Nucleic acid isothermal amplification kit for detecting bovine rotavirus and detection method thereof

Abstract

The invention relates to a nucleic acid isothermal amplification kit for detecting bovine rotavirus and a detection method thereof, the kit contains a primer probe combination, the primer sequence is shown as SEQ ID NO: 1-SEQ ID NO: 6, the probe sequence is shown as SEQ ID NO: 7, the kit containing the primer probe combination is adopted to construct a reaction system, the optimal reaction condition and the optimal primer pair are determined, and the kit is used for detecting the bovine rotavirus. Meanwhile, a method for detecting the bovine rotavirus based on real-time RT-MIRA is established and optimized, and the method is rapid in detection, high in sensitivity, good in specificity, easy to operate and low in cost and has important research significance and application value in bovine rotavirus detection.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, in particular to the field of bovine rotavirus detection technology, and specifically to a nucleic acid isothermal amplification kit for detecting bovine rotavirus and a detection method thereof. Background Art

[0002] Bovine rotavirus (BRV) is an important factor causing calf diarrhea. Newborn calves are usually susceptible to infection, with a high morbidity rate and a mortality rate of about 50%. Currently, studies have shown that BRV can be isolated from the tissues of sick animals, and there is a complex relationship between the transmission modes of different species. The presence of the virus in any animal will lead to the spread of the virus. The high incidence rate, widespread distribution and serious harm of newborn calves after infection have caused immeasurable losses to the cattle industry and related industries.

[0003] BRV belongs to the Reoviridae family and the genus Rotavirus. The particles are spherical in appearance, with a size of about 80nm, no envelope, and short spike protein molecules attached to the surface. The nucleotide length of the total genome is approximately 18555bp, and the length of each nucleotide segment is basically between 669bp and 3305bp. The VP6 protein is a more conservative sequence in the BRV gene, and it is used as the preferred target in many studies at home and abroad. The VP6 protein is the main antigen and immunogen of BRV, and is the most critical structural protein to maintain the stability of virus particles. The VP7 protein plays an important role in the stability of the morphology and spatial configuration of rotavirus particles, and is closely related to the virulence and immune protection of the virus.

[0004] Rotavirus is divided into 7 groups, A to G, due to differences in antigens. Alam and Yang discovered a new type of rotavirus that does not belong to the A to G types. BRV is transmitted via the fecal-oral route, and group A is a typical rotavirus. Groups A to C are more commonly detected in most animals. Currently, there are 34 G types and 50 P types known to exist, and G6 and G18 are the most common strains in China.

[0005] At present, the cells used to isolate BRV mainly include MA-104 (rhesus monkey fetal kidney cells), Vero (African green monkey kidney cells), CaCo2 (human cloned cells), etc. Other group RVs cannot grow in these cell lines, but most group A RVs can be cultured in vitro. The participation of trypsin is a necessary factor for the in vitro isolation and culture of BRV. The difference from other common viruses is that when BRV infects cells, the appropriate concentration of trypsin plays a role in activating the virus, and the VP4 protein is broken down into VP5 and VP8, while exposing the binding site of BRV to achieve the purpose of in vitro replication and proliferation.

[0006] In the 1970s, BRV was discovered in calf feces. In 1973, Bishop discovered viral particles in the intestines of cattle in Australia. In 2008, Chang Jitao et al. isolated the G10 genotype of the virus for the first time in China, and tested more than 90 fecal samples from Anhui, Beijing and other regions with a positive rate of 12%. In 2016, Zhou Fang et al. tested 234 fecal samples collected in Qinghai and Tibet in 2016, and the results showed that BRV is also widely prevalent in western my country. In 2020, Jia Weiqiang et al. used the established SYBR Green I real-time fluorescence quantitative PCR technology to test several large-scale cattle farms in Heilongjiang Province with a positive rate of 36.4%. Bertonil et al. first discovered diarrhea in Argentine beef cattle caused by G15P in 2020. It can be seen that rotavirus is widely distributed worldwide.

