fluorescent probe is: CGTGACCAAAAAGGCGGCATGC;

[0046] For the examination of Streptococcus agalactiae, the nucleic acid sequence of the upstream primer is: AACTCTAGTGGCTGGTGCA; the nucleic acid sequence of the downstream primer is: CTTGTGGAGTTGTCACTTGATCA; the nucleic acid sequence of the fluorescent probe is: ATTTTCACCAGCTGTATTAGAAGTA;

[0047] For the detection of Mycobacterium chelonae, the nucleic acid sequence of the upstream primer is: TTACTCGCTTGGTGAATATGTTT; the nucleic acid sequence of the downstream primer is: ACGTTTTGCCGACTACCT; the nucleic acid sequence of the fluorescent probe is: AATCCTCGTCCACCCCGTGGA;

[0048] For the detection of Nocardia asteroides, the nucleic acid sequence of the upstream primer is: GCCTTCGGGTTGTAAACCTCTT; the nucleic acid sequence of the downstream primer is: GCCGGTGCTTCTTCTACAGGTA; the nucleic acid sequence of the fluorescent probe is: ACAGGGACGAAGCGCAAGTGACG;

[0049] For the detection of Fusobacterium nucleatum, the nucleic acid sequence of the upstream primer is: AAGCGGTGGAGCATG; the nucleic acid sequence of the downstream primer is: AAGATGTCAACGCTGGTAAGG; the nucleic acid sequence of the fluorescent probe is: TAATTCGACGCAACGCGAGG;

[0050] For the detection of Orientia tsutsugamushi, the nucleic acid sequence of the upstream primer is: AACTGATTTTATTCAAACTAATGCTG; the nucleic acid sequence of the downstream primer is: TATGCCTGAGTAAGATACRTGAATRGA; the nucleic acid sequence of the fluorescent probe is: TGGGTAGCTTTGGTGGACCGATGTTTAA;

[0051] For the examination of Bartonella henselae, the nucleic acid sequence of the upstream primer: ATGATGATCCCAAGCCTTCTG; the nucleic acid sequence of the downstream primer: ATRAAYYRGWAAACCTTYMYC; the nucleic acid sequence of the fluorescent probe: ACCGTGGGCTTTGAAAAACGC;

[0052] For the detection of Burkholderia pseudomallei, the nucleic acid sequence of the upstream primer is: GAGCGCATCGTACTCGTA; the nucleic acid sequence of the downstream primer is: AAGTCGTGGATGCGCATTA; the nucleic acid sequence of the fluorescent probe is: TGAAACGCGCAGCG;

[0053] For the detection of Neisseria meningitidis, the nucleic acid sequence of the upstream primer is: TTTACCCCTGATTTACAAGGAT; the nucleic acid sequence of the downstream primer is: GCTCACAGCTTGGGTTT; the nucleic acid sequence of the fluorescent probe is: CGAAGGCTTACATGGTTTCCACATCC;

[0054] For the detection of enteric Salmonella, the nucleic acid sequence of the upstream primer is: AATGGCGGCGAATTACG; the nucleic acid sequence of the downstream primer is: GATCCCTTTGCGAATAAC; the nucleic acid sequence of the fluorescent probe is: TAATGGTATCTGCTGAAGTTGAG;

[0055] For the examination of Proteus mirabilis, the nucleic acid sequence of the upstream primer is: GTGGCGGGTACTAATGCAA; the nucleic acid sequence of the downstream primer is: GCCTCTAACATGCGGTACA; the nucleic acid sequence of the fluorescent probe is: ACAGTTACCCCCGGTATTTGGA;

[0056] For the detection of Burkholderia cepacia, the nucleic acid sequence of the upstream primer is: CAAGAAGAACGACGAGGTGATC; the nucleic acid sequence of the downstream primer is: GGCGGCGACACCTT; the nucleic acid sequence of the fluorescent probe is: AACCCGCGTGAAGGTCGTCAAG;

[0057] For the examination of Serratia marcescens, the nucleic acid sequence of the upstream primer: CCGACAGATCCTTGTCCAAC; the nucleic acid sequence of the downstream primer: GGGTGAAAAACGCCAACTC; the nucleic acid sequence of the fluorescent probe: TTGGCCGTTGAGCCATAC;

[0058] For the detection of Klebsiella aerogenes, the nucleic acid sequence of the upstream primer is: CGAAACCCAGCAGAAACT; the nucleic acid sequence of the downstream primer is: GTACGTTACCGCTATATTCACG; the nucleic acid sequence of the fluorescent probe is: ACCTTTATGGCCCTGCTG;

[0059] For the detection of Nocardia mallei, the nucleic acid sequence of the upstream primer is: CCGATCCGCCGTCAAATC; the nucleic acid sequence of the downstream primer is: GGTCGTCCGGTGTGGA; the nucleic acid sequence of the fluorescent probe is: CATACCCCAACGCCAGCTGA;

[0060] For the detection of Aspergillus niger, the nucleic acid sequence of the upstream primer is: ACCCCAACACGAACACTGTC; the nucleic acid sequence of the downstream primer is: GAGATCCATTGTTGAAAGTTTTAA; the nucleic acid sequence of the fluorescent probe is: AGCGTGCAGTCTGAGTTGATTGAATGC;

[0061] For the detection of Aspergillus terreus, the nucleic acid sequence of the upstream primer is: TTACCGAGTGCGGGTCTTTA; the nucleic acid sequence of the downstream primer is: CCGCCGAAGCAACAAG; the nucleic acid sequence of the fluorescent probe is: CAACCTCCCACCCGTGACTATTG;

[0062] For the detection of Brucella melitensis, the nucleic acid sequence of the upstream primer is: GCTCGACACAAAGGGCCA; the nucleic acid sequence of the downstream primer is: CAAGCGTGGTCTGGCGA; the nucleic acid sequence of the fluorescent probe is: CCGAGATACAAA;

[0063] For the examination of Morganella morganii, the nucleic acid sequence of the upstream primer is: GTGAAATCCCCGGGCTTAA; the nucleic acid sequence of the downstream primer is: ACCCCCCTCTACAAGACTCTA; the nucleic acid sequence of the fluorescent probe is: CCGGGAATTGCATCTGATACTGG;

[0064] For the examination of Candida glabrata, the nucleic acid sequence of the upstream primer: TGTGGTAGTACCTGAGTTGCACTAT; the nucleic acid sequence of the downstream primer: GAACTCCTGTTCACGAACTT; the nucleic acid sequence of the fluorescent probe: CGGATATCTTTTCACACCTACGACCTTT;

[0065] For the examination of Candida parapsilosis, the nucleic acid sequence of the upstream primer: CCCTTGTATATAATGCCTTTGT; the nucleic acid sequence of the downstream primer: GCCTTCGATGAGACTTGAA; the nucleic acid sequence of the fluorescent probe: GTTAAAGCAATCGCTTGAAGCGCGGTCT;

[0066] For the detection of Mycoplasma hominis, the nucleic acid sequence of the upstream primer is: GGTTCCAACAACAACAGGT; the nucleic acid sequence of the downstream primer is: AATGATCCAGTTATTGTTGGA; the nucleic acid sequence of the fluorescent probe is: CTATTGGAAAAGTTATCCCTTCATTGGATAAGA;

[0067] For the detection of Chlamydia trachomatis, the nucleic acid sequence of the upstream primer is: CGACATTTCTTGCTGCAAAG; the nucleic acid sequence of the downstream primer is: AGGACATTTTGCGGATAGG; the nucleic acid sequence of the fluorescent probe is: CTTTACCCATGAAATCCCTCGTGAT;

[0068] For the detection of Candida krusei, the nucleic acid sequence of the upstream primer is: CGAAATGCGATACCTAGTG; the nucleic acid sequence of the downstream primer is: ATGGAAACGACGCTCAAA; the nucleic acid sequence of the fluorescent probe is: CAGCCATCGTGAATCATCGAGT;

[0069] For the detection of Candida dubliniensis , the nucleic acid sequence of the upstream primer is: CACCACATGTGTTTTGTTC; the nucleic acid sequence of the downstream primer is: AGTTTATGTCCTCTGGCGG; the nucleic acid sequence of the fluorescent probe is: ACTTGCTTTGGCGGTGGGCCCCT;

[0070] For the detection of Chlamydia pneumoniae, the nucleic acid sequence of the upstream primer is: TTGGTGCGACGCTATTAGC; the nucleic acid sequence of the downstream primer is: ATCTACTTTTAAGATACGGTCGAA; the nucleic acid sequence of the fluorescent probe is: TGCTGGATTTTACGGAGACTATG;

[0071] For the detection of Treponema pallidum, the nucleic acid sequence of the upstream primer is: GGTAGAAGGGAGGGCTAGTACA; the nucleic acid sequence of the downstream primer is: GACACAGCACTCGTCTTCAAC; the nucleic acid sequence of the fluorescent probe is: GAGGTGAACTCCGTATTGAAGTCGG;

[0072] For detecting Cryptococcus neoformans, the nucleic acid sequence of the upstream primer is: CTTAAATGTGTTAGTGGGAAGG; the nucleic acid sequence of the downstream primer is: CATAGGCCCAGCGAAACT; the nucleic acid sequence of the fluorescent probe is: TACCTGTCAGCCCGGCGTA;

[0073] For the examination of Trichosporon asahii, the nucleic acid sequence of the upstream primer is: GCAGGCTTGGGTCTGTA; the nucleic acid sequence of the downstream primer is: GCTCACCAGCACTCATACTTG; the nucleic acid sequence of the fluorescent probe is: GTGAGCATACTAGGAGCTGCAA;

[0074] For the examination of Bacteroides fragilis, the nucleic acid sequence of the upstream primer: CTTGACTGTTGTAGATAAAGCTAATG; the nucleic acid sequence of the downstream primer: TCTTCATTGCAGCATTATCCAC; the nucleic acid sequence of the fluorescent probe: GCTTCCAGTCGTCTATGGAGGCAGA;

[0075] For the detection of Brucella, the nucleic acid sequence of the upstream primer is: GCCAAGATGTGCAACGA; the nucleic acid sequence of the downstream primer is: GTCGCACCGGCTTTCTA; the nucleic acid sequence of the fluorescent probe is: AATCGCGGCAACCGGCCTC;

[0076] For the detection of Talaromyces marneffei, the nucleic acid sequence of the upstream primer is: AATCTTTGAACGCACATTGC; the nucleic acid sequence of the downstream primer is: CCCGGAGGGACCACA; the nucleic acid sequence of the fluorescent probe is: TGGCATTCCGGGGGGCAT;

[0077] For the detection of Pneumocystis jirovecii, the nucleic acid sequence of the upstream primer is: ATGACCCTTATGAAGTGGGC; the nucleic acid sequence of the downstream primer is: TCCGACTTCCATCATTGC; the nucleic acid sequence of the fluorescent probe is: GTGCTGCAAAATTTTCTACAATGGG;

[0078] For the detection of Bordetella pertussis, the nucleic acid sequence of the upstream primer is: GCATCGACCCCACCAA; the nucleic acid sequence of the downstream primer is: TTGTATTCGTCCAGGTTGAGT; the nucleic acid sequence of the fluorescent probe is: CGGGCGCGCTGTACCCATCT;

[0079] For the examination of Aeromonas hydrophila, the nucleic acid sequence of the upstream primer is: GAACCACACCTTCGTCATC; the nucleic acid sequence of the downstream primer is: TAAGCTTGTCCCACTGG; the nucleic acid sequence of the fluorescent probe is: GTACAAGGACAAGGCGAGCAGC;

[0080] For the detection of Rhizopus microsporus, the nucleic acid sequence of the upstream primer is: CGACTAGAGATTGGGCGTGTTT; the nucleic acid sequence of the downstream primer is: CCCCCAGAACCCAAAAA; the nucleic acid sequence of the fluorescent probe is: TATGACTGGCTCAGCATCTTAGCG;

[0081] For the examination of Fusarium spp., the nucleic acid sequence of the upstream primer: TGGAACGGGACGCCATAGA; the nucleic acid sequence of the downstream primer: CGACTCGTCGAAGGAACTTTACA; the nucleic acid sequence of the fluorescent probe: CCCCGTCTGGTTGGATGCCATATCT;

[0082] For the detection of Citrobacter freundii, the nucleic acid sequence of the upstream primer is: GCACGAGCGCTTTAATC; the nucleic acid sequence of the downstream primer is: GAAGGTGGCGGAATAACG; the nucleic acid sequence of the fluorescent probe is: CATGGCCGGAGCTGTCATC;

[0083] For the detection of Nocardia otitidis in guinea pigs, the nucleic acid sequence of the upstream primer is: CCAGGACTCGAATTGAA; the nucleic acid sequence of the downstream primer is: CGGACAGATCGACGAATC; the nucleic acid sequence of the fluorescent probe is: CGAAGGTGTGAAACAT;

