A dCAPS molecular marker related to strong female character of chieh-qua and application thereof

By developing dCAPS molecular markers Sgy_317 and Sgy_416 associated with strong female characteristics in Cucurbita moschata, and utilizing PCR amplification and gel electrophoresis techniques, the problem of difficulty in screening for strong female characteristics in Cucurbita moschata in existing technologies was solved, thereby improving breeding efficiency and seed purity.

CN119351611BActive Publication Date: 2025-11-18SOUTH CHINA AGRICULTURAL UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411742192.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-29
Publication Date
2025-11-18
Estimated Expiration
2044-11-29

AI Technical Summary

Technical Problem

No molecular markers associated with the strong female trait of wax gourd have been found in the existing technology, which leads to problems such as high cost of hybridization breeding, low seed purity, and long breeding cycle.

Method used

The dCAPS molecular markers Sgy_317 and Sgy_416 associated with the strong female trait of wax gourd were developed. These molecular markers were used for PCR amplification and genotyping. The amplification products were detected by 6% polyacrylamide gel electrophoresis, and strong female wax gourds were screened out.

Benefits of technology

This technology enables precise screening of strongly female wax gourds, improving breeding efficiency, reducing breeding costs, and simplifying seed production procedures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119351611B_ABST
    Figure CN119351611B_ABST
Patent Text Reader

Abstract

The application discloses a dCAPS molecular marker related to a strong female character of chiehqua and application thereof and belongs to the technical field of molecular biology. In the application, fine positioning is carried out on a strong female gene of chiehqua based on BSA-seq, and finally, the strong female gene site is narrowed to 51.08Kb of Chr08, and only one gene (Bch08G003160) is contained. Sequence alignment finds that there are two base site deletions in the coding region of the gene, namely, G base of SNP_317 (Chr08, 14,693,253bp) and C base of SNP_416 (Chr08, 14,693,154bp), and the deletion of the two position bases leads to an early termination codon. Meanwhile, dCAPS markers for screening the strong female character, namely, Sgy_317SNP-dCAPS and Sgy_416SNP-dCAPS, are developed at the deletion positions of the two base sites. The two pairs of markers can be used for accurately screening the strong female chiehqua, and the breeding efficiency is greatly improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a dCAPS molecular marker associated with the strong female trait of Cucurbita moschata and its applications. Background Technology

[0002] Hairy gourd, also known as winter melon or winter squash, is a variety of winter melon in the Cucurbitaceae family. It is widely cultivated in southern China and is characterized by its small size, delicate flesh, mild flavor, and the fact that the fruit can be eaten at any stage of ripeness. It is one of my country's distinctive vegetables.

[0003] The diversity of sex types in cucurbit crops makes them ideal model plants for studying sex differentiation traits. Among the various sex types of cucurbits, wax gourd can be classified as monoecious, hermaphroditic, or semi-hermaphroditic. The strongly female type, in particular, has a very high female rate, exceeding 80%. This unique characteristic not only helps increase yield but also simplifies seed production procedures, accelerates the breeding cycle, and reduces investment costs. While research on strongly female traits has been conducted on some cucurbitaceous crops, no studies have been reported on strongly female characteristics in wax gourd. Developing molecular markers related to strongly female characteristics in wax gourd is of great significance for reducing the cost of hybrid breeding and improving the purity of hybrid seeds. Summary of the Invention

[0004] To address the above problems, this invention provides a dCAPS molecular marker associated with the strong female trait of Cucurbita moschata and its application. The technical solution adopted by this invention is as follows:

[0005] A dCAPS molecular marker associated with the strong female trait of Cucurbita moschata, the dCAPS molecular marker comprising Sgy_317 and Sgy_416, wherein the SNP site for developing Sgy_317 is located at position 14,693,253 bp on chromosome 8 of Cucurbita moschata, and the SNP site for developing Sgy_416 is located at position 14,693,154 bp on chromosome 8 of Cucurbita moschata; the SNP site of Sgy_317 has a G base deletion, and the SNP site of Sgy_416 has a C base deletion.

[0006] Furthermore, if there is a deletion of a G base at 14,693,253bp on chromosome 8 of the wax gourd, or a deletion of a C base at 14,693,154bp on chromosome 8 of the wax gourd, then it is a strongly female wax gourd.

[0007] Furthermore, the characteristic primer pair for Sgy_317 is Sgy_317SNP-dCAPS, and the characteristic primer pair for Sgy_416 is Sgy_416SNP-dCAPS.