[0007] BRV infection often occurs in the cold seasons of autumn and winter, and is usually secondary to viral diarrhea virus, coronavirus, salmonella, Escherichia coli, etc., and the cold weather can also cause lung diseases, leading to clinical symptoms such as coughing, sneezing, dyspnea, hypothermia, and even death in severe cases. BRV mainly infects calves within one month of age, and calves within one week of age are most susceptible. In the early stages of infection, symptoms include listlessness, dehydration diarrhea, loss of appetite, drooling, etc., and the excrement is basically yellow-white and soft feces. Severe symptoms include blood in the feces, mucus, and even yellow-brown watery feces. Within 24 hours after infection, intestinal epithelial cells are intact, the level of disaccharidase is reduced, and sugars in the body cannot be hydrolyzed and absorbed, resulting in osmotic diarrhea. It is extremely difficult to diagnose the cause of the disease only through clinical examination. Therefore, it is necessary to combine laboratory diagnosis to quickly and accurately detect the pathogen, which is crucial to inhibit the spread of the disease and reduce economic losses.

[0008] At present, electron microscopy technology includes direct electron microscopy and immunoelectron microscopy. Although it is fast and accurate, it is complicated to operate and has high requirements for operators and testing environment. Because of its many restrictions, it is not widely used in testing. The most common method of virus isolation is to inoculate fecal samples into cells to isolate viruses. It is difficult to operate, has low sensitivity and is time-consuming. ELISA is a method for rapid detection of pathogens. It can detect viruses in cell suspensions, feces, etc., and can also monitor population health. From 2010 to 2012, Madadgar et al. used this method to conduct epidemiological studies on BRV in 11 regions of Iran. Chang Jitao and others have achieved large-scale detection of bovine rotavirus in China in 2018; ELISA method has been widely used in epidemiological surveys and clinical testing of BRV because of its advantages of simplicity, rapidity, high sensitivity and large-scale testing; immunofluorescence technology has relatively high requirements for instruments and laboratory conditions, and is not suitable for practical application; RT-PCR technology is fast, highly sensitive, and time-saving, and is currently widely used in various regions; fluorescent quantitative PCR technology has high amplification efficiency and strong specificity, but has high primer requirements, the establishment of methods is relatively difficult, and has higher requirements on the level of operators and equipment; the HI test has high specificity and will not be affected by complex factors during sample testing, and has obvious advantages over the HA test; LAMP is fast, specific, and highly efficient at constant temperature, but it has high requirements for primer design, and opening the lid is prone to aerosol contamination, resulting in false positives.

[0009] Multienzyme Isothermal Rapid Amplification (RT-MIRA) technology is an isothermal amplification technology developed in recent years. Compared with loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and recombinase-mediated amplification technology (RAA), RT-MIRA has significant advantages and is a truly portable on-site rapid nucleic acid detection technology. RT-MIRA is inspired by simulating the self-repair process of nucleic acids in the body. It relies on multiple functional proteins to act simultaneously at room temperature to achieve rapid amplification of nucleic acids. It is a technology invented in China.

[0010] The recombinase isothermal amplification technology reacts quickly and can obtain results within 30 minutes. It is easy to operate and does not require a complex professional laboratory. Non-professionals can also complete sample testing. The sensitivity can reach 1 to 10 copies / reaction, and the primers are combined with fluorescent probes with high specificity. No complex instruments are required during amplification, and the reaction temperature is 25 to 42°C. It can be subsequently developed into rapid detection methods such as fluorescence detection and colloidal gold test paper to meet the needs of sites that do not have molecular detection technology and conduct on-site rapid nucleic acid testing of animal diseases.

[0011] In view of the current situation that the detection methods for bovine rotavirus are uneven, the detection equipment requirements are high, the detection time is long, and the detection sensitivity is poor, there is no relevant research involving the real-time RT-MIRA method for detecting bovine rotavirus. Summary of the invention

[0012] The purpose of the present invention is to provide a nucleic acid isothermal amplification kit and a detection method for detecting bovine rotavirus in order to address at least one of the shortcomings of the prior art, so as to solve the problems existing in the related art such as uneven bovine rotavirus detection methods, high requirements for detection equipment, long detection time, and poor detection sensitivity.

[0013] To achieve the above object, the technical solution adopted by the present invention is:

[0014] The first aspect of the present invention is to provide a primer-probe combination for detecting bovine rotavirus, wherein the primer-probe combination is designed for a conserved sequence of the VP6 full gene sequence of bovine rotavirus, and the conserved sequence is shown in SEQ ID NO:8.

[0015] Furthermore, the primer probe is used in a real-time RT-MIRA method.

[0016] Furthermore, the primer-probe combination includes primers with sequences shown in SEQ ID NO: 1 to SEQ ID NO: 6 and a probe with a sequence shown in SEQ ID NO: 7.