[0084] For detecting human herpes virus type 1, the nucleic acid sequence of the upstream primer is: GCCGTGTGACACTATCG; the nucleic acid sequence of the downstream primer is: CGTAAAATGGCCCCTCC; the nucleic acid sequence of the fluorescent probe is: ATACCGACCACACCGACGAACC;

[0085] For detecting human herpes virus type 2, the nucleic acid sequence of the upstream primer is: CTCTCGTAAATGCTTCCCT; the nucleic acid sequence of the downstream primer is: TACCCACAACAGACCCAC; the nucleic acid sequence of the fluorescent probe is: CGGAGACATTCGAGTACCAGATCG;

[0086] For detecting human herpes virus type 3 (VZV), the nucleic acid sequence of the upstream primer is: GAGAACGGTTTGGGTTTTC; the nucleic acid sequence of the downstream primer is: CCGGTCGTCTCAACA; the nucleic acid sequence of the fluorescent probe is: CTGCCAAGGGCCTCCTGTT;

[0087] For detecting human herpes virus type 6, the nucleic acid sequence of the upstream primer is: AACAATACTCTCTACTTATTCGACTCT; the nucleic acid sequence of the downstream primer is: GGGCGGTGAGCAGTTCATA; the nucleic acid sequence of the fluorescent probe is: CCACAGCAGCCATCTACATCTGTCAA;

[0088] For detecting human herpes virus type 7, the nucleic acid sequence of the upstream primer is: AGACATCTTACACGACAGCAT; the nucleic acid sequence of the downstream primer is: GCTTTTCGAACTTGTCACCT; the nucleic acid sequence of the fluorescent probe is: TACATGTTCTTTGTAAAACTATT;

[0089] For the detection of Streptococcus suis, the nucleic acid sequence of the upstream primer is: TTACTTGCTACTTTTGATGGAAATT; the nucleic acid sequence of the downstream primer is: CACCTCTTTTATCTCTTCCAA; the nucleic acid sequence of the fluorescent probe is: AAGAATCTGAGCTGCAAAAGTGTCAAATT;

[0090] For the examination of intracellular mycobacterium, the nucleic acid sequence of the upstream primer is: GTGAGTAACACGTGGGCAA; the nucleic acid sequence of the downstream primer is: CACCTAAAGACATGCGCCTAA; the nucleic acid sequence of the fluorescent probe is: CACTTCGGGATAAGCCTGGGAA;

[0091] For the examination of Nocardia Gelsenkirchen, the nucleic acid sequence of the upstream primer: CGTCTGTGCCACACTTTCG; the nucleic acid sequence of the downstream primer: CTGGTCAGCGTTGGTTCTC; the nucleic acid sequence of the fluorescent probe: GCCGCGACAGCACGTCT;

[0092] For detecting adenovirus type 3, the nucleic acid sequence of the upstream primer is: GAGACAATATTACTAAAGAAGGTTTGC; the nucleic acid sequence of the downstream primer is: ACTTGAGGCTCTGGCTGATA; the nucleic acid sequence of the fluorescent probe is: CTACTGAAGGAGAAGAAAAGCCCATTTATGCC;

[0093] For detecting adenovirus type 4, the nucleic acid sequence of the upstream primer is: GCCAACCTGTGGAGKAAC; the nucleic acid sequence of the downstream primer is: GTTGGCCGGTGTGTATTTG; the nucleic acid sequence of the fluorescent probe is: STATGCCAATGTTGCCCTCTATTTGCCT;

[0094] For detecting adenovirus type 7, the nucleic acid sequence of the upstream primer is: GGAGCCAGATATTGATATGGAATT; the nucleic acid sequence of the downstream primer is: TTGACATTTTCCGTGTAAAGCA; the nucleic acid sequence of the fluorescent probe is: AGCTGCTGACGCTTTTTCGCCTGA;

[0095] For detecting adenovirus type 21, the nucleic acid sequence of the upstream primer is: CTGCTATGGGTCTTTTGC; the nucleic acid sequence of the downstream primer is: GTTGTTCAGTAGTTTTTTGTTTTG; the nucleic acid sequence of the fluorescent probe is: ACCCACTAACGTCAAAGGCGGACAG;

[0096] For the detection of Hantavirus, the nucleic acid sequence of the upstream primer is: TCAGTCACAGTCTAGTCAAAA; the nucleic acid sequence of the downstream primer is: GATTCTTCCACCATTTTGTGTT; the nucleic acid sequence of the fluorescent probe is: CACTGAAGTTGACTTGAAAGG;

[0097] For checking mecA, the nucleic acid sequence of the upstream primer is: CCACCCAATTTGTCTGCC; the nucleic acid sequence of the downstream primer is: ATGGTATGCAACAAGTCGTAAA; the nucleic acid sequence of the fluorescent probe is: TTGTTTCATTTTGAGTTCTGCAGTACC;

[0098] For checking bla KPC, the nucleic acid sequence of the upstream primer is: TACCACGTTCCGTCTGG; the nucleic acid sequence of the downstream primer is: AGCCCAGTGTCAGTTTT; the nucleic acid sequence of the fluorescent probe is: TCCCAGGCGATGCGCGCGATAC;

[0099] For the examination of NDM, the nucleic acid sequence of the upstream primer is: TTGATCGTCAGGGATGGC; the nucleic acid sequence of the downstream primer is: AGGTTGATCTCCTGCTTGAT; the nucleic acid sequence of the fluorescent probe is: TGGTCGATACCGCCTGGACC;

[0100] For checking OXA-48, the nucleic acid sequence of the upstream primer is: TATCGCCACTTGGAATCGC; the nucleic acid sequence of the downstream primer is: ATAATCGAAAGCATGTAGCATC; the nucleic acid sequence of the fluorescent probe is: GCCCGCCAAATTGGCGAG;

[0101] For checking VIM, the nucleic acid sequence of the upstream primer is: GCGGAGATTGAGAAGCAA; the nucleic acid sequence of the downstream primer is: GCCGCCCGAAGGACAT; the nucleic acid sequence of the fluorescent probe is: GGACTTCCTGTAACGCGTGCA;

[0102] For checking IMP, the nucleic acid sequence of the upstream primer is: TTTGTGGAGCGTGGCTAT; the nucleic acid sequence of the downstream primer is: CATTTGTTAATTCAGATGCATACG; the nucleic acid sequence of the fluorescent probe is: GGCAGCATTTCCTCTCATTTTCATAG;

[0103] For checking vanA, the nucleic acid sequence of the upstream primer: AAATCAACCATGTTGATGTAGCA; the nucleic acid sequence of the downstream primer: AGGGATACCGGACAATTCAAA; the nucleic acid sequence of the fluorescent probe: AGCTTTGCATGGCAAGTCAGGTG;

[0104] For checking ampC, the nucleic acid sequence of the upstream primer is: AAATCAGCCGATTCGAGTTAA; the nucleic acid sequence of the downstream primer is: TGTCGATTTGACGCCATATG; the nucleic acid sequence of the fluorescent probe is: GCCCACTCGATGCCCCT;

[0105] For checking OXA-23, the nucleic acid sequence of the upstream primer is: ACTAGGAGAAGCCATGAAG; the nucleic acid sequence of the downstream primer is: ATGAGATCAAGACCGATAC; the nucleic acid sequence of the fluorescent probe is: CCAGTCTATCAGGAACTTGCGCG;

[0106] For checking SHV, the nucleic acid sequence of the upstream primer is ACGGTCGGCGAACTCT; the nucleic acid sequence of the downstream primer is GATTGGCGGCGCTGTT; the nucleic acid sequence of the fluorescent probe is CCGCCATTACCATGAGCGA;

[0107] For the examination of MCR-1, the nucleic acid sequence of the upstream primer is: GTTTGTTCTTGTGGCGAG; the nucleic acid sequence of the downstream primer is: GATTGTCCGCGATGGGAT; the nucleic acid sequence of the fluorescent probe is: CCGTTTTCTTGACCGCGACCGC.

[0108] The two ends of the fluorescent probe are respectively labeled with a fluorescent reporter group and a fluorescent quencher group; the 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0109] Preferably, the packaging specification of the primers and fluorescent probes used to detect target pathogenic microorganisms and drug-resistant genes is 192 μL*24 test tubes; the packaging specification of the PCR reaction premix is ​​1000 μL*6 test tubes; the packaging specification of the positive quality control product is 1000 μL*3 test tubes; the packaging specification of the negative quality control product is 1000 μL*3 test tubes.

[0110] Preferably, the 24 test tubes of primers and fluorescent probes for detecting target pathogenic microorganisms and drug-resistant genes are 3 rows of 8-tube strips, which are respectively used for detecting:

[0111] The A1 test tube detects Staphylococcus aureus, Streptococcus pneumoniae, Enterococcus faecalis and Enterococcus faecium; the B1 test tube detects Mycoplasma pneumoniae, Mycobacterium avium complex and Stenotrophomonas maltophilia; the C1 test tube detects Legionella pneumophila, Moraxella catarrhalis, Pseudomonas aeruginosa and Acinetobacter baumannii; the D1 test tube detects Haemophilus influenzae, Escherichia coli, Klebsiella pneumoniae and Epstein-Barr virus; the E1 test tube detects Aspergillus fumigatus, Aspergillus flavus, human cytomegalovirus and influenza A virus; the F1 test tube detects Candida albicans, Candida tropicalis, Tropical whipple and human bocavirus; the G1 test tube detects Mycobacterium tuberculosis, new coronavirus, influenza B virus and human metapneumovirus; the H1 test tube detects Chlamydia psittaci, rhinovirus, internal reference gene and respiratory syncytial virus;

[0112] The A2 test tube detects Listeria monocytogenes, Streptococcus pyogenes, Streptococcus agalactiae and Mycobacterium chelonae; the B2 test tube detects Nocardia asteroides, Fusobacterium nucleatum, Orientia tsutsugamushi and Bartonella henselae; the C2 test tube detects Burkholderia mallei, Neisseria meningitidis, Salmonella enterica and Proteus mirabilis; the D2 test tube detects Burkholderia cepacia, Serratia marcescens, Klebsiella aerogenes and Nocardia mallei; the E2 test tube detects Aspergillus niger, Aspergillus terreus, Brucella melitensis and Morganella morganii; the F2 test tube detects Candida glabrata, Candida parapsilosis, Mycoplasma hominis and Chlamydia trachomatis; the G2 test tube detects Candida krusei, Candida dubliniensis, Chlamydia pneumoniae and Treponema pallidum; the H2 test tube detects Cryptococcus neoformans, Trichosporon asahii, Bacteroides fragilis and Brucella spp.

[0113] The A3 test tube detects Talaromyces marneffei, Pneumocystis jiroveci, Bordetella pertussis, and Aeromonas hydrophila; the B3 test tube detects Rhizopus microsporus, Fusarium spp., Citrobacter freundii, and Nocardia caviae; the C3 test tube detects human herpesvirus-1, human herpesvirus-2, human herpesvirus-3 (VZV), and human herpesvirus-6; the D3 test tube detects human herpesvirus-7, Streptococcus suis, Mycobacterium intracellulare, and Nocardia gelsenkirchen; the E3 test tube detects adenovirus-3, adenovirus-4, adenovirus-7, and adenovirus-21; the F3 test tube detects hantavirus, mecA, bla KPC, and NDM; the G3 test tube detects OXA-48, VIM, IMP, and vanA; and the H3 test tube detects ampC, OXA-23, SHV, and MCR-1;

[0114] Among them, the primer-probe ratios of different targets in the H1 test tube are as follows: the upstream primer and downstream primer of Chlamydia psittaci are both 0.4μM, and the fluorescent probe is 0.2μM; the upstream primer and downstream primer of rhinovirus are both 0.4μM, and the fluorescent probe is 0.2μM; the upstream primer and downstream primer of the internal reference gene are both 0.3μM, and the fluorescent probe is 0.1μM; the upstream primer and downstream primer of respiratory syncytial virus are both 0.4μM, and the fluorescent probe is 0.2μM;

[0115] Among them, the primer-probe ratios of different targets in the D3 test tube are as follows: the upstream primer and downstream primer of human herpes virus type 7 are both 0.4 μM, and the fluorescent probe is 0.2 μM; the upstream primer and downstream primer of Streptococcus suis are both 0.4 μM, and the fluorescent probe is 0.2 μM; the upstream primer and downstream primer of Mycobacterium intracellulare are both 0.6 μM, and the fluorescent probe is 0.3 μM; the upstream primer and downstream primer of Nocardia Gelsenkirchen are both 0.4 μM, and the fluorescent probe is 0.2 μM;

[0116] In the other sub-tubes except H1 detection tube and D3 detection tube, the upstream primer and downstream primer of different targets are all 0.4 μM, and the fluorescent probe is all 0.2 μM.