[0008] Furthermore, the upstream primer sequence of Sgy_317SNP-dCAPS is shown in SEQ ID NO.1, and the downstream primer sequence of Sgy_317SNP-dCAPS is shown in SEQ ID NO.2.

[0009] Furthermore, the upstream primer sequence of Sgy_416SNP-dCAPS is shown in SEQ ID NO.3, and the downstream primer sequence of Sgy_416SNP-dCAPS is shown in SEQ ID NO.4.

[0010] This invention also provides a method for detecting the strong female trait in *Cucurbita moschata*, based on the dCAPS molecular marker associated with the strong female trait in *Cucurbita moschata* as described in any of the above-mentioned claims, the method comprising:

[0011] Extract DNA from the wax gourd to be tested;

[0012] Using the DNA of the target wax gourd as a template, PCR amplification was performed using the characteristic primer pair of Sgy_317 and the characteristic primer pair of Sgy_416 to obtain the amplification product.

[0013] Identify the gene type of the amplified product to determine whether the wax gourd is a strongly female wax gourd.

[0014] Further, identifying the gene type of the amplified product includes:

[0015] The gene type of the amplified product was identified using a 6% polyacrylamide gel.

[0016] Furthermore, the sequence of the PCR amplification product of the characteristic primer pair Sgy_317SNP-dCAPS is shown in SEQ ID NO.5.

[0017] Furthermore, the sequence of the PCR amplification product of the characteristic primer pair Sgy_416SNP-dCAPS is shown in SEQ ID NO.6.

[0018] Furthermore, the present invention also provides the application of the method for detecting the strong female trait of wax gourd described in any of the above-mentioned methods in wax gourd-assisted breeding.

[0019] Based on the above technical solution, the present invention has the following technical effects: The present invention provides a dCAPS molecular marker associated with the strong female trait of *Cucurbita edulis* and its application. The dCAPS marker is located at positions 14,693,246 and 14,693,148 on chromosome 8 of *Cucurbita edulis*, with a deletion of a G base at position 14,693,253 bp or a deletion of a C base at position 14,693,154 bp. Simultaneously, dCAPS markers for screening strong female *Cucurbita edulis*, namely Sgy_317 and Sgy_416, were developed at the above two positions. The SNP site for developing Sgy_317 is position 14,693,253 bp on chromosome 8 of *Cucurbita edulis*, and the characteristic primer pair corresponding to Sgy_317 is Sgy_317SNP-dCAPS. The SNP locus used to develop Sgy_416 is located at positions 14,693,154 bp on chromosome 8 of *Cucurbita moschata*, and the corresponding characteristic primer pair for Sgy_416 is Sgy_416SNP-dCAPS. In this invention, genes related to the strong female trait in *Cucurbita moschata* were precisely mapped. The G base deletion at position 317 of the Bch08003160 coding region and the C base deletion at position 416 of the Bch08003160 coding region are closely related to the strong female trait in *Cucurbita moschata*. Using these two characteristic primer pairs, strong female *Cucurbita moschata* can be precisely screened, thereby improving breeding efficiency. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The phenotypic characteristics of the parents are as follows: the strong female maternal parent J16 (P1) and the strong male paternal parent FJ5 ​​(P2).

[0022] Figure 2 The genetic mapping of the strong female gene in wax gourd is shown in Figure a. Figure a is the BSASeq mapping of the strong female gene in wax gourd; Figure b is the preliminary genetic mapping of the strong female gene in wax gourd; and Figure c is the fine mapping of the strong female gene in wax gourd.

[0023] Figure 3 Genotyping results of 30 strongly female plants in the F2 population using the Sgy_317SNP-dCAPS marker;

[0024] Figure 4 Genotyping results of 30 strongly female plants in the F2 population using the Sgy_416SNP-dCAPS marker;

[0025] Figure 5Genotyping results of 32 different *Cucumis melo* materials using Sgy_317SNP-dCAPS combined with Sgy_416SNP-dCAPS markers;

[0026] Figure 6 The typing results of 21 different wax gourd materials were obtained by using Sgy_317SNP-dCAPS and Sgy_416SNP-dCAPS tags. Detailed Implementation

[0027] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc., used in the embodiments of the present invention are commercially available; unless otherwise specified, all technical means in the embodiments of the present invention are conventional means well known to those skilled in the art.