[0017] Furthermore, in the primer-probe combination, the primers include an upstream primer and a downstream primer, the upstream primer is selected from one of the sequences shown in SEQ ID NO: 1 to SEQ ID NO: 3, and the downstream primer is selected from one of the sequences shown in SEQ ID NO: 4 to SEQ ID NO: 6.

[0018] Furthermore, the upstream primer sequence is shown in SEQ ID NO:2.

[0019] Furthermore, the downstream primer sequence is shown in SEQ ID NO:4.

[0020] Furthermore, the probe is labeled with a FAM group at the 31st base T from the 5' end, the 32nd base A is replaced by tetrahydrofuran THF, the 33rd base T is labeled with a BHQ group, and the 3' end is modified with C3 spacer blocking.

[0021] The second aspect of the present invention is to provide a nucleic acid isothermal amplification kit for detecting bovine rotavirus, the kit comprising: the primer-probe combination as described in the first aspect.

[0022] Furthermore, the reaction system of the kit includes: 29.4 μL R Buffer, 2 μL upstream primer, 2 μL downstream primer, 0.6 μL probe, 2-13.5 μL nucleic acid template, 2.5 μL B Buffer, and ddH2O supplemented to 50 μL; wherein the concentration of the upstream primer is 10 μmol / L, the concentration of the downstream primer is 10 μmol / L, and the concentration of the probe is 10 μmol / L.

[0023] Furthermore, the reaction system also contains freeze-dried enzyme powder.

[0024] The third aspect of the present invention is to provide a method for detecting bovine rotavirus, comprising the following steps:

[0025] S1. Extract viral nucleic acid from samples;

[0026] S2. Perform real-time RT-MIRA amplification detection of viral nucleic acid using the primer-probe combination described in the first aspect or the kit described in the second aspect.

[0027] Furthermore, the viral nucleic acid extraction comprises the following steps:

[0028] Choose Thermo KingFisher TM AM1836 V2 program in MagMax Express instrument; insert the magnetic jacket into the instrument; add 150μL Buffer MW1 to the B / C wells, add 150μL Buffer MW2 to the D / E wells, add 90μL Nuclease Free Water to the F wells, and add 20μL magnetic beads / PK mixture, 50μL sample and 130μL Buffer MLB to the A wells; execute AM1836 V2 program, press Start, and the program ends in about 30 minutes; remove the elution tube, transfer the sample to a 1.5mL centrifuge tube, and store at -20℃ or -80℃.

[0029] Furthermore, the real-time RT-MIRA amplification detection comprises the following steps:

[0030] 1) Add the reaction system to the dry powder reaction tube containing the enzyme;

[0031] 2) The reaction tube containing the reaction system is centrifuged instantaneously and then placed in a constant temperature metal bath for incubation;

[0032] 4) After the incubation, take out the reaction system, mix well, and centrifuge instantly;

[0033] 5) Place the reaction tube into a constant temperature fluorescence detector for amplification.

[0034] Furthermore, the reaction conditions of the amplification are: constant temperature of 37-42° C., collecting fluorescence signals every 30 seconds, and reaction time of 10-30 minutes.

[0035] Furthermore, the reaction conditions of the amplification are: constant temperature of 42° C., collecting fluorescence signals every 30 seconds, and reaction time of 15 minutes.

[0036] Furthermore, the minimum detection concentration of the method is 1.80 copies / μL.

[0037] Furthermore, the test sample includes a stool sample.

[0038] In a specific embodiment, the specific operation of the real-time RT-MIRA amplification detection is as follows:

[0039] Add the reaction system to the dry powder reaction tube containing the enzyme, add 29.4μL R Buffer, 2μL upstream primer, 2μL downstream primer and 0.6μL probe to each reaction system, then add 2-13.5μL nucleic acid template to the reaction system respectively (can be adjusted according to actual needs, and finally make up to 13.5μL with ddH2O); then add 2.5μL B Buffer to the reaction system cover, cover the cover, turn upside down 8-10 times, mix evenly, centrifuge instantly, place in a constant temperature metal bath, incubate at 37-42℃ for 4 minutes, after the end, take out the reaction system, turn upside down 8-10 times, mix evenly, centrifuge instantly, and place in a constant temperature fluorescence detector for amplification. The amplification program is: constant temperature 42℃, collect fluorescence signals once every 30s, and the reaction time is 15min.

[0040] The fourth aspect of the present invention is to provide a use of the primer-probe combination as described in the first aspect, or the kit as described in the second aspect, in detecting bovine rotavirus.