[0117] The specific detection targets and corresponding fluorescence channels of the kit of the present invention are shown in Table 1.

[0118] Table 1 Specific detection targets and corresponding fluorescence channels of the kit

[0119]

[0120]

[0121]

[0122] Preferably, the PCR reaction premix includes a buffer, magnesium ions, potassium ions, ammonium sulfate, glycerol, dNTP, dUTP, reverse transcriptase, thermostable Taq DNA polymerase, and UDG enzyme.

[0123] Preferably, the PCR reaction premix further comprises at least one of polyvinyl alcohol-polylysine polymer, polyvinyl alcohol, trehalose, and trehalose polymer.

[0124] Preferably, the negative quality control product is nuclease-free water.

[0125] Further preferably, the preparation method of the polyvinyl alcohol-polylysine polymer comprises the following steps, measured by weight:

[0126] S1. Add 1.2-1.4 parts of succinic anhydride to 8-12 parts of a 25-30wt% ε-polylysine aqueous solution, mix and stir at 45-55°C for 1.5-3h to obtain a mixed solution A; then pour the mixed solution A into a dialysis bag, dialyze with water for 22-25h, then freeze-dry for 22-25h, and then vacuum dry at 55-65°C for 15-20h to obtain carboxylated ε-polylysine;

[0127] S2. Dissolve 0.9-1.1 parts of polyvinyl alcohol in water and stir at 55-65°C for 1.5-2.5 hours; then add 1-1.2 parts of 1,1'-carbonyldiimidazole and continue stirring for 1.5-2.5 hours to obtain a mixed solution B; then add 0.9-1.1 parts of carboxylated ε-polylysine to the mixed solution B, mix and stir at 55-65°C for 3-5 hours to obtain a mixed solution C, then pour the mixed solution C into a dialysis bag, dialyze with water for 2.5-3.5 days, dry in an oven after dialysis for 22-25 hours, and then vacuum dry at 55-65°C for 15-20 hours to obtain a polyvinyl alcohol-polylysine polymer.

[0128] Further preferably, the preparation method of the trehalose polymer comprises the following steps, calculated by weight:

[0129] Dissolve 3.5-4.2 parts of trehalose and 1.7-2 parts of sodium hydroxide in 8-12 parts of water, place at 65-75°C and mix and stir for 25-35 minutes to obtain a transparent viscous liquid; then add 3.2-3.3 parts of epichlorohydrin to the liquid and mix, let stand at room temperature for 45-50 hours to obtain a mixed solution; then adjust the pH value of the mixed solution to 7-7.5 with hydrochloric acid, then pour the solution into a dialysis bag, dialyze with water for 2.5-3 days, and freeze-dry under vacuum after dialysis to obtain trehalose polymer.

[0130] The present invention also provides the above-mentioned multiple fluorescence PCR detection method for simultaneously detecting multiple pathogenic microorganisms and drug-resistant genes, comprising the following steps:

[0131] (1) Extraction of nucleic acid template: extracting and purifying the nucleic acid in the sample to obtain a nucleic acid template;

[0132] (2) Preparing a multiplex fluorescent PCR reaction solution: Preparing a PCR reaction premix solution; mixing the nucleic acid template obtained in step 1 with the PCR reaction premix solution, primers and fluorescent probes, and ddH2O to obtain a multiplex fluorescent PCR reaction solution;

[0133] (3) adding the multiplex fluorescence PCR reaction solution in step (2) to a 96-well plate and reacting on a fluorescence quantitative PCR instrument;

[0134] (4) Data analysis: Monitor the changes in the fluorescence signal of each fluorescence channel in each well using a fluorescence quantitative PCR instrument, and record the Ct value based on the amplification curve;

[0135] (5) Report interpretation: Based on the Ct value, determine the qualitative results of each detection target in the sample.

[0136] Preferably, the multiplex fluorescent PCR reaction solution in step (2) includes 4 μL of PCR reaction premix, 4 μL of primers and fluorescent probes, 10 μL of ddH2O and 2 μL of nucleic acid template.

[0137] The sample to be tested in the present invention is a sample of peripheral blood, sputum, bronchoalveolar lavage fluid or other body fluid of a subject.

[0138] Beneficial effects of the present invention:

[0139] 1. Compared with the existing single-target fluorescent PCR kit, the pathogenic microorganism and drug-resistant gene detection kit and method based on multicolor fluorescent channels provided by the present invention can help the clinic determine pathogenic microorganisms and related drug-resistant genes more quickly. For complex or mixed infection situations, the single-target fluorescent PCR kit needs to be tested multiple times to determine the true pathogenic microorganism. However, using the multiple fluorescent PCR kit in the present invention for detection, information on dozens of pathogenic microorganisms and drug-resistant genes can be obtained in one test, which can help the clinic determine pathogenic microorganisms more quickly.

[0140] Compared with the existing metagenomic sequencing technology, the detection sensitivity of the multiplex fluorescent PCR kit provided by the present invention is better than that of metagenomic sequencing technology, and the detection time is shortened. Metagenomic sequencing technology can obtain all nucleic acid sequence information in the sample through one detection, including pathogenic microorganism sequence information and human genome sequence information. This method has no preference for the detection target, and theoretically can detect all pathogenic microorganisms in the database. However, in practical applications, the detection sensitivity of this method to pathogens will be affected by the human genome in the sample. Metagenomic sequencing technology is time-consuming as a whole, and it generally takes about 24 hours from receiving the sample to issuing the test results. The multiplex fluorescent PCR detection involved in the present invention takes about 4 hours.

[0141] 2. The present invention provides a PCR reaction premix comprising a polyvinyl alcohol-polylysine polymer and a trehalose polymer. The synergistic use of the two improves the enzyme activity of Taq DNA polymerase under freezing and repeated freezing and thawing conditions, improves PCR stability, and ensures the detection accuracy of the kit. BRIEF DESCRIPTION OF THE DRAWINGS

[0142] Figure 1 It is a schematic diagram of the principle of multiplex fluorescence PCR;

[0143] Figure 2 is a multiplex fluorescence PCR amplification curve diagram of the bronchoalveolar lavage fluid sample in Example 1 of the present invention;

[0144] Figure 3 It is a multiplex fluorescence PCR amplification curve diagram of the Klebsiella pneumoniae standard strain in Example 1 of the present invention;

[0145] Figure 4 It is a multiple fluorescence PCR amplification curve diagram of the standard strain of Pseudomonas aeruginosa in Example 1 of the present invention; Figure 5 is a multiplex fluorescence PCR amplification curve of the standard strain of Staphylococcus aureus in Example 1 of the present invention; Figure 6 is a multiplex fluorescence PCR amplification curve of the standard strain of Streptococcus pneumoniae in Example 1 of the present invention; Figure 7 It is a multiplex fluorescence PCR amplification curve diagram of the Candida albicans standard strain in Example 1 of the present invention; Figure 8 It is a multiplex fluorescence PCR amplification curve diagram of the EB virus inactivated virus in Example 1 of the present invention; Fig. 9 This is a multiplex fluorescence PCR amplification curve of the inactivated adenovirus type 7 virus in Example 1 of the present invention; Fig.10 This is a multiplex fluorescence PCR amplification curve of the inactivated influenza A virus in Example 1 of the present invention; Fig.11 It is a multiplex fluorescence PCR amplification curve diagram of the standard strain of Haemophilus influenzae in Example 1 of the present invention; Fig.12 It is a multiplex fluorescence PCR amplification curve diagram of the standard strain of Listeria monocytogenes in Example 1 of the present invention; Fig.13 It is a multiplex fluorescence PCR amplification curve diagram of the standard strain of Enterococcus faecalis in Example 1 of the present invention; Fig.14 is a multiplex fluorescence PCR amplification curve of the standard strain of Staphylococcus epidermidis in Example 1 of the present invention; Fig.15 is a multiplex fluorescence PCR amplification curve diagram of the Escherichia coli standard strain in Example 1 of the present invention; Fig.16 is a multiplex fluorescence PCR amplification curve diagram of the standard strain of Acinetobacter baumannii in Example 1 of the present invention; Fig.17 is a multiplex fluorescence PCR amplification curve diagram of sample 1 in Example 1 of the present invention; Fig.18 is a multiplex fluorescence PCR amplification curve diagram of sample 2 in Example 1 of the present invention; Fig.19 is a multiplex fluorescence PCR amplification curve diagram of sample 3 in Example 1 of the present invention; Fig. 20 is a multiplex fluorescence PCR amplification curve diagram of sample 4 in Example 1 of the present invention; Fig.21 is a multiplex fluorescence PCR amplification curve diagram of sample 5 in Example 1 of the present invention; Fig. 22 is a multiplex fluorescence PCR amplification curve diagram of sample 6 in Example 1 of the present invention; Fig.23 This is a multiplex fluorescence PCR amplification curve diagram of sample 7 in Example 1 of the present invention. DETAILED DESCRIPTION

[0146] Parameters for specific chemical substances used, sources.

[0147] ε-Poly-lysine, light yellow powder, purity: 95%, produced by Shanghai Xuanke Biotechnology Co., Ltd., item number: XK0712-45;

[0148] Polyvinyl alcohol: alcoholysis degree: 98-99% (mol / mol), produced by Shanghai Myril Biochemical Technology Co., Ltd., product number: M29049;

[0149] The kit described in the present invention plans to perform PCR amplification on specific conserved regions of pathogenic microorganisms and drug-resistant genes in the target through multiple fluorescent PCR, and then use multiple fluorescent channels to mark the corresponding detection targets respectively, and then monitor the changes in fluorescent signals in different fluorescent channels to monitor the amplification of different targets, thereby realizing the simultaneous detection of dozens of pathogenic microorganisms and drug-resistant genes on a single machine.

[0150] The kit development process is as follows:

[0151] (1) Selection of detection targets. In the early stage, the target pathogen list and drug resistance gene list were determined by searching the literature and consensus of experts in the field of infection.

[0152] (2) Design of specific primers and fluorescent probes. Relevant pathogen databases and foreign literature were searched, specific genomic regions were determined using software, and amplification primer pairs and fluorescent probes were designed respectively.

[0153] (3) Confirmation of primer and probe specificity: For pathogenic microorganisms with standard strains or inactivated virus cultures, purchase standard strains. For pathogenic microorganisms without standard strains, synthesize corresponding plasmids for testing.

[0154] (4) Screening and replacement of primers and probes. Primers were verified by fluorescent PCR and conventional PCR amplification combined with agarose gel electrophoresis, and primers that would cause primer dimers or low amplification efficiency were removed. Primers and probes were then redesigned and synthesized.

[0155] (5) Optimize PCR reaction conditions: Test different annealing temperatures based on primer characteristics.

[0156] (6) Optimization of different primer and probe ratio conditions. The amplification efficiency of different primers varies. In order to balance the amplification efficiency between primers as much as possible, different primer ratio concentrations were tested.

[0157] Example 1

[0158] Multiplex fluorescence PCR was used to detect pathogenic microorganisms and drug-resistant genes in bronchoalveolar lavage fluid of patients with lower respiratory tract infection. The detection method is as follows:

[0159] 1. Nucleic acid template extraction

[0160] (1) Take 500 μL of bronchoalveolar lavage fluid sample, add 0.2 g of 0.2 mm grinding beads, and oscillate on an oscillator for 5 min to obtain an oscillated bronchoalveolar lavage fluid sample; add 500 μL of lysis buffer and 20 μL of proteinase K to the oscillated bronchoalveolar lavage fluid sample, mix well, incubate at 50° C. for 10 min, and then add 500 μL of anhydrous ethanol to mix;

[0161] (2) Take the mixed liquid and add it to a centrifuge column with a collection tube, centrifuge at 10,000 rpm for 1 min, and discard the filtrate;

[0162] (3) Add 500 μL of rinse solution 1 to the centrifuge column, centrifuge at 10,000 rpm for 1 min, and discard the filtrate;

[0163] (4) Add 700 μL of rinse solution 2 to the centrifuge column, centrifuge at 10,000 rpm for 1 min, and discard the filtrate;

[0164] (5) Add 500 μL of rinse solution 2 to the centrifuge column, centrifuge at 10,000 rpm for 1 min, and discard the filtrate;

[0165] (6) Transfer the centrifuge column to a new 1.5 mL centrifuge tube, add 50 μL of Nuclease-Free Water to the center of the centrifuge column, let it stand at room temperature for 2 min, and centrifuge at 8000 rpm for 1 min to collect the nucleic acid to obtain the nucleic acid template.