[0028] Example 1

[0029] Experimental materials: Using the inbred line J16(P1) of wax gourd as the female parent and FJ5(P2) as the male parent, the F1 generation of J16 × FJ5 was obtained through artificial isolation, and then the F1 generation was self-pollinated to obtain the F2 population. The female flower rate of J16 was 95.45 (±1.35)%; the female flower rate of FJ5 was 16.67 (±1.35)%. All materials were multi-generation stable inbred lines of wax gourd provided by Guangzhou Academy of Agricultural Sciences. The method for calculating the female flower rate was: number of nodes with female flowers / total number of flowering nodes × 100%.

[0030] The mapping of genes for strong female traits included the following steps: statistical analysis of female flower rates in the parents, F1, and F2 plants. Results showed that the average female flower rate of the strong female parents was 95.45% (±3.1)%, while the average female flower rate of the strong male parents was 16.67% (±1.3)%. The female flower rate of the F1 population was between that of the two parents, averaging 37.5% (±2.7)%, and was generally closer to that of the strong male parents.

[0031] In the F2 generation population, traits showed segregation and a bimodal distribution, indicating quantitative trait characteristics. Subsequently, 25 plants from each generation were selected to construct extreme mixed pools, and a region above the threshold was found on Chr08, with a total length of 2.64 Mb. Figure 2 a).

[0032] Based on BSA-seq results, multiple pairs of Indel markers were designed within the Sgy_3-Sgy_6 interval. The results were validated on 363 F2 plants, and the strong female gene of *Cucumis melo* was preliminarily located within the Sgy_3-Sgy_6 (14,554,914–15,050,000) interval, which is approximately 495 kb in size. Figure 2 b).

[0033] Following the initial localization, Indel markers were subsequently developed to genotype 2741 F2 individuals. By combining phenotype and genotype, the region was ultimately narrowed down to a size of 51.08 kb. Figure 2 c) This region contains only one gene (Bch08G003160), with the gene annotation MYB62. Therefore, it is speculated that Bch08G003160 is an important candidate gene for the strong female trait in wax gourd.

[0034] Table 1. InDel primer pairs used for fine mapping of the efficacy gene in *Cucumis melo*.

[0035]

[0036]

[0037] Note: S_1 is the primer sequence used in Sanger sequencing.

[0038] Subsequently, the cDNA sequence of this gene was extracted from the genome of *Cucurbita stenoptera*, amplified, and cloned. It was found that compared to the paternal parent FJ5, the maternal parent J16 had a deletion of one C base at position 416, and the dCAPS molecular marker at this position was named Sgy_416. Subsequently, in another strongly female material (17045), a deletion of one G base (G) at position 317 was found, and the dCAPS molecular marker at this position was named Sgy_317. Finally, the amino acid sequence of Bch08G003160 was analyzed, and the results showed that the deletion of either a G or C base led to a frameshift mutation, prematurely forming a stop codon. Based on the variation sites among candidate genes, dCAPS primers were developed and endonucleases were selected using the dCAPS website (http: / / helix.wustl.edu / dcaps / dcaps.html). Primers for the other end were designed using Primer 5.0 software based on the given upstream and downstream primers for screening strongly female *Cucurbita stenoptera*.

[0039] As shown in Table 2, the specific primer sequences are as follows:

[0040] The upstream primer sequence of SEQ ID NO.1Sgy_317SNP-dCAPS:

[0041] TTGCACAACATTTACCGGTAGAAC

[0042] The downstream primer sequence of SEQ ID NO.2Sgy_317SNP-dCAPS:

[0043] GGGAGGAGTTGGAGGATTGGTC

[0044] The upstream primer sequence of SEQ ID NO.3Sgy_416SNP-dCAPS:

[0045] AGGAGATTTTCGGACTCAGTG

[0046] The downstream primer sequence of SEQ ID NO.4Sgy_416SNP-dCAPS:

[0047] AGTTTCCGACGTGTTCGGTA

[0048] The sequence of the PCR amplification product of SEQ ID NO.5Sgy_317SNP-dCAPS:

[0049] TTGCACAACATTTACCGGTAGAACGGATAACGAAATCAAGAACTACTGGAGAACGAGAGTTCAAAAACAGTCACGGCAGCTTAAAGTTGAGGCAGACAGCAGGAGATTTTCGGACTCGAGTGTGCTAGAAGCCATGGACCAATCCTCCAACTCCTCCC

[0050] The sequence of the PCR amplification product of SEQ ID NO.6Sgy_416SNP-dCAPS:

[0051] AGGAGATTTTCGGACTCAGTGTGCTAGAAGCCATGGACCAATCCTCCAACTCCTCCCTCAATTTTCCTCTCCATCTCTCCACAACACAACCTTACCGAACACGTCGGAAACT

[0052] Table 2 dCAPS primer pairs

[0053]

[0054]

[0055] Note: Bold text indicates mismatch.