[0041] The present invention adopts the above technical solution, and has the following technical effects compared with the prior art:

[0042] The present invention optimizes and designs the conserved sequence of the bovine rotavirus VP6 gene to synthesize a primer-probe combination, and further constructs a reaction system, not only determines the optimal reaction conditions and the optimal primer pair, but also establishes and optimizes a method for detecting bovine rotavirus. The detection method constructed by the present invention not only has high sensitivity, good specificity, and simple operation, but also has a fast detection speed and low cost, and has important application value in detecting whether a sample contains bovine rotavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are only used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0044] Figure 1 This is a diagram showing the results of the comparison and analysis of the conservative sequences of the VP6 gene in one embodiment of the present invention;

[0045] Figure 2 It is a schematic diagram of designing primers and probes according to the conserved sequence of VP6 gene in one embodiment of the present invention;

[0046] Figure 3 is a result diagram of the optimization of the BRV real-time MIRA method conditions in one embodiment of the present invention;

[0047] Figure 4 1 is a result diagram of the optimization of primer and probe combination of the BRV real-time RT-MIRA method in one embodiment of the present invention; wherein, 1: F2 / R1; 2: F2 / R2; 3: F3 / R2; 4: F1 / R3; 5: F2 / R3; 6: F3 / R3; 7: F3 / R1; 8: F1 / R1; 9: F1 / R2; 10: negative control;

[0048] Figure 5 is a result diagram of the sensitivity experiment of the BRV real-time MIRA method in one embodiment of the present invention; wherein 1:1.80×10 6 copies / μL; 2: 1.80×10 5 copies / μL; 3: 1.80×10 4 copies / μL; 4: 1.80×10 3 copies / μL; 5: 1.80×10 2 copies / μL; 6: 1.80×10 1 copies / μL; 7: 1.80×10 0 copies / μL, 8: negative control;

[0049] Figure 6 1 is a result diagram of a BRV real-time RT-MIRA method specificity experiment in one embodiment of the present invention; wherein, 1: BRV; 2: BPV; 3: BCV; 4: BVDV; 5: BAV; 6: BKV; 7: BToV; 8: negative control;

[0050] Figure 7 is a result diagram of the repeatability experiment of the BRV real-time RT-MIRA method in one embodiment of the present invention; wherein A: 1.80×103 copies / μL; B: 1.80×10 4 copies / μL; C: 1.80×10 5 copies / μL. DETAILED DESCRIPTION

[0051] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work belong to the scope of protection of the present invention. The experimental methods without specific conditions in the following embodiments are usually measured according to national standards. The experimental materials without the source indicated in the following embodiments are all commercially available raw materials. The equipment used in each step in the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to the general international standards, conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, all parts are weight parts and all percentages are mass percentages. Unless otherwise defined or specified, all professional and scientific terms used in the present invention have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar or equal to the recorded content can be applied to the method of the present invention.

[0052] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other. The present invention is further described below in conjunction with the drawings and specific embodiments, but is not intended to be a limitation of the present invention.

[0053] The main sources of viruses, reagents and kits used in the examples of the present invention are as follows:

[0054] Bovine rotavirus (BRV), bovine coronavirus (BCoV), bovine parvovirus (BPV), bovine viral diarrheavirus (BVDV), bovine astrovirus (BoAstV), bovine kobuvirus (BKoV), and bovine torovirus (BToV) were identified and preserved by our laboratory; multi-enzyme fluorescence constant temperature amplification detection kit (Shanghai Manman Biotechnology Co., Ltd., catalog number: MM-RNA-R); nuclease-free water, MagPure ViralDNA / RNA Kit For MagMax Express nucleic acid extraction kit (Shanghai Maigen Biotechnology Co., Ltd., catalog number: MD5416-02); bovine group A rotavirus real-time fluorescence RT-PCR detection kit (Hunan Guanmu Biotechnology Co., Ltd., catalog number: GM12022).

[0055] Other materials not specifically marked with manufacturers in the examples can be obtained through conventional commercial purchases.

[0056] In the embodiments of the present invention, the main instruments used are as follows:

[0057] Nucleic acid extractor (Thermo KingFisher TM MagMax Express); constant temperature metal bath (Qunan Scientific Instrument Co., Ltd.); isothermal fluorescence PCR instrument (Shanghai Manman Biotechnology Co., Ltd.); high-throughput real-time fluorescence quantitative PCR instrument (QuanStudio5); high-speed centrifuge (Thermo); ultra-clean workbench (Thermo).