[0166] The reagents in the above extraction steps are from the FastPure Cell / Tissue Total RNA Isolation Kit V2, catalog number: RC112-01;

[0167] 2. Multiplex fluorescence PCR reaction solution configuration

[0168] (1) The components of the PCR reaction premix include: dNTP 0.5mM, dUTP 0.3mM, Tris-HCl (pH 8.5) 200mM, MgCl2 5mM, KCl 100mM, (NH4)2SO4 80mM, glycerol 5%, reverse transcriptase 8U / μL, high temperature resistant Taq DNA polymerase 4.5U / μL, UDG enzyme 1.5U / μL, and the solvent is water; the components are mixed to obtain a PCR reaction premix;

[0169] (2) Mix 2 μL of the nucleic acid template obtained in the above nucleic acid template extraction operation with 4 μL of the PCR reaction premix prepared above, 4 μL of primers and fluorescent probes, and 10 μL of ddH2O to obtain a multiplex fluorescent PCR reaction solution with a total reaction system of 20 μL;

[0170] 3. Multiplex fluorescence PCR reaction

[0171] The multiplex fluorescence PCR reaction solution obtained above was added to a 96-well plate, and after instant centrifugation, multiplex fluorescence PCR reaction was performed on a fluorescence quantitative PCR instrument; the schematic diagram of the multiplex fluorescence PCR principle is shown in the attached figure. Figure 1 As shown;

[0172] The multiplex fluorescence PCR reaction procedure is shown in Table 2 ;

[0173] Table 2 Multiplex fluorescence PCR reaction procedures

[0174]

[0175] 4. Data Analysis

[0176] The fluorescence quantitative PCR instrument will monitor the changes in the fluorescence signals in each detection well, draw a fluorescence amplification curve, and automatically give the Ct value; the multiple fluorescence PCR amplification curve of the alveolar lavage fluid sample is shown in the attached figure. Figure 2 As shown;

[0177] The test results of the bronchoalveolar lavage fluid sample were positive for Legionella pneumophila, with a Ct value of 29.20; positive for Moraxella catarrhalis, with a Ct value of 29.35; positive for Pseudomonas aeruginosa, with a Ct value of 31.84; and negative for Acinetobacter baumannii, with no Ct value.

[0178] 5. Report Interpretation

[0179] Use the report template to fill in the patient information and the test results of pathogenic microorganisms and drug-resistant genes detected in the sample.

[0180] In order to verify the reliability of the multiplex fluorescence PCR detection results provided by the present invention, standard strains or inactivated virus cultures were selected for verification of some detection targets. The multiplex fluorescence PCR results of the standard strains or inactivated viruses are shown in Table 3 below; the multiplex fluorescence PCR amplification curves of the standard strains or inactivated viruses are shown in the attached Figure 2-16 ;

[0181] For some targets that do not have commercial standard quality control products, positive samples confirmed by metagenomic sequencing were selected for verification. The test results of the samples are shown in Table 4 below; the multiplex fluorescence PCR amplification curve of the samples is shown in the attached Figure 17-23 ;

[0182] The experimental process is carried out with reference to the above-mentioned multiplex fluorescence PCR method for detecting pathogenic microorganisms and drug-resistant genes in the bronchoalveolar lavage fluid of patients with lower respiratory tract infection, specifically:

[0183] 1. Sample pretreatment

[0184] Take 500 μL of quality control sample or metagenomic sequencing positive sample, add 0.2 g of 0.2 mm grinding beads, and oscillate on an oscillator for 5 min to break the cells and release nucleic acids;

[0185] 2. Nucleic acid extraction

[0186] (1) Add 500 μL of lysis buffer and 20 μL of proteinase K to the shaken bronchoalveolar lavage fluid sample, mix thoroughly, incubate at 50°C for 10 min, and then add 500 μL of anhydrous ethanol to mix;

[0187] (2) Take the mixed liquid and add it to a centrifuge column with a collection tube, centrifuge at 10,000 rpm for 1 min, and discard the filtrate;

[0188] (3) Add 500 μL of rinse solution 1 to the centrifuge column, centrifuge at 10,000 rpm for 1 min, and discard the filtrate;

[0189] (4) Add 700 μL of rinse solution 2 to the centrifuge column, centrifuge at 10,000 rpm for 1 min, and discard the filtrate;

[0190] (5) Add 500 μL of rinse solution 2 to the centrifuge column, centrifuge at 10,000 rpm for 1 min, and discard the filtrate;

[0191] (6) Transfer the centrifuge column to a new 1.5 mL centrifuge tube, add 50 μL of Nuclease-Free Water to the center of the centrifuge column, let it stand at room temperature for 2 min, and centrifuge at 8000 rpm for 1 min to collect nucleic acid;

[0192] The reagents in the above extraction steps are from the FastPure Cell / Tissue Total RNA Isolation Kit V2, catalog number: RC112-01;

[0193] 3. Preparation of reaction solution

[0194] Add 24 tubes of primer-probe mixture into a 96-well plate, then add nucleic acid template and PCR amplification reaction solution, centrifuge briefly, and place on a fluorescent quantitative PCR instrument;

[0195] The multiplex fluorescence PCR reaction system is specifically as follows:

[0196] 4 μL of PCR reaction premix, 4 μL of primers and fluorescent probes, 2 μL of nucleic acid template, 10 μL of ddH2O, and 20 μL of total reaction system; wherein the components of the PCR reaction premix include: 0.5 mM dNTP, 0.3 mM dUTP, 200 mM Tris-HCl (pH 8.5), 5 mM MgCl2, 100 mM KCl, 80 mM (NH4)2SO4, 5% glycerol, 8 U / μL of reverse transcriptase, 4.5 U / μL of high temperature resistant Taq DNA polymerase, 1.5 U / μL of UDG enzyme, and the solvent is water; the components are mixed to obtain a PCR reaction premix;

[0197] The reaction procedure of multiplex fluorescence PCR is as follows:

[0198]

[0199] 4. Data Analysis

[0200] The fluorescence quantitative PCR instrument will monitor the changes in the fluorescence signal in each detection well, draw a fluorescence amplification curve, automatically give a Ct value, and judge the detection result of the corresponding target based on the given Ct value;

[0201] Table 3

[0202]

[0203]

[0204] Table 4

[0205]

[0206]

[0207] According to the test results in Table 3 and Table 4 and the corresponding Figure 3-23 The results showed that the multiplex fluorescence PCR detection results were highly reliable and had good consistency with the metagenomic sequencing results.

[0208] Example 2

[0209] The PCR reaction premix is ​​prepared by the following steps:

[0210] The PCR reaction premix includes the following components: dNTP 0.5mM, dUTP 0.3mM, Tris-HCl (pH 8.5) 200mM, MgCl2 5mM, KCl 100mM, (NH4)2SO4 80mM, glycerol 5%, reverse transcriptase 8U / μL, high temperature resistant Taq DNA polymerase 4.5U / μL, UDG enzyme 1.5U / μL, polyvinyl alcohol-polylysine polymer 1mg / mL and trehalose polymer 100mg / mL, and the solvent is water; the components are mixed to obtain the PCR reaction premix.

[0211] The preparation method of the polyvinyl alcohol-polylysine polymer comprises the following steps:

[0212] S1. Add 1.3 g of succinic anhydride to 10 g of a 25 wt% ε-polylysine aqueous solution, mix and stir at 50° C. for 2 h to obtain a mixed solution A; then pour the mixed solution A into a dialysis bag (10 KDa), dialyze with water for 24 h, then freeze-dry for 24 h, and then vacuum-dry at 60° C. for 18 h to obtain carboxylated ε-polylysine;

[0213] S2. Dissolve 1 g of polyvinyl alcohol in water and stir at 60°C for 2 h; then add 1.05 g of 1,1'-carbonyldiimidazole and continue stirring for 2 h to obtain a mixed solution B; then add 1 g of carboxylated ε-polylysine to the mixed solution B, mix and stir at 60°C for 4 h to obtain a mixed solution C, then pour the mixed solution C into a dialysis bag (10 KDa), dialyze with water for 3 days, dry in an oven for 24 h after dialysis, and then vacuum dry at 60°C for 18 h to obtain a polyvinyl alcohol-polylysine polymer.

[0214] The preparation method of the trehalose polymer comprises the following steps:

[0215] Dissolve 4 g of trehalose and 1.87 g of sodium hydroxide in 10 g of water, place at 70°C and mix and stir for 30 min to obtain a transparent viscous liquid; then add 3.23 g of epichlorohydrin to the liquid and mix, and let stand at room temperature for 48 h to obtain a mixed solution; then adjust the pH value of the mixed solution to 7.0 with hydrochloric acid, then pour the solution into a dialysis bag (3KDa), dialyze with water for 3 days, and freeze-dry under vacuum after dialysis to obtain trehalose polymer.

[0216] Example 3

[0217] The PCR reaction premix is ​​prepared by the following steps:

[0218] The PCR reaction premix includes the following components: dNTP 0.5mM, dUTP 0.3mM, Tris-HCl (pH 8.5) 200mM, MgCl2 5mM, KCl 100mM, (NH4)2SO4 80mM, glycerol 5%, reverse transcriptase 8U / μL, high temperature resistant Taq DNA polymerase 4.5U / μL, UDG enzyme 1.5U / μL, polyvinyl alcohol-polylysine polymer 1mg / mL and trehalose 100mg / mL, and the solvent is water; the components are mixed to obtain the PCR reaction premix.

[0219] The preparation method of the polyvinyl alcohol-polylysine polymer is consistent with that of Example 2.

[0220] Example 4

[0221] The PCR reaction premix is ​​prepared by the following steps:

[0222] The PCR reaction premix includes the following components: dNTP 0.5mM, dUTP 0.3mM, Tris-HCl (pH 8.5) 200mM, MgCl2 5mM, KCl 100mM, (NH4)2SO4 80mM, glycerol 5%, reverse transcriptase 8U / μL, high temperature resistant Taq DNA polymerase 4.5U / μL, UDG enzyme 1.5U / μL, UDG enzyme 1.5U / μL and polyvinyl alcohol-polylysine polymer 1mg / mL, and the solvent is water; the components are mixed to obtain the PCR reaction premix.

[0223] The preparation method of the polyvinyl alcohol-polylysine polymer is consistent with that of Example 2.

[0224] Example 5

[0225] The PCR reaction premix is ​​prepared by the following steps:

[0226] The PCR reaction premix includes the following components: dNTP 0.5mM, dUTP 0.3mM, Tris-HCl (pH 8.5) 200mM, MgCl2 5mM, KCl 100mM, (NH4)2SO4 80mM, glycerol 5%, reverse transcriptase 8U / μL, high temperature resistant Taq DNA polymerase 4.5U / μL, UDG enzyme 1.5U / μL, polyvinyl alcohol 1mg / mL and trehalose 100mg / mL, and the solvent is water; the components are mixed to obtain the PCR reaction premix.

[0227] Comparative Example 1

[0228] The PCR reaction premix is ​​prepared by the following steps:

[0229] The PCR reaction premix includes the following components: dNTP 0.5mM, dUTP 0.3mM, Tris-HCl (pH 8.5) 200mM, MgCl2 5mM, KCl 100mM, (NH4)2SO4 80mM, glycerol 5%, reverse transcriptase 8U / μL, high temperature resistant Taq DNA polymerase 4.5U / μL, UDG enzyme 1.5U / μL and polyvinyl alcohol 1mg / mL, and the solvent is water; the components are mixed to obtain the PCR reaction premix.

[0230] Comparative Example 2

[0231] The PCR reaction premix is ​​prepared by the following steps:

[0232] The PCR reaction premix includes the following components: dNTP 0.5mM, dUTP 0.3mM, Tris-HCl (pH 8.5) 200mM, MgCl2 5mM, KCl 100mM, (NH4)2SO4 80mM, glycerol 5%, reverse transcriptase 8U / μL, high temperature resistant Taq DNA polymerase 4.5U / μL, UDG enzyme 1.5U / μL and trehalose polymer 100mg / mL, and the solvent is water; the components are mixed to obtain the PCR reaction premix.

[0233] The preparation method of the trehalose polymer is consistent with that in Example 2.

[0234] Test Example 1

[0235] Taq DNA polymerase activity test

[0236] Taq DNA polymerase is a key enzyme in the PCR reaction, and its activity is directly related to the efficiency of the PCR reaction and the accuracy of the results. During long-term freezing or repeated freezing and thawing, the activity of the Taq enzyme may decrease, which will affect the amplification effect of PCR and the accuracy of quantitative detection. Therefore, improving the enzyme activity of Taq DNA polymerase in the PCR reaction premix under these conditions can ensure the reliability and repeatability of the PCR experimental results.

[0237] Freezing test: The PCR reaction premixes prepared in Examples 1-5 and Comparative Examples 1-2, as well as commercially available premix 1 (Shanghai Fusheng Industrial Co., Ltd., item number A-Hc2094), commercially available premix 2 (Beijing Jiehui Bogao Biotechnology Co., Ltd., item number: TQ2200-00), and commercially available premix 3 (Yisheng Biotechnology (Shanghai) Co., Ltd., item number: 10102ES03) were stored at -20°C for 1 year to detect the activity of Taq DNA enzyme.