[0056] Two pairs of dCAPS molecular markers were used to validate the strong female characteristics of 30 F2 plants and 53 different germplasm of wax gourd (including 11 strong female materials and 42 male materials). All materials were from the Guangzhou Academy of Agricultural Sciences.

[0057] DNA extraction was performed using the hexadecyltrimethylammonium bromide (CTAB) method, the specific method being as follows:

[0058] (1) Take the leaf and put it into a 2mL centrifuge tube, add 700μL CTAB lysis buffer and 2 grinding beads, and put it into an automatic grinder for crushing. The program is set to 65Hz and 120s.

[0059] (2) After grinding, transfer the 2mL centrifuge tube to a constant temperature metal bath and keep it at 65℃ for 25min. During this period, invert the tube once every 8min. After mixing, centrifuge at 4℃ and 12,000rpm for 8min.

[0060] (3) After cooling slightly, add an equal volume of chloroform and invert.

[0061] (4) Transfer the supernatant to a new 1.5 cm centrifuge tube, add an equal volume of isopropanol, gently invert to mix, and place at -20°C for 20 min.

[0062] (5) After centrifuging at 12,000 rpm for 5 min, discard the supernatant, add 600 μL of 75% ethanol, wash the DNA precipitate twice by inverting the container, and then air dry.

[0063] (6) Add 50 μL of 1×TE to the centrifuge tube to dissolve the DNA.

[0064] (7) After the DNA is dissolved, add RNase and incubate in a 37°C metal bath for 40 minutes to remove residual RNA. Finally, store the DNA solution in a -20°C refrigerator.

[0065] PCR amplification using dCAPS

[0066] PCR reaction mixture (10 μL): 5.0 μL Mix (2×), 1.0 μL forward primer, 1.0 μL reverse primer, 1.0 μL DNA, 2.0 μL ddH2O

[0067] PCR program: Pre-denaturation, 95℃, 3 min; Denaturation, 95℃, 30 s; Annealing, 55-58℃, 30 s; Extension, 72℃, 30 s; Steps 2-4, 34 cycles; Extension, 72℃, 5 min; Storage, 12℃, ∞.

[0068] Enzyme digestion system: PCR product, 1 μL; 10×NE Buffer, 1 μL; enzyme, 0.2 μL; Nuclease-Free Water, 7.8 μL.

[0069] Enzyme digestion conditions: 37℃, 15 min; 65℃, 20 min.

[0070] This experiment used 6% polyacrylamide gel electrophoresis to detect PCR products. The specific steps are as follows:

[0071] Gel preparation requires 80 mL of 6% acrylamide solution, 640 μL of 12% ammonium persulfate, and 32 μL of TEMED. These three solutions are rapidly mixed and poured into a composite glass plate with an agarose-sealed bottom. The comb is inserted, and the gel is allowed to stand at room temperature for approximately half an hour until it solidifies. Then, the comb is gently removed from the gel, and the sample wells are rinsed under running water. Pairs of electrophoresis plates are fixed to both sides of the electrophoresis tank, TBE buffer is poured in, and 1 μL of PCR product is injected into the gel wells using a micropipette. The electrophoresis apparatus voltage is set to 300V, and the electrophoresis time is adjusted according to the size of the amplified product. After electrophoresis, photos are taken and the data recorded.

[0072] Results: (1) The 30 strongly female materials in F2 were genotyped using the Sgy_317SNP-dCAPS marker. The genotyping results are as follows: Figure 3 As shown, the genotypes of the 30 F2 lines differed from those of the strong female material 17045, but were consistent with those of the parents (FJ5 and J16).

[0073] (2) The 30 strongly female materials in F2 were genotyped using the Sgy_416SNP-dCAPS marker. The genotyping results are as follows: Figure 4 As shown, the 30 F2 maternal parents (J16) had the same genotype.

[0074] (3) Figure 5 As shown, genotyping of 32 wax gourd materials was performed using two pairs of markers. The Sgy_416SNP-dCAPS marker screened out 3 strong female materials that were consistent with the maternal parent J16 genotype.