[0058] The present invention is described below by way of example.

[0059] Example 1-Design and synthesis of primers and probes

[0060] This embodiment optimizes the design of primer probes for detecting bovine rotavirus, specifically comprising the following steps:

[0061] According to literature reports and gene sequence comparison, the highly conserved VP6 full gene sequence of bovine rotavirus HB-BD strain (MN047454) was selected from GenBank for the design of BRV real-time RT-MIRA primers and probes.

[0062] The BRV gene VP6 gene sequence is as follows:

[0063] ATGGATGTCCTGTACTCCTTGTCAAAAACTCTTAAAGATGCTAGAGACAAAATTGTCGAAGGCACATTATACTCCAATGTAAGTGATCTAATTCAACAATTTAATCAAATGATAATTACTATGAATGGAAATGAGTTCCAAACTGGAGGA ATTGGTAATCTACCGATTAGAAATTGGAATTTTGATTTTGGATTACTCGGAACAACTCTACTAAATTTGGATGCCAACTACGTCGAAACGGCCCGCAATACAATTGATTATTTTGTAGATTTTGTAGATAATGTATGTATGGATGAAATG GTTAGAGAATCACAAAGAAATGGAATTGCACCACAATCAGATTCACTTAGAAAGTTGTCAGGTATTAAATTCAAAAGAATAAATTTTGACAATTCATCAGAATACATAGAGAACTGGAATTTGCAAAACAGAAGACAAAGAACGGGTTTT ACATTTCATAAACCAAACATTTTCCCTTACTCAGCGTCATTCACACTGAACAGATCACAACCAGCTCATGATAACTTGATGGTACGATGTGGCTCAATGCGGGATCAGAAATTCAGGTCGCTGGATTCGATTATTCATGTGCAATCAAT

[0064] After BLAST comparison, Figure 1 As shown, it was found that the conserved sequence homology of 366bp of VP6 gene was 98%-100%, indicating that this segment of gene sequence has good specificity and is suitable for designing primers and probes; among them, the conserved sequence of 366bp of VP6 gene is as follows:

[0065] TCGAAGGCACATTATACTCCAATGTAAGTGATCTAATTCAACAATTTAATCAAATGATAATTACTATGAATGGAAATGAGTTCCAAACTGGAGGAATTGGTAATCTACCGATTAGAAATTGGAATTTTGATTTTGGATTACTCGGAACAACTCTACTAAATTTGGATGCCAACTACGTCGAAA CGGCCCGCAATACAATTGATTATTTTGTAGATTTTGTAGATAATGTATGTATGGATGAAATGGTTAGAGAATCACAAAGAAATGGAATTGCACCACAATCAGATTCACTTAGAAAGTTGTCAGGTATTAAATTCAAAAGAATAAATTTTGACAATTCATCAGAATACATAGAGAACTGGAATT

[0066] After software design, 3 sets of primers and 1 probe were obtained, such as Figure 2 As shown in Table 1 below.

[0067] Table 1 Primer and probe sequences

[0068]

[0069] Example 2 - Establishment and Optimization of BRV Real-time RT-MIRA Method

[0070] In this example, based on the primer probe designed in Example 1, a BRV real-time RT-MIRA method was established and its reaction conditions were optimized, specifically including the following steps:

[0071] 1. Viral nucleic acid extraction

[0072] Take 50 μL of supernatant and extract viral nucleic acid using MagPure Viral DNA / RNA Kit according to the instructions. Finally, dissolve the nucleic acid in 50 μL of water and store it at -80°C for later use. The specific steps are as follows:

[0073] 1. Choose Thermo KingFisher TM AM1836 V2 program in the MagMax Express instrument.

[0074] 2. Insert the magnetic jacket into the instrument.

[0075] 3. Add 150 μL of Buffer MW1 to the wells in rows B / C.

[0076] 4. Add 150 μL of Buffer MW2 to the wells in row D / E.

[0077] 5. Add 90 μL Nuclease Free Water to the wells in row F.

[0078] 6. Add 20 μL of magnetic beads / PK mixture, 50 μL of sample and 130 μL of Buffer MLB to the wells in row A.

[0079] 7. Execute the AM1836 V2 program, press the Start button, and the program ends after about 30 minutes.

[0080] 8. Remove the elution tube, transfer the sample to a 1.5 mL centrifuge tube, and store at -20°C or -80°C.