[0238] Repeated freeze-thaw test: The PCR reaction premixes prepared in Examples 1-5 and Comparative Examples 1-2, as well as commercially available premix 1 (Shanghai Fusheng Industrial Co., Ltd., item number A-Hc2094), commercially available premix 2 (Beijing Jiehui Bogao Biotechnology Co., Ltd., item number: TQ2200-00), and commercially available premix 3 (Yishen Biotechnology (Shanghai) Co., Ltd., item number: 10102ES03) were frozen at -20°C for 1 h, thawed at 25°C for 3 h, and repeatedly frozen and thawed 25 and 50 times to detect the activity of Taq DNA polymerase.

[0239] Remaining enzyme activity of DNA polymerase (%) = enzyme activity before test / activity after test × 100%

[0240] The results are shown in Table 5 below.

[0241] Table 5 Taq DNA polymerase activity test results

[0242]

[0243] As shown in Table 5 above, after freezing treatment of the PCR reaction premix prepared by Examples 1-5 and Comparative Examples 1-2 and the commercially available premix of 1-3, it was found that Examples 1-5 and Comparative Examples 1-2 could still maintain a high enzyme activity, with the enzyme activity being higher than 82%, and the enzyme activity of Examples 2-5 and Comparative Example 1 could be maintained at more than 90%, while the enzyme activity of the commercially available polymerase of 1-3 was significantly reduced, indicating that the PCR reaction premix provided by the present invention can protect the enzyme activity of Taq DNA polymerase under long-term freezing and prevent the Taq DNA polymerase from being damaged by freezing. By comparing the enzyme activity of Examples 1-5 and Comparative Examples 1-2, it was found that the enzyme activity of Examples 2-5 and Comparative Examples 1-2 was higher than that of Example 1, wherein the enzyme activity of Example 2 was the highest, and the enzyme activity could be maintained at 98.6% after long-term freezing, indicating that the coordinated use of polyvinyl alcohol-polylysine polymer and trehalose polymer can improve the cryoprotection effect on Taq DNA polymerase and increase the antifreeze stability of Taq DNA polymerase.

[0244] After repeated freezing and thawing treatment of Examples 1-5, Comparative Examples 1-2 and 3 groups of commercially available premixes, the activity of Taq enzyme will be affected, and all of them will decrease significantly, among which the decreasing trend of Examples 1-5 and Comparative Examples 1-2 is significantly less than that of commercially available 1-3, indicating that the PCR reaction premix prepared by the present invention has a better protective effect on the enzyme than the commercially available one. Comparison of Examples 1-5 and Comparative Examples 1-2 found that the amount of decrease in the activity of Taq DNA polymerase in the premix prepared by Examples 2-5 and Comparative Examples 1-2 was significantly lower than that of the premix prepared by Example 1, and the ability of Example 2-5 to protect the enzyme activity was significantly better than that of Comparative Examples 1-2, and Example 2 was the best. After repeated freezing and thawing 25 times and 50 times, the enzyme activity can be maintained at 97.4% and 94.5%, indicating that the coordinated use of polyvinyl alcohol-polylysine polymer and trehalose polymer can buffer the damage to the activity of Taq DNA polymerase caused by repeated freezing and thawing, thereby maintaining a higher activity.

[0245] Test Example 2

[0246] Multiplex fluorescence PCR stability test

[0247] The PCR reaction premixes prepared in Example 1 and Example 2, which were subjected to repeated freeze-thaw pretreatment (frozen at -20°C for 1 hour, thawed at 25°C for 3 hours, and repeatedly frozen and thawed 50 times) and not subjected to repeated freeze-thaw pretreatment (placed at 25°C for 1 hour), were used to prepare multiple fluorescent PCR reaction solutions, and multiple fluorescent PCR reactions were performed according to the detection method provided in Example 1. The detection results of pathogenic microorganisms or drug-resistant genes using the multiple fluorescent kits using the PCR reaction premixes with different pretreatments were tested, and the detection was repeated 20 times, and the stability of PCR was judged according to the detection rate of each pathogenic microorganism or drug-resistant gene.

[0248] The detection rate is calculated according to the following formula:

[0249] Detection rate (%) = number of detections / number of tests × 100%

[0250] The test results are averaged and are shown in Table 6.

[0251] Table 6 Detection rate of pathogenic microorganisms or drug-resistant genes

[0252]

[0253]

[0254] As shown in Table 6, the detection rates of pathogenic microorganisms or drug-resistant genes in Example 1 and Example 2 changed under different pretreatments. Under the condition of no repeated freezing and thawing pretreatment, the detection rates of Example 1 and Example 2 were 100%, but after repeated freezing and thawing treatment, the detection rates of Example 1 and Example 2 decreased, and the decrease in Example 1 was more obvious. The gene detection rate of Example 2 remained at a high level, and after repeated freezing and thawing for 50 times, the detection rate of more than 90% could be maintained, and PCR was stable. The reason for the analysis may be that the enzyme activity of Taq DNA polymerase will be significantly reduced under repeated freezing and thawing, which will have a negative impact on the amplification efficiency and specificity of the PCR reaction, thereby affecting the detection rate of PCR. The synergistic use of polyvinyl alcohol-polylysine polymer and trehalose polymer in Example 2 can protect the enzyme activity of Taq DNA polymerase under repeated freezing and thawing.

[0255] The polyvinyl alcohol in the polyvinyl alcohol-polylysine polymer structure has high anti-ice crystallization activity, which can increase the enthalpy gain of the system by forming hydrogen bonds with ice, and increase the entropy factor by desolvation of the methyl group of polyvinyl alcohol, thereby inhibiting the growth of ice crystals, which helps to maintain a smaller ice crystal size during freezing, reduce physical damage to the protein structure, and increase enzyme activity. In addition, during the freezing process, due to the formation of ice, the solute concentration in the surrounding medium will increase, resulting in freezing concentration, which will cause osmotic damage to the enzyme protein. Carboxylated ε-polylysine is grafted into the polyvinyl alcohol-polylysine polymer structure. As a polyampholyte, carboxylated ε-polylysine can reduce the occurrence of freezing concentration through strong intermolecular interactions, reduce the osmotic damage caused by freezing concentration, and reduce the freezing concentration effect by capturing salt in the molecule, thereby improving the efficiency of polyvinyl alcohol-polylysine polymer in protecting enzyme proteins from multiple freeze-thaw cycles and long-term freezing, thereby facilitating the maintenance of enzyme activity. At the same time, trehalose binds to water molecules by forming hydrogen bonds, which enhances hydration and helps maintain the three-dimensional structure of Taq DNA polymerase during freezing and prevents it from denaturing or aggregating due to dehydration. Moreover, trehalose can inhibit the formation and growth of ice crystals during freezing and reduce the physical damage that ice crystals may cause to enzyme molecules. Therefore, trehalose helps maintain the activity of Taq DNA polymerase during repeated freezing and thawing and reduces activity loss. In addition, trehalose may improve the stability of Taq DNA polymerase during freezing and thawing by forming a vitrified state and reduce structural changes caused by temperature changes. On this basis, trehalose is modified by epichlorohydrin to form trehalose polymers, which improves its permeability and may help it penetrate into the microenvironment of the enzyme, further reducing enzyme denaturation and changes in enzyme protein structure.

[0256] The present invention introduces polyvinyl alcohol-polylysine polymer and trehalose polymer into PCR premix for coordinated use, trehalose polymer protects Taq DNA polymerase by enhancing hydration and forming a glassy matrix, and polyvinyl alcohol-polylysine polymer inhibits ice crystal growth and reduces osmotic pressure stress through its high anti-ice crystallization activity, and this different protection mechanism may complement each other in the premix, more effectively maintaining the structural integrity and function of the enzyme. In addition, trehalose polymer and polyvinyl alcohol-polylysine polymer are both hydrophilic, and the coordinated use of the two more effectively binds water molecules to form a stable hydration layer, reducing the dehydration effect during freezing. In addition, the IRI activity of polyvinyl alcohol-polylysine polymer may synergize with the vitrification effect of trehalose polymer, improve the thermal stability of Taq DNA polymerase during repeated freezing and thawing, reduce protein structural changes and aggregation caused by temperature changes, thereby protecting the activity of the enzyme, and then improving the stability of PCR after repeated freezing and thawing.