[0075] (4) Figure 6 As shown, genotyping of 21 wax gourd materials was performed using two pairs of markers. The Sgy_317SNP-dCAPS marker screened out 8 strong female materials that were consistent with the genotype 17045.

[0076] The above results indicate that genotyping of 30 F2 single plants using Sgy_416SNP-dCAPS achieved 100% accuracy. Of the 53 *Cucurbita hirsuta* materials, 3 shared the same genotype as the maternal parent J16, and 8 shared the same genotype as 17045. In conclusion, using the two specific primer pairs Sgy_317SNP-dCAPS and Sgy_416SNP-dCAPS can screen for strongly female *Cucurbita hirsuta* with 100% accuracy. A deletion of either a G base at 14,6932,53 bp or a C base at 14,693,154 bp on chromosome 8 indicates a strongly female *Cucurbita hirsuta*. Using the dCPAS markers and primers developed in this study, strongly female *Cucurbita hirsuta* can be screened more quickly based on genotype, significantly improving breeding efficiency and demonstrating significant application value.

[0077] It is understood that the above embodiments only illustrate preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can freely combine the above technical features without departing from the concept of the present invention, and can also make several modifications and improvements, all of which fall within the protection scope of the present invention. Therefore, all equivalent transformations and modifications made with respect to the scope of the claims of the present invention should fall within the scope of the claims of the present invention.

Claims

1. The application of a dCAPS molecular marker associated with strong femaleness in *Cucumis melo* in assisted breeding of *Cucumis melo* with strong femaleness, characterized in that... The dCAPS molecular markers include Sgy_317 and Sgy_416. The SNP site for developing Sgy_317 is located at position 14,693,253 bp on chromosome 8 of *Cucurbita moschata*, and the SNP site for developing Sgy_416 is located at position 14,693,154 bp on chromosome 8 of *Cucurbita moschata*. The SNP site of Sgy_317 has a G base deletion, and the SNP site of Sgy_416 has a C base deletion. If there is a deletion of a G base at position 14,693,253 bp on chromosome 8 of the wax gourd, and a deletion of a C base at position 14,693,154 bp on chromosome 8 of the wax gourd, then it is a strongly female wax gourd.

2. The application according to claim 1, characterized in that, The characteristic primer pair for Sgy_317 is Sgy_317SNP-dCAPS, and the characteristic primer pair for Sgy_416 is Sgy_416SNP-dCAPS. The upstream primer sequence of Sgy_317SNP-dCAPS is shown in SEQ ID NO.1, and the downstream primer sequence of Sgy_317SNP-dCAPS is shown in SEQ ID NO.

2. The upstream primer sequence of Sgy_416SNP-dCAPS is shown in SEQ ID NO.3, and the downstream primer sequence of Sgy_416SNP-dCAPS is shown in SEQ ID NO.

4.

3. A method for detecting strong female trait in wax gourd, characterized in that, Based on the application according to any one of claims 1-2, the method includes: extracting DNA from the wax gourd to be tested; using the wax gourd DNA as a template, performing PCR amplification using characteristic primer pairs of Sgy_317 and Sgy_416 to obtain amplification products; identifying the gene type of the amplification products to determine whether the wax gourd is a strongly female wax gourd.

4. The method for detecting strong female trait in Cucurbita japonica according to claim 3, characterized in that, The identification of the gene type of the amplified product includes: identifying the gene type of the amplified product using a 6% polyacrylamide gel by mass.

5. The method for detecting strong female trait in Cucurbita japonica according to claim 3, characterized in that, The sequence of the PCR amplification product of the characteristic primer pair Sgy_317SNP-dCAPS of Sgy_317 is shown in SEQ ID NO.

5.

6. The method for detecting strong female trait in Cucurbita japonica according to claim 3, characterized in that, The sequence of the PCR amplification product of the characteristic primer pair Sgy_416SNP-dCAPS of Sgy_416 is shown in SEQ ID NO.

6.

7. The application of the method for detecting strong female traits in Cucurbita moschata according to any one of claims 3-6 in assisted breeding related to strong female traits in Cucurbita moschata.

Citation Information

Patent Citations

  • KASP molecular marker, primer and screening method of all-female chieh-qua

    CN115125325A

  • CAPS marker of chieh-qua strong female character and application of CAPS marker

    CN118773374A