[0081] 2. Construction of recombinant plasmid standards

[0082] The VP6 gene sequence including upstream and downstream primers was synthesized, connected to the pMD19-T vector, and transformed into DH5α competent cells to construct the recombinant plasmid. After sequencing and identification, the plasmid was extracted as a standard, and the plasmid concentration was measured by Nanodrop 2000c, and the concentration was converted into copy number according to the following formula: DNA copy number / μL = [6.02×10 23 ×DNA concentration (ng / μL) × 10 -9 ] / (DNA base number×660), after calculation, the copy number of the positive recombinant plasmid is 1.8×10 10 copies / μL.

[0083] 3. Establishment of BRV real-time RT-MIRA method

[0084] The BRV real-time RT-MIRA reaction was performed using the instructions of the multi-enzyme fluorescence isothermal amplification detection kit. The reaction system was added to the dry powder reaction tube containing the enzyme. The reaction system was the same as in Table 2. The operation steps were as follows:

[0085] 1. Add 29.4 μL R Buffer, 2 μL upstream primer, 2 μL downstream primer and 0.6 μL probe to each reaction system.

[0086] 2. Add 2 to 13.5 μL of nucleic acid template to the reaction system (can be adjusted according to actual needs, and finally make up to 13.5 μL with ddH2O).

[0087] 3. Add 2.5 μL B Buffer to the lid of the reaction system, close the lid, and invert 8 to 10 times to mix well.

[0088] 4. After mixing, centrifuge instantly, place in a constant temperature metal bath, incubate at 37-42°C for 4 minutes. After the end, take out the reaction system, turn it upside down 8-10 times, mix evenly, and centrifuge instantly.

[0089] 5. Place in a constant temperature fluorescence detector for amplification. The amplification program is: constant temperature 37-42°C, collect fluorescence signals every 30 seconds, and reaction time 30 minutes.

[0090] Table 2 Reaction system

[0091]

[0092] 4. Reaction System Optimization

[0093] The reaction temperature, reaction time and optimal primer pair of the BRV real-time RT-MIRA method were optimized.

[0094] To optimize the BRV real-time RT-MIRA reaction system, 1.80×10 3 The copied plasmid was used as a template, and different reaction temperatures of 37°C to 42°C and reaction times within 30 minutes were tested in isothermal amplification PCR to determine the optimal reaction temperature and reaction time. Specifically, the reaction temperatures of the BRV real-time RT-MIRA method were set at 37°C, 39°C, and 42°C, respectively, to determine its optimal reaction temperature.

[0095] Reaction time: Real-time fluorescence quantitative PCR was used for detection, the reaction temperature was set at 42°C, one cycle was 30 seconds, and the amplification curve within 30 minutes (10 minutes, 15 minutes, 30 minutes) was observed to determine the optimal reaction time.

[0096] The results are as follows Figure 3 As shown, the above method can be amplified at 37°C ~ 42°C, and the result can be obtained in 10 minutes. Since it is an RNA virus, the temperature is selected to be higher. The final conservative optimal reaction conditions are 42°C and the reaction time is 15 minutes. That is, the amplification program is: constant temperature 42°C, collecting fluorescence signals once every 30 seconds, and reaction time 15 minutes.

[0097] A total of three pairs of primers were designed for the BRV VP6 gene, with a total of nine different primer pair combinations: BRV-VP6-F1 / BRV-VP6-R1, BRV-VP6-F1 / BRV-VP6-R2, BRV-VP6-F1 / BRV-VP6-R3, BRV-VP6-F2 / BRV-VP6-R1, BRV-VP6-F2 / BRV-VP6-R2, BRV-VP6-F2 / BRV-VP6-R3, BRV-VP6-F3 / BRV-VP6-R1, BRV-VP6-F3 / BRV-VP6-R2, and BRV-VP6-F3 / BRV-VP6-R3), using 1.80 × 10 3 The copied plasmid was used as a template to carry out a combination test of each primer pair and probe to determine the best primer pair combination; among them, the amplification curves produced by nine different primer pair combinations were: 1: F2 / R1; 2: F2 / R2; 3: F3 / R2; 4: F1 / R3; 5: F2 / R3; 6: F3 / R3; 7: F3 / R1; 8: F1 / R1; 9: F1 / R2; 10: negative control.

[0098] Depend on Figure 4 It can be seen that BRV-VP6-F2 / BRV-VP6-R1 (SEQ ID NO: 2, SEQ ID NO: 4) is the best primer pair, and this group of primer pairs shows better amplification effect than other groups of primer pairs.