Claims

1. A multiplex fluorescent PCR kit for simultaneously detecting multiple pathogenic microorganisms and drug-resistant genes, characterized in that: Including primers and fluorescent probes for detecting target pathogenic microorganisms and drug-resistant genes, PCR reaction premix, positive quality control products, and negative quality control products; The target pathogenic microorganisms and drug resistance genes include Staphylococcus aureus, Streptococcus pneumoniae, Enterococcus faecalis, Enterococcus faecium, Mycoplasma pneumoniae, Mycobacterium avium complex, Stenotrophomonas maltophilia, Legionella pneumophila, Moraxella catarrhalis, Pseudomonas aeruginosa, Acinetobacter baumannii, Haemophilus influenzae, Escherichia coli, Klebsiella pneumoniae, Epstein-Barr virus, Aspergillus fumigatus, Aspergillus flavus, human cytomegalovirus, influenza A virus, Candida albicans, Candida tropicalis, and Trophicola whipplei. , human bocavirus, Mycobacterium tuberculosis, novel coronavirus, influenza B virus, human metapneumovirus, Chlamydia psittaci, rhinovirus, internal reference gene, respiratory syncytial virus, Listeria monocytogenes, Streptococcus pyogenes, Streptococcus agalactiae, Mycobacterium chelonae, Nocardia asteroides, Fusobacterium nucleatum, Orientia tsutsugamushi, Bartonella henselae, Burkholderia glanders, Neisseria meningitidis, Salmonella enterica, Proteus mirabilis, Burkholderia cepacia, Serratia marcescens, Klebsiella aerogenes, Nocardia mallei, Aspergillus niger, Aspergillus terreus, Brucella melitensis, Morganella morganii, Candida glabrata, Candida parapsilosis, Mycoplasma hominis, Chlamydia trachomatis, Candida krusei, Candida dubliniensis, Chlamydia pneumoniae, Treponema pallidum, Cryptococcus neoformans, Trichosporon asahii, Bacteroides fragilis, Brucella, Talaromyces marneffei, Pneumocystis jirovecii, Bordetella pertussis, Aeromonas hydrophila, Rhizopus microsporus, Fusarium, Citrobacter freundii, Guinea pig otitis Nocardia, human herpesvirus 1, human herpesvirus 2, human herpesvirus 3 (VZV), human herpesvirus 6, human herpesvirus 7, Streptococcus suis, Mycobacterium intracellulare, Nocardia Gelsenkirchen, adenovirus type 3, adenovirus type 4, adenovirus type 7, adenovirus type 21, Hantavirus, mecA, blaKPC, NDM, OXA-48, VIM, IMP, vanA, ampC, OXA-23, SHV, MCR-1; The primers of the target pathogenic microorganism and drug resistance gene and the upstream primer sequence, downstream primer sequence and nucleic acid sequence of the fluorescent probe are as follows: For the detection of Staphylococcus aureus, the nucleic acid sequence of the upstream primer is: GGCGGCGTGCCTAATA; the nucleic acid sequence of the downstream primer is: CTAACATCAGAGAAGCAAGC; the nucleic acid sequence of the fluorescent probe is: GCAAGTCGAGCGAACGGACGAG; For the detection of Streptococcus pneumoniae, the nucleic acid sequence of the upstream primer is: CTTATGGGCGCCAAGTCTA; the nucleic acid sequence of the downstream primer is: AAGCTTCAAAAGCAGCCTCTA; the nucleic acid sequence of the fluorescent probe is: AAGTTGGAAACCACGAGTAAGAGTGATGA; For the detection of Enterococcus faecalis, the nucleic acid sequence of the upstream primer is: ATGCCGCGTTCATTTA; the nucleic acid sequence of the downstream primer is: TTCTTGTAATTTTTCACGATCAA; the nucleic acid sequence of the fluorescent probe is: ACCAAATCGGCGAAACAACGTCTG; For the detection of Enterococcus faecium, the nucleic acid sequence of the upstream primer is: GTATCAAGATCGTTGTTCGTGCTT; the nucleic acid sequence of the downstream primer is: TGATCCTTCATAACCAGCGTTT; the nucleic acid sequence of the fluorescent probe is: AAGAACCAATTCGTCAAATCGCTG; Used to check the drug resistance of bronchitis, the nucleic acid sequence of the upstream primer is: AATCCAGGTACGGGTGAAGACA; the nucleic acid sequence of the downstream primer is: TGCTCCTACCTATTCTCTACATGATAATG; the nucleic acid sequence of the fluorescent probe is: AACGGGACGGGAAGAC; For the detection of Mycoplasma pneumoniae, the nucleic acid sequence of the upstream primer is: GCCACACCAATGCCATCA; the nucleic acid sequence of the downstream primer is: GAGGGAGGAAAAGCTCGTGTT; the nucleic acid sequence of the fluorescent probe is: CGCGCTTAACCGTGAACG; For the examination of Mycobacterium avium complex, the nucleic acid sequence of the upstream primer is: CATCGAGAGCCGATGAAG; the nucleic acid sequence of the downstream primer is: GATCAATGCTCGGTTGAC; the nucleic acid sequence of the fluorescent probe is: ACGTGGGAGGCTGCGATATGC; For the detection of Stenotrophomonas maltophilia, the nucleic acid sequence of the upstream primer is: GCCGAAAGCCCAAGGTTT; the nucleic acid sequence of the downstream primer is: CGACTTTCGTCCTCGCCTTA; the nucleic acid sequence of the fluorescent probe is: CGCAACGTTAATCGGCGCAGG; For the detection of Legionella pneumophila, the nucleic acid sequence of the upstream primer is: TGCCAAGTGGTTTGCAATACAA; the nucleic acid sequence of the downstream primer is: TTCGACAGTGACTGTATCCGATTT; the nucleic acid sequence of the fluorescent probe is: AATCAATTCTGGAAATGGTGTGTTAAACCCGG; For the detection of Moraxella catarrhalis, the nucleic acid sequence of the upstream primer is: GGTGAGTGCCGCTTTTACAAC; the nucleic acid sequence of the downstream primer is: TGTATCGCCTGCCAAGACAA; the nucleic acid sequence of the fluorescent probe is: TGCTTTTGCAGCTGTTAGCCAGCCTAAG; For the examination of Pseudomonas aeruginosa, the nucleic acid sequence of the upstream primer is: AGCCTTCCTGGTCCCCTTAC; the nucleic acid sequence of the downstream primer is: CCTAATGAACCCCAGTGTATAAGTTTG; the nucleic acid sequence of the fluorescent probe is: TGAACTGACGGTCGCCAACGGTT; For the detection of Acinetobacter baumannii, the nucleic acid sequence of the upstream primer is: TCTTGGTGGTCACTTGAAGCC; the nucleic acid sequence of the downstream primer is: ACTCTTGTGGTTGTGGAGCAA; the nucleic acid sequence of the fluorescent probe is: TGTAGTAGAAGTTGCTCCAGTTGAACCAACTC; For the detection of Haemophilus influenzae, the nucleic acid sequence of the upstream primer is: AGCTTGTAGTTCATCTAACA; the nucleic acid sequence of the downstream primer is: CAGAGTAACCGCCAAAAGTT; the nucleic acid sequence of the fluorescent probe is: CGATGCTGCAGGCAATGGTGCT; For detecting Escherichia coli, the nucleic acid sequence of the upstream primer is: CGGCGTGGTGTAGAGCATT; the nucleic acid sequence of the downstream primer is: GCAGTCTTACTTCCATGATTTCTTTAAC; the nucleic acid sequence of the fluorescent probe is: CGCTGCGATGGATCCCGG; For the detection of Klebsiella pneumoniae, the nucleic acid sequence of the upstream primer is: CGGGCGTAGCGCGTAA; the nucleic acid sequence of the downstream primer is: GATACCCGCATTCACATTAAACAG; the nucleic acid sequence of the fluorescent probe is: CCCGGCATGGATCGTTCCGA; For detecting Epstein-Barr virus, the nucleic acid sequence of the upstream primer is: GGCCGTGATGGAGGCTA; the nucleic acid sequence of the downstream primer is: AGACAGAGGCCACCACG; the nucleic acid sequence of the fluorescent probe is: ACCTTTGGCTCGGCCTCCTGC; For the detection of Aspergillus fumigatus, the nucleic acid sequence of the upstream primer is: GAAGACCCCAACATG; the nucleic acid sequence of the downstream primer is: CGGAACCAAGAGATCCGTTGT; the nucleic acid sequence of the fluorescent probe is: ACGCTGTTCTGAAAGTATGCAG; For checking Aspergillus flavus, the nucleic acid sequence of the upstream primer is: GTCCGATCCTCGAGCGTATG; the nucleic acid sequence of the downstream primer is: TTGATTTGCGTTCGGCAAG; the nucleic acid sequence of the fluorescent probe is: CCCGCTCTGTAGGCCCGGCC; For the detection of human cytomegalovirus, the nucleic acid sequence of the upstream primer is: CTAGTGTGATGCTGCCAA; the nucleic acid sequence of the downstream primer is: TTCATGCAGATCTCCTCAATG; the nucleic acid sequence of the fluorescent probe is: CCTGAGGTTATCAGTGTAATGAAGC; For the detection of influenza A virus, the nucleic acid sequence of the upstream primer is: GTCAGGCCCCCTCAAA; the nucleic acid sequence of the downstream primer is: TGTGTTCTTCCCTGCAAAGA; the nucleic acid sequence of the fluorescent probe is: AGATCGCGCAGAGACTTGAAGA; For the examination of Candida albicans, the nucleic acid sequence of the upstream primer is: TTTGGTGTTGAGCAATACGA; the nucleic acid sequence of the downstream primer is: AGCGATCCCGCCTTACC; the nucleic acid sequence of the fluorescent probe is: GGTTTGCTTGAAAGACGGTAG; For the examination of Candida tropicalis, the nucleic acid sequence of the upstream primer is: CTTGGTATTTTGTATGTTACTTCTTCGG; the nucleic acid sequence of the downstream primer is: GGCTGGCAGTATCGACGAAGG; the nucleic acid sequence of the fluorescent probe is: CTCTACAGTTTATCGGGCCAGCAT; For detecting Trophophora whipplei, the nucleic acid sequence of the upstream primer is: TTTTGTACTGCTTGTAACAGGATCT; the nucleic acid sequence of the downstream primer is: GCTCTATCCCTCCTATCATC; the nucleic acid sequence of the fluorescent probe is: AGATACATTTGTGTTAGTTGTTACA; For the detection of human bocavirus, the nucleic acid sequence of the upstream primer is: GACAAGTCAGCTGTGAAATTG; the nucleic acid sequence of the downstream primer is: CCGAGTGCAGTATGTCTTCTTT; the nucleic acid sequence of the fluorescent probe is: CAACAAAGAACTGGCGTCCA; For the detection of Mycobacterium tuberculosis, the nucleic acid sequence of the upstream primer is: GGATAGGGGATCTCAGTAC; the nucleic acid sequence of the downstream primer is: GTCTCGGCTAGTGCATTGTC; the nucleic acid sequence of the fluorescent probe is: CCGACCGCTCCGACCGAC; For testing the novel coronavirus, the nucleic acid sequence of the upstream primer is: CTGTGGGTTTTACACTTAAA; the nucleic acid sequence of the downstream primer is: CGATTGTGCATCAGCTGA; the nucleic acid sequence of the fluorescent probe is: TCTGCGGTATGTGGAAAGGTTATGG; For detecting influenza B virus, the nucleic acid sequence of the upstream primer is: GAACAAGACCAGAGGGAAACTATG; the nucleic acid sequence of the downstream primer is: CTGCCTAAGGCCACATCCA; the nucleic acid sequence of the fluorescent probe is: CCAACCTGCCTCAACTGCACAGA; For detecting human metapneumovirus, the nucleic acid sequence of the upstream primer is: TGGCCAATTGCCCCAAT; the nucleic acid sequence of the downstream primer is: TTCCGATTATGCCTAGACCTGAA; the nucleic acid sequence of the fluorescent probe is: TTTGCTAGTGTTGTTCTTGGCAATGC; For the detection of Chlamydia psittaci, the nucleic acid sequence of the upstream primer is: GAGGCATCTTGTAGTAGAGAA; the nucleic acid sequence of the downstream primer is: TATCGGCACTACTTCTAACA; the nucleic acid sequence of the fluorescent probe is: ACTACCCTCCTCAGGGACCACT; For detecting rhinovirus, the nucleic acid sequence of the upstream primer is: GCCCCTGAATGCGGCTAA; the nucleic acid sequence of the downstream primer is: GAAACACGGACACCCAAAGTAGT; the nucleic acid sequence of the fluorescent probe is: TAATGAGCAATTGCGGGATGGGACC; For checking the internal reference gene, the nucleic acid sequence of the upstream primer is: CAGGTGGTCTCCTCTGACTTC; the nucleic acid sequence of the downstream primer is: GGTCGTTGAGGGCAATG; the nucleic acid sequence of the fluorescent probe is: AGCGACCACCCACTCCTCCACCTT; For detecting respiratory syncytial virus, the nucleic acid sequence of the upstream primer is: TGGAGGAAATCCAACTAATCACAA; the nucleic acid sequence of the downstream primer is: AAGGCCAGAATTTGCTTGAGA; the nucleic acid sequence of the fluorescent probe is: ACATAGACAAGTCAACACGCCAGGCA; For the examination of Listeria monocytogenes , the nucleic acid sequence of the upstream primer: TGGCACCACCAGCATCT; the nucleic acid sequence of the downstream primer: CCGCGTGTTTCTTTTCGA; Nucleic acid sequence of the fluorescent probe: CCTGCAAGTCCTAAGACGCCA; For the examination of Streptococcus pyogenes, the nucleic acid sequence of the upstream primer is: GGGACACGTACCCAAAATGTAGGA; the nucleic acid sequence of the downstream primer is: TCTTGAGCTCTTTGTTCGGTATAG; the nucleic acid sequence of the fluorescent probe is: CGTGACCAAAAAGGCGGCATGC; For the examination of Streptococcus agalactiae, the nucleic acid sequence of the upstream primer is: AACTCTAGTGGCTGGTGCA; the nucleic acid sequence of the downstream primer is: CTTGTGGAGTTGTCACTTGATCA; the nucleic acid sequence of the fluorescent probe is: ATTTTCACCAGCTGTATTAGAAGTA; For the detection of Mycobacterium chelonae, the nucleic acid sequence of the upstream primer is: TTACTCGCTTGGTGAATATGTTT; the nucleic acid sequence of the downstream primer is: ACGTTTTGCCGACTACCT; the nucleic acid sequence of the fluorescent probe is: AATCCTCGTCCACCCCGTGGA; For the detection of Nocardia asteroides, the nucleic acid sequence of the upstream primer is: GCCTTCGGGTTGTAAACCTCTT; the nucleic acid sequence of the downstream primer is: GCCGGTGCTTCTTCTACAGGTA; the nucleic acid sequence of the fluorescent probe is: ACAGGGACGAAGCGCAAGTGACG; For the detection of Fusobacterium nucleatum, the nucleic acid sequence of the upstream primer is: AAGCGGTGGAGCATG; the nucleic acid sequence of the downstream primer is: AAGATGTCAACGCTGGTAAGG; the nucleic acid sequence of the fluorescent probe is: TAATTCGACGCAACGCGAGG; For the detection of Orientia tsutsugamushi, the nucleic acid sequence of the upstream primer is: AACTGATTTTATTCAAACTAATGCTG; the nucleic acid sequence of the downstream primer is: TATGCCTGAGTAAGATACRTGAATRGA; the nucleic acid sequence of the fluorescent probe is: TGGGTAGCTTTGGTGGACCGATGTTTAA; For the examination of Bartonella henselae, the nucleic acid sequence of the upstream primer: ATGATGATCCCAAGCCTTCTG; the nucleic acid sequence of the downstream primer: ATRAAYYRGWAAACCTTYMYC; the nucleic acid sequence of the fluorescent probe: ACCGTGGGCTTTGAAAAACGC; For the detection of Burkholderia pseudomallei, the nucleic acid sequence of the upstream primer is: GAGCGCATCGTACTCGTA; the nucleic acid sequence of the downstream primer is: AAGTCGTGGATGCGCATTA; the nucleic acid sequence of the fluorescent probe is: TGAAACGCGCAGCG; For the detection of Neisseria meningitidis, the nucleic acid sequence of the upstream primer is: TTTACCCCTGATTTACAAGGAT; the nucleic acid sequence of the downstream primer is: GCTCACAGCTTGGGTTT; the nucleic acid sequence of the fluorescent probe is: CGAAGGCTTACATGGTTTCCACATCC; For the detection of enteric Salmonella, the nucleic acid sequence of the upstream primer is: AATGGCGGCGAATTACG; the nucleic acid sequence of the downstream primer is: GATCCCTTTGCGAATAAC; the nucleic acid sequence of the fluorescent probe is: TAATGGTATCTGCTGAAGTTGAG; For the examination of Proteus mirabilis, the nucleic acid sequence of the upstream primer is: GTGGCGGGTACTAATGCAA; the nucleic acid sequence of the downstream primer is: GCCTCTAACATGCGGTACA; the nucleic acid sequence of the fluorescent probe is: ACAGTTACCCCCGGTATTTGGA; For the detection of Burkholderia cepacia, the nucleic acid sequence of the upstream primer is: CAAGAAGAACGACGAGGTGATC; the nucleic acid sequence of the downstream primer is: GGCGGCGACACCTT; the nucleic acid sequence of the fluorescent probe is: AACCCGCGTGAAGGTCGTCAAG; For the examination of Serratia marcescens, the nucleic acid sequence of the upstream primer: CCGACAGATCCTTGTCCAAC; the nucleic acid sequence of the downstream primer: GGGTGAAAAACGCCAACTC; the nucleic acid sequence of the fluorescent probe: TTGGCCGTTGAGCCATAC; For the detection of Klebsiella aerogenes, the nucleic acid sequence of the upstream primer is: CGAAACCCAGCAGAAACT; the nucleic acid sequence of the downstream primer is: GTACGTTACCGCTATATTCACG; the nucleic acid sequence of the fluorescent probe is: ACCTTTATGGCCCTGCTG; For the detection of Nocardia mallei, the nucleic acid sequence of the upstream primer is: CCGATCCGCCGTCAAATC; the nucleic acid sequence of the downstream primer is: GGTCGTCCGGTGTGGA; the nucleic acid sequence of the fluorescent probe is: CATACCCCAACGCCAGCTGA; For the detection of Aspergillus niger, the nucleic acid sequence of the upstream primer is: ACCCCAACACGAACACTGTC; the nucleic acid sequence of the downstream primer is: GAGATCCATTGTTGAAAGTTTTAA; the nucleic acid sequence of the fluorescent probe is: AGCGTGCAGTCTGAGTTGATTGAATGC; For the detection of Aspergillus terreus, the nucleic acid sequence of the upstream primer is: TTACCGAGTGCGGGTCTTTA; the nucleic acid sequence of the downstream primer is: CCGCCGAAGCAACAAG; the nucleic acid sequence of the fluorescent probe is: CAACCTCCCACCCGTGACTATTG; For the detection of Brucella melitensis, the nucleic acid sequence of the upstream primer is: GCTCGACACAAAGGGCCA; the nucleic acid sequence of the downstream primer is: CAAGCGTGGTCTGGCGA; the nucleic acid sequence of the fluorescent probe is: CCGAGATACAAA; For the examination of Morganella morganii, the nucleic acid sequence of the upstream primer is: GTGAAATCCCCGGGCTTAA; the nucleic acid sequence of the downstream primer is: ACCCCCCTCTACAAGACTCTA; the nucleic acid sequence of the fluorescent probe is: CCGGGAATTGCATCTGATACTGG; For the examination of Candida glabrata, the nucleic acid sequence of the upstream primer: TGTGGTAGTACCTGAGTTGCACTAT; the nucleic acid sequence of the downstream primer: GAACTCCTGTTCACGAACTT; the nucleic acid sequence of the fluorescent probe: CGGATATCTTTTCACACCTACGACCTTT; For the examination of Candida parapsilosis, the nucleic acid sequence of the upstream primer: CCCTTGTATATAATGCCTTTGT; the nucleic acid sequence of the downstream primer: GCCTTCGATGAGACTTGAA; the nucleic acid sequence of the fluorescent probe: GTTAAAGCAATCGCTTGAAGCGCGGTCT; For the detection of Mycoplasma hominis, the nucleic acid sequence of the upstream primer is: GGTTCCAACAACAACAGGT; the nucleic acid sequence of the downstream primer is: AATGATCCAGTTATTGTTGGA; the nucleic acid sequence of the fluorescent probe is: CTATTGGAAAAGTTATCCCTTCATTGGATAAGA; For the detection of Chlamydia trachomatis, the nucleic acid sequence of the upstream primer is: CGACATTTCTTGCTGCAAAG; the nucleic acid sequence of the downstream primer is: AGGACATTTTGCGGATAGG; the nucleic acid sequence of the fluorescent probe is: CTTTACCCATGAAATCCCTCGTGAT; For the detection of Candida krusei, the nucleic acid sequence of the upstream primer is: CGAAATGCGATACCTAGTG; the nucleic acid sequence of the downstream primer is: ATGGAAACGACGCTCAAA; the nucleic acid sequence of the fluorescent probe is: CAGCCATCGTGAATCATCGAGT; For the detection of Candida dubliniensis , the nucleic acid sequence of the upstream primer is: CACCACATGTGTTTTGTTC; the nucleic acid sequence of the downstream primer is: AGTTTATGTCCTCTGGCGG; the nucleic acid sequence of the fluorescent probe is: ACTTGCTTTGGCGGTGGGCCCCT; For the detection of Chlamydia pneumoniae, the nucleic acid sequence of the upstream primer is: TTGGTGCGACGCTATTAGC; the nucleic acid sequence of the downstream primer is: ATCTACTTTTAAGATACGGTCGAA; the nucleic acid sequence of the fluorescent probe is: TGCTGGATTTTACGGAGACTATG; For the detection of Treponema pallidum, the nucleic acid sequence of the upstream primer is: GGTAGAAGGGAGGGCTAGTACA; the nucleic acid sequence of the downstream primer is: GACACAGCACTCGTCTTCAAC; the nucleic acid sequence of the fluorescent probe is: GAGGTGAACTCCGTATTGAAGTCGG; For detecting Cryptococcus neoformans, the nucleic acid sequence of the upstream primer is: CTTAAATGTGTTAGTGGGAAGG; the nucleic acid sequence of the downstream primer is: CATAGGCCCAGCGAAACT; the nucleic acid sequence of the fluorescent probe is: TACCTGTCAGCCCGGCGTA; For the examination of Trichosporon asahii, the nucleic acid sequence of the upstream primer is: GCAGGCTTGGGTCTGTA; the nucleic acid sequence of the downstream primer is: GCTCACCAGCACTCATACTTG; the nucleic acid sequence of the fluorescent probe is: GTGAGCATACTAGGAGCTGCAA; For the examination of Bacteroides fragilis, the nucleic acid sequence of the upstream primer: CTTGACTGTTGTAGATAAAGCTAATG; the nucleic acid sequence of the downstream primer: TCTTCATTGCAGCATTATCCAC; the nucleic acid sequence of the fluorescent probe: GCTTCCAGTCGTCTATGGAGGCAGA; For the detection of Brucella, the nucleic acid sequence of the upstream primer is: GCCAAGATGTGCAACGA; the nucleic acid sequence of the downstream primer is: GTCGCACCGGCTTTCTA; the nucleic acid sequence of the fluorescent probe is: AATCGCGGCAACCGGCCTC; For the detection of Talaromyces marneffei, the nucleic acid sequence of the upstream primer is: AATCTTTGAACGCACATTGC; the nucleic acid sequence of the downstream primer is: CCCGGAGGGACCACA; the nucleic acid sequence of the fluorescent probe is: TGGCATTCCGGGGGGCAT; For the detection of Pneumocystis jirovecii, the nucleic acid sequence of the upstream primer is: ATGACCCTTATGAAGTGGGC; the nucleic acid sequence of the downstream primer is: TCCGACTTCCATCATTGC; the nucleic acid sequence of the fluorescent probe is: GTGCTGCAAAATTTTCTACAATGGG; For the detection of Bordetella pertussis, the nucleic acid sequence of the upstream primer is: GCATCGACCCCACCAA; the nucleic acid sequence of the downstream primer is: TTGTATTCGTCCAGGTTGAGT; the nucleic acid sequence of the fluorescent probe is: CGGGCGCGCTGTACCCATCT; For the examination of Aeromonas hydrophila, the nucleic acid sequence of the upstream primer is: GAACCACACCTTCGTCATC; the nucleic acid sequence of the downstream primer is: TAAGCTTGTCCCACTGG; the nucleic acid sequence of the fluorescent probe is: GTACAAGGACAAGGCGAGCAGC; For the detection of Rhizopus microsporus, the nucleic acid sequence of the upstream primer is: CGACTAGAGATTGGGCGTGTTT; the nucleic acid sequence of the downstream primer is: CCCCCAGAACCCAAAAA; the nucleic acid sequence of the fluorescent probe is: TATGACTGGCTCAGCATCTTAGCG; For the examination of Fusarium spp., the nucleic acid sequence of the upstream primer: TGGAACGGGACGCCATAGA; the nucleic acid sequence of the downstream primer: CGACTCGTCGAAGGAACTTTACA; the nucleic acid sequence of the fluorescent probe: CCCCGTCTGGTTGGATGCCATATCT; For the detection of Citrobacter freundii, the nucleic acid sequence of the upstream primer is: GCACGAGCGCTTTAATC; the nucleic acid sequence of the downstream primer is: GAAGGTGGCGGAATAACG; the nucleic acid sequence of the fluorescent probe is: CATGGCCGGAGCTGTCATC; For the detection of Nocardia otitidis in guinea pigs, the nucleic acid sequence of the upstream primer is: CCAGGACTCGAATTGAA; the nucleic acid sequence of the downstream primer is: CGGACAGATCGACGAATC; the nucleic acid sequence of the fluorescent probe is: CGAAGGTGTGAAACAT; For detecting human herpes virus type 1, the nucleic acid sequence of the upstream primer is: GCCGTGTGACACTATCG; the nucleic acid sequence of the downstream primer is: CGTAAAATGGCCCCTCC; the nucleic acid sequence of the fluorescent probe is: ATACCGACCACACCGACGAACC; For detecting human herpes virus type 2, the nucleic acid sequence of the upstream primer is: CTCTCGTAAATGCTTCCCT; the nucleic acid sequence of the downstream primer is: TACCCACAACAGACCCAC; the nucleic acid sequence of the fluorescent probe is: CGGAGACATTCGAGTACCAGATCG; For detecting human herpes virus type 3 (VZV), the nucleic acid sequence of the upstream primer is: GAGAACGGTTTGGGTTTTC; the nucleic acid sequence of the downstream primer is: CCGGTCGTCTCAACA; the nucleic acid sequence of the fluorescent probe is: CTGCCAAGGGCCTCCTGTT; For detecting human herpes virus type 6, the nucleic acid sequence of the upstream primer is: AACAATACTCTCTACTTATTCGACTCT; the nucleic acid sequence of the downstream primer is: GGGCGGTGAGCAGTTCATA; the nucleic acid sequence of the fluorescent probe is: CCACAGCAGCCATCTACATCTGTCAA; For detecting human herpes virus type 7, the nucleic acid sequence of the upstream primer is: AGACATCTTACACGACAGCAT; the nucleic acid sequence of the downstream primer is: GCTTTTCGAACTTGTCACCT; the nucleic acid sequence of the fluorescent probe is: TACATGTTCTTTGTAAAACTATT; For the detection of Streptococcus suis, the nucleic acid sequence of the upstream primer is: TTACTTGCTACTTTTGATGGAAATT; the nucleic acid sequence of the downstream primer is: CACCTCTTTTATCTCTTCCAA; the nucleic acid sequence of the fluorescent probe is: AAGAATCTGAGCTGCAAAAGTGTCAAATT; For the examination of intracellular mycobacterium, the nucleic acid sequence of the upstream primer is: GTGAGTAACACGTGGGCAA; the nucleic acid sequence of the downstream primer is: CACCTAAAGACATGCGCCTAA; the nucleic acid sequence of the fluorescent probe is: CACTTCGGGATAAGCCTGGGAA; For the examination of Nocardia Gelsenkirchen, the nucleic acid sequence of the upstream primer: CGTCTGTGCCACACTTTCG; the nucleic acid sequence of the downstream primer: CTGGTCAGCGTTGGTTCTC; the nucleic acid sequence of the fluorescent probe: GCCGCGACAGCACGTCT; For detecting adenovirus type 3, the nucleic acid sequence of the upstream primer is: GAGACAATATTACTAAAGAAGGTTTGC; the nucleic acid sequence of the downstream primer is: ACTTGAGGCTCTGGCTGATA; the nucleic acid sequence of the fluorescent probe is: CTACTGAAGGAGAAGAAAAGCCCATTTATGCC; For detecting adenovirus type 4, the nucleic acid sequence of the upstream primer is: GCCAACCTGTGGAGKAAC; the nucleic acid sequence of the downstream primer is: GTTGGCCGGTGTGTATTTG; the nucleic acid sequence of the fluorescent probe is: STATGCCAATGTTGCCCTCTATTTGCCT; For detecting adenovirus type 7, the nucleic acid sequence of the upstream primer is: GGAGCCAGATATTGATATGGAATT; the nucleic acid sequence of the downstream primer is: TTGACATTTTCCGTGTAAAGCA; the nucleic acid sequence of the fluorescent probe is: AGCTGCTGACGCTTTTTCGCCTGA; For detecting adenovirus type 21, the nucleic acid sequence of the upstream primer is: CTGCTATGGGTCTTTTGC; the nucleic acid sequence of the downstream primer is: GTTGTTCAGTAGTTTTTTGTTTTG; the nucleic acid sequence of the fluorescent probe is: ACCCACTAACGTCAAAGGCGGACAG; For the detection of Hantavirus, the nucleic acid sequence of the upstream primer is: TCAGTCACAGTCTAGTCAAAA; the nucleic acid sequence of the downstream primer is: GATTCTTCCACCATTTTGTGTT; the nucleic acid sequence of the fluorescent probe is: CACTGAAGTTGACTTGAAAGG; For checking mecA, the nucleic acid sequence of the upstream primer is: CCACCCAATTTGTCTGCC; the nucleic acid sequence of the downstream primer is: ATGGTATGCAACAAGTCGTAAA; the nucleic acid sequence of the fluorescent probe is: TTGTTTCATTTTGAGTTCTGCAGTACC; For checking bla KPC, the nucleic acid sequence of the upstream primer is: TACCACGTTCCGTCTGG; the nucleic acid sequence of the downstream primer is: AGCCCAGTGTCAGTTTT; the nucleic acid sequence of the fluorescent probe is: TCCCAGGCGATGCGCGCGATAC; For the examination of NDM, the nucleic acid sequence of the upstream primer is: TTGATCGTCAGGGATGGC; the nucleic acid sequence of the downstream primer is: AGGTTGATCTCCTGCTTGAT; the nucleic acid sequence of the fluorescent probe is: TGGTCGATACCGCCTGGACC; For checking OXA-48, the nucleic acid sequence of the upstream primer is: TATCGCCACTTGGAATCGC; the nucleic acid sequence of the downstream primer is: ATAATCGAAAGCATGTAGCATC; the nucleic acid sequence of the fluorescent probe is: GCCCGCCAAATTGGCGAG; For checking VIM, the nucleic acid sequence of the upstream primer is: GCGGAGATTGAGAAGCAA; the nucleic acid sequence of the downstream primer is: GCCGCCCGAAGGACAT; the nucleic acid sequence of the fluorescent probe is: GGACTTCCTGTAACGCGTGCA; For checking IMP, the nucleic acid sequence of the upstream primer is: TTTGTGGAGCGTGGCTAT; the nucleic acid sequence of the downstream primer is: CATTTGTTAATTCAGATGCATACG; the nucleic acid sequence of the fluorescent probe is: GGCAGCATTTCCTCTCATTTTCATAG; For checking vanA, the nucleic acid sequence of the upstream primer: AAATCAACCATGTTGATGTAGCA; the nucleic acid sequence of the downstream primer: AGGGATACCGGACAATTCAAA; the nucleic acid sequence of the fluorescent probe: AGCTTTGCATGGCAAGTCAGGTG; For checking ampC, the nucleic acid sequence of the upstream primer is: AAATCAGCCGATTCGAGTTAA; the nucleic acid sequence of the downstream primer is: TGTCGATTTGACGCCATATG; the nucleic acid sequence of the fluorescent probe is: GCCCACTCGATGCCCCT; For checking OXA-23, the nucleic acid sequence of the upstream primer is: ACTAGGAGAAGCCATGAAG; the nucleic acid sequence of the downstream primer is: ATGAGATCAAGACCGATAC; the nucleic acid sequence of the fluorescent probe is: CCAGTCTATCAGGAACTTGCGCG; For checking SHV, the nucleic acid sequence of the upstream primer is ACGGTCGGCGAACTCT; the nucleic acid sequence of the downstream primer is GATTGGCGGCGCTGTT; the nucleic acid sequence of the fluorescent probe is CCGCCATTACCATGAGCGA; For the examination of MCR-1, the nucleic acid sequence of the upstream primer is: GTTTGTTCTTGTGGCGAG; the nucleic acid sequence of the downstream primer is: GATTGTCCGCGATGGGAT; the nucleic acid sequence of the fluorescent probe is: CCGTTTTCTTGACCGCGACCGC.