[0099] 5. Determination of the optimal detection steps

[0100] According to the above optimization results, the optimal detection steps are as follows:

[0101] Add the reaction system to the dry powder reaction tube containing the enzyme, add 29.4μL R Buffer, 2μL upstream primer, 2μL downstream primer and 0.6μL probe to each reaction system; add 2-13.5μL nucleic acid template to the reaction system respectively (can be adjusted according to actual needs, and finally make up to 13.5μL with ddH2O); then add 2.5μL B Buffer to the reaction system cover, cover the cover, turn upside down 8-10 times, and mix evenly; after mixing, centrifuge instantly, place in a constant temperature metal bath, incubate at 37-42℃ for 4 minutes, after the end, take out the reaction system, turn upside down 8-10 times, mix evenly, and centrifuge instantly; then put it into a constant temperature fluorescence detector for amplification, the amplification program is: constant temperature 42℃, collect fluorescence signals once every 30s, and reaction time 15min.

[0102] Example 3 - Sensitivity, specificity and reproducibility of BRV real-time RT-MIRA method

[0103] This example conducted experiments according to the BRV real-time RT-MIRA method established in Example 2.

[0104] 1. Sensitivity of BRV real-time RT-MIRA method

[0105] The plasmid standard was diluted 10-fold to 1.8 × 10 6 ~1.8×10 0 copies / μL, 2 μL was taken as reaction template, and nuclease-free water was used as negative control for real-time RT-MIRA detection to determine its sensitivity. 6 copies / μL; 2: 1.80×10 5 copies / μL; 3: 1.80×10 4 copies / μL; 4: 1.80×10 3 copies / μL, 5: 1.80×10 2 copies / μL; 6: 1.80×10 1 copies / μL; 7: 1.80×10 0 copies / μL; 8: negative control.

[0106] Sensitivity test results: Select BRV 1.80×10 6 ~1.80×10 0 The plasmid with a concentration of copies / μL was detected by real-time RT-MIRA method, such as Figure 5 As shown in the figure, the experimental results showed that the minimum detection rate of BRV for the BRV real-time RT-MIRA method established in this study was 1.80 copies / μL.

[0107] 2. BRV real-time RT-MIRA method specificity

[0108] The real-time RT-MIRA method established in Example 2 was used to detect BRV, BCoV, BPV, BVDV, BoAstV, BKoV, and BToV, and nuclease-free water was used as a negative control to evaluate the specificity of the method. Among them, 1: BRV; 2: BPV; 3: BCV; 4: BVDV; 5: BAV; 6: BKV; 7: BToV; 8: negative control.

[0109] Specificity test results: BCoV, BPV, BVDV, BoAstV, BKoV and BToV nucleic acids that cause similar clinical symptoms were amplified with BRV nucleic acid to determine their specificity. Figure 6 As shown, the results showed that only BRV showed a fluorescence amplification curve, while other pathogens did not show a fluorescence amplification curve, and no cross reaction occurred, proving that the method had good specificity.

[0110] 3. Repeatability of BRV real-time RT-MIRA method

[0111] Select the sensitivity of 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 The repeatability test was performed with three concentrations of A: 1.80×10 3 copies / μL, B: 1.80×10 4 copies / μL, C: 1.80×10 5 copies / μL; at the same time, nuclease-free water was set as a negative control, and the repeatability test was divided into intra-batch repeat and inter-batch repeat. Intra-batch repeat: The three concentrations and the negative control were tested at the same time under the same reaction conditions, repeated three times, and the coefficient of variation of intra-batch repeat was calculated by analysis; inter-batch repeat: The nucleic acid template was stored at -20°C, and the repeatability test was performed once every two days, three times, and three replicates were performed each time, and the coefficient of variation of inter-batch repeat was calculated by analysis; the results are as follows Figure 7 And as shown in Table 3.

[0112] Table 3 Intra-assay and inter-assay reproducibility of BRV

[0113]

[0114] Repeatability test results: Three concentrations were selected for repeatability testing, including intra-batch repeats and inter-batch repeats. The intra-batch coefficient of variation (CV) was 2.24% to 6.68%, and the inter-batch coefficient of variation (CV) was 3.62% to 5.10%, both less than 10%. The results showed that the coefficient of variation of Tt values ​​of the three concentration samples in the same batch and in different batches was less than 10%, and the repeatability was good.

[0115] Example 4-BRV real-time RT-MIRA clinical sample detection verification results

[0116] In this example, the BRV real-time RT-MIRA method established in Example 2 was used to detect and verify clinical samples.