2. The multiplex fluorescent PCR kit according to claim 1, characterized in that: The packaging specification of the primers and fluorescent probes used to detect target pathogenic microorganisms and drug-resistant genes is 192μL*24 test tubes; the packaging specification of the PCR reaction premix is ​​1000μL*6 test tubes; the packaging specification of the positive quality control product is 1000μL*3 test tubes; the packaging specification of the negative quality control product is 1000μL*3 test tubes.

3. The multiplex fluorescent PCR kit according to claim 2, characterized in that: The 24 test tubes for detecting the target pathogenic microorganisms and the primers and fluorescent probes for drug resistance genes are 3 rows of 8 tubes, which are respectively used for detecting: The A1 test tube detects Staphylococcus aureus, Streptococcus pneumoniae, Enterococcus faecalis and Enterococcus faecium; the B1 test tube detects Mycoplasma pneumoniae, Mycobacterium avium complex and Stenotrophomonas maltophilia; the C1 test tube detects Legionella pneumophila, Moraxella catarrhalis, Pseudomonas aeruginosa and Acinetobacter baumannii; the D1 test tube detects Haemophilus influenzae, Escherichia coli, Klebsiella pneumoniae and Epstein-Barr virus; the E1 test tube detects Aspergillus fumigatus, Aspergillus flavus, human cytomegalovirus and influenza A virus; the F1 test tube detects Candida albicans, Candida tropicalis, Tropical whipple and human bocavirus; the G1 test tube detects Mycobacterium tuberculosis, new coronavirus, influenza B virus and human metapneumovirus; the H1 test tube detects Chlamydia psittaci, rhinovirus, internal reference gene and respiratory syncytial virus; The A2 test tube detects Listeria monocytogenes, Streptococcus pyogenes, Streptococcus agalactiae and Mycobacterium chelonae; the B2 test tube detects Nocardia asteroides, Fusobacterium nucleatum, Orientia tsutsugamushi and Bartonella henselae; the C2 test tube detects Burkholderia mallei, Neisseria meningitidis, Salmonella enterica and Proteus mirabilis; The D2 test tube detects Burkholderia cepacia, Serratia marcescens, Klebsiella aerogenes, and Nocardia mallei; the E2 test tube detects Aspergillus niger, Aspergillus terreus, Brucella melitensis, and Morganella morganii; The F2 test tube detects Candida glabrata, Candida parapsilosis, Mycoplasma hominis, and Chlamydia trachomatis; the G2 test tube detects Candida krusei, Candida dubliniensis, Chlamydia pneumoniae, and Treponema pallidum; the H2 test tube detects Cryptococcus neoformans, Trichosporon asahii, Bacteroides fragilis, and Brucella; The A3 test tube detects Talaromyces marneffei, Pneumocystis jiroveci, Bordetella pertussis, and Aeromonas hydrophila; the B3 test tube detects Rhizopus microsporus, Fusarium spp., Citrobacter freundii, and Nocardia caviae; the C3 test tube detects human herpesvirus-1, human herpesvirus-2, human herpesvirus-3 (VZV), and human herpesvirus-6; the D3 test tube detects human herpesvirus-7, Streptococcus suis, Mycobacterium intracellulare, and Nocardia gelsenkirchen; the E3 test tube detects adenovirus-3, adenovirus-4, adenovirus-7, and adenovirus-21; the F3 test tube detects hantavirus, mecA, bla KPC, and NDM; the G3 test tube detects OXA-48, VIM, IMP, and vanA; and the H3 test tube detects ampC, OXA-23, SHV, and MCR-1; Among them, the primer-probe ratios of different targets in the H1 test tube are as follows: the upstream primer and downstream primer of Chlamydia psittaci are both 0.4 μM, and the fluorescent probe is 0.2 μM; the upstream primer and downstream primer of rhinovirus are both 0.4 μM, and the fluorescent probe is 0.2 μM; the upstream primer and downstream primer of the internal reference gene are both 0.3 μM, and the fluorescent probe is 0.1 μM; the upstream primer and downstream primer of respiratory syncytial virus are both 0.4 μM, and the fluorescent probe is 0.2 μM; Among them, the primer-probe ratios of different targets in the D3 test tube are as follows: the upstream primer and downstream primer of human herpesvirus type 7 are both 0.4 μM, and the fluorescent probe is 0.2 μM; the upstream primer and downstream primer of Streptococcus suis are both 0.4 μM, and the fluorescent probe is 0.2 μM; the upstream primer and downstream primer of Mycobacterium intracellulare are both 0.6 μM, and the fluorescent probe is 0.3 μM; the upstream primer and downstream primer of Nocardia Gelsenkirchen are both 0.4 μM, and the fluorescent probe is 0.2 μM; In the other tubes except H1 detection tube and D3 detection tube, the upstream primer and downstream primer of different targets are 0.4 μM, and the fluorescent probe is 0.2 μM.

4. The multiplex fluorescent PCR kit according to claim 1 or 2, characterized in that: The PCR reaction premix includes buffer, magnesium ions, potassium ions, ammonium sulfate, glycerol, dNTP, dUTP, reverse transcriptase, high temperature resistant Taq DNA polymerase, and UDG enzyme; the negative quality control product is nuclease-free water.

5. The multiplex fluorescent PCR kit according to claim 1 or 2, characterized in that: The PCR reaction premix solution also includes at least one of polyvinyl alcohol-polylysine polymer, polyvinyl alcohol, trehalose, and trehalose polymer.

6. The multiplex fluorescent PCR kit according to claim 5, characterized in that: The preparation method of the polyvinyl alcohol-polylysine polymer comprises the following steps, measured by weight: S1. Add 1.2-1.4 parts of succinic anhydride to 8-12 parts of a 25-30wt% ε-polylysine aqueous solution, mix and stir at 45-55°C for 1.5-3h to obtain a mixed solution A; then pour the mixed solution A into a dialysis bag, dialyze with water for 22-25h, then freeze-dry for 22-25h, and then vacuum dry at 55-65°C for 15-20h to obtain carboxylated ε-polylysine; S2. Dissolve 0.9-1.1 parts of polyvinyl alcohol in water and stir at 55-65°C for 1.5-2.5 hours; then add 1-1.2 parts of 1,1'-carbonyldiimidazole and continue stirring for 1.5-2.5 hours to obtain a mixed solution B; then add 0.9-1.1 parts of carboxylated ε-polylysine to the mixed solution B, mix and stir at 55-65°C for 3-5 hours to obtain a mixed solution C, then pour the mixed solution C into a dialysis bag, dialyze with water for 2.5-3.5 days, dry in an oven after dialysis for 22-25 hours, and then vacuum dry at 55-65°C for 15-20 hours to obtain a polyvinyl alcohol-polylysine polymer.

7. The multiplex fluorescent PCR kit according to claim 5, characterized in that: The preparation method of the trehalose polymer comprises the following steps, calculated by weight: Dissolve 3.5-4.2 parts of trehalose and 1.7-2 parts of sodium hydroxide in 8-12 parts of water, place at 65-75°C and mix and stir for 25-35 minutes to obtain a transparent viscous liquid; then add 3.2-3.3 parts of epichlorohydrin to the liquid and mix, let stand at room temperature for 45-50 hours to obtain a mixed solution; then adjust the pH value of the mixed solution to 7-7.5 with hydrochloric acid, then pour the solution into a dialysis bag, dialyze with water for 2.5-3 days, and freeze-dry under vacuum after dialysis to obtain trehalose polymer.

8. A multiplex fluorescence PCR detection method for simultaneously detecting multiple pathogenic microorganisms and drug-resistant genes as described in any one of claims 1 to 7, characterized in that: The steps include: (1) Nucleic acid template extraction: extract and purify the nucleic acid in the sample to obtain the nucleic acid template; (2) Preparing a multiplex fluorescent PCR reaction solution: preparing a PCR reaction premix; mixing the nucleic acid template obtained in step 1 with the PCR reaction premix, primers and fluorescent probes, and ddH2O to obtain a multiplex fluorescent PCR reaction solution; (3) Add the multiplex fluorescent PCR reaction solution in step (2) to a 96-well plate and perform the reaction on a fluorescent quantitative PCR instrument; (4) Data analysis: Use a fluorescent quantitative PCR instrument to monitor the changes in the fluorescence signal of each fluorescent channel in each well, and record the Ct value based on the amplification curve; (5) Report interpretation: Based on the Ct value, determine the qualitative results of each detection target in the sample.

9. The detection method according to claim 8, characterized in that: The multiplex fluorescent PCR reaction solution in step (2) includes 4 μL of PCR reaction premix, 4 μL of primers and fluorescent probes, 10 μL of ddH2O and 2 μL of nucleic acid template, and the total reaction system is 20 μL.

Images