[0117] Clinical samples were collected from October 2023 to December 2023, and 206 dairy cow feces samples were collected from four farms, including Xindong Dairy Farm of Shanghai Guangming Animal Husbandry Co., Ltd., Jinshan Dairy Farm of Guangming Animal Husbandry Co., Ltd., Shanghai Dairy Breeding Center Co., Ltd., and Shanghai Beef Cattle Breeding Center. They were dissolved in 3 volumes of sterile PBS, shaken and mixed thoroughly, centrifuged at 12000×g for 5 minutes, and the supernatant was collected for later use.

[0118] Viral nucleic acid was extracted from 206 healthy cow feces samples collected from four dairy farms in Shanghai (the nucleic acid extraction method was the same as in Example 2), and the BRV real-time RT-MIRA method and bovine rotavirus real-time fluorescence RT-PCR detection kit established in Example 2 were used for detection. The results of real-time fluorescence RT-PCR were used as the gold standard for virus detection to evaluate the specificity, sensitivity, negative predictive value and positive predictive value of real-time RT-MIRA. Kappa was used to analyze the consistency, and when Kappa>0.8, it means that the test results have excellent consistency.

[0119] The detection results of clinical samples by real-time fluorescence RT-PCR were used as the standard, and 206 clinical samples were detected by the established real-time RT-MIRA method. The results are shown in Table 4. The detection results of the two methods were consistent with each other by 100.00% and the Kappa value was 1.00, indicating that the two methods had good consistency.

[0120] Table 4 BRV real-time RT-MIRA clinical sample detection

[0121]

[0122] In summary, the real-time RT-MIRA method is used to detect whether a sample contains bovine rotavirus. It is not only fast, but also highly sensitive, specific, simple to operate, and low cost. It has important research significance and application value in the detection of bovine rotavirus.

[0123] The above description is only a preferred embodiment of the present invention, and does not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be aware that all solutions obtained by equivalent substitutions and obvious changes made using the description and illustrations of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer-probe combination for detecting bovine rotavirus, characterized in that: The primer-probe combination is designed for the conservative sequence of the VP6 full gene sequence of bovine rotavirus, and the conservative sequence is shown in SEQ ID No:

8.

2. The primer-probe combination according to claim 1, characterized in that: The primer-probe combination includes primers with sequences shown as SEQ ID NO: 1 to SEQ ID NO: 6 and a probe with a sequence shown as SEQ ID NO:

7.

3. The primer-probe combination according to claim 2, characterized in that: In the primer-probe combination, the primers include an upstream primer and a downstream primer, the upstream primer is selected from one of the sequences shown in SEQ ID NO: 1 to SEQ ID NO: 3, and the downstream primer is selected from one of the sequences shown in SEQ ID NO: 4 to SEQ ID NO:

6.

4. The primer-probe combination according to claim 2, characterized in that: The probe is labeled with a FAM group at the 31st base T from the 5' end, the 32nd base A is replaced by tetrahydrofuran THF, the 33rd base T is labeled with a BHQ group, and the 3' end is modified with C3 spacer blocking.

5. A nucleic acid isothermal amplification kit for detecting bovine rotavirus, characterized in that: The kit comprises: a primer-probe combination as claimed in any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that The reaction system of the kit includes: 29.4 μL RBuffer, 2 μL upstream primer, 2 μL downstream primer, 0.6 μL probe, 2-13.5 μL nucleic acid template, 2.5 μL B Buffer, and ddH2O supplemented to 50 μL; wherein the concentration of the upstream primer is 10 μmol / L, the concentration of the downstream primer is 10 μmol / L, and the concentration of the probe is 10 μmol / L.

7. A method for detecting bovine rotavirus, characterized in that: The following steps are involved: S1. Extract viral nucleic acid from samples; S2. Perform real-time RT-MIRA amplification detection of viral nucleic acid using the primer-probe combination described in any one of claims 1 to 4 or the kit described in any one of claims 5 to 6.

8. The method according to claim 7, characterized in that The reaction conditions of the amplification are: constant temperature of 37-42° C., collecting fluorescence signals every 30 seconds, and reaction time of 10-30 minutes.

9. The method according to any one of claims 7 to 8, characterized in that: The minimum detection concentration of the method is 1.80 copies / μL.

10. Use of the primer-probe combination according to any one of claims 1 to 4, or the kit according to any one of claims 5 to 6, in detecting bovine rotavirus.

Images