A method for multi-antibody linked capture immunoassay

Abstract

This invention relates to a protein detection method. Specifically, the method introduces magnetic beads to capture antibodies that bind to the target protein structure, forming a triple-antibody sandwich protein-magnetic bead complex. This complex is then detected to obtain the target protein detection result. The method of this invention exhibits good stability, high sensitivity, high efficiency, low background signal, and simple operation steps.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically to a method for multi-antibody linked capture immunoassay. Background Technology

[0002] In the field of clinical medical testing, the detection of protein biomarkers has always played a crucial role. Traditional immunoassay techniques, including Western blotting, flow cytometry, enzyme-linked immunosorbent assay (ELISA), and chemiluminescence immunoassay, have become the core pillars of in vitro diagnostics (IVD) immunodiagnostics. These techniques not only provide important evidence for early disease diagnosis, treatment monitoring, and prognostic assessment, but also, with the rapid development of medical technology, the demand for protein biomarker detection is increasing daily.

[0003] However, existing immunoassay techniques still have limitations when detecting low-abundance proteins. Low-abundance proteins are often present in extremely low concentrations in biological samples, making them difficult to accurately detect using conventional methods. This not only limits in-depth research on certain diseases but also affects the accuracy and timeliness of clinical diagnosis. Therefore, the need for ultrasensitive detection technologies has become particularly urgent.

[0004] Alamar Biosciences' NULISA (Nucleic acid Linked ImmuNO-Sandwich Assay) technology improves the sensitivity of traditional proximity-linked protein detection and reduces background signal through a dual capture and release mechanism, achieving ultrasensitive detection. By using uncoupled antibodies and next-generation sequencing of barcode reporter DNA, it enables highly multiplexed quantification of low-abundance and high-abundance proteins across a wide dynamic range. However, this technology also has some limitations. NULISA involves multiple steps, including immune complex formation, capture, washing, release, recapture, and DNA strand ligation, which increases operational complexity. Furthermore, experimental testing shows that the dual magnetic bead system involved in NULISA has relatively low reaction efficiency, especially the first step with dT magnetic beads, where both adsorption and elution efficiencies are relatively low, precision is difficult to control, and result stability is relatively poor.

[0005] Therefore, there is an urgent need in this field for a protein detection method that is simple to operate, low in cost, has low background signal, high sensitivity, and can perform multiplex detection. Summary of the Invention

[0006] The purpose of this invention is to provide a protein detection method that is simple to operate, low in cost, has low background signal, high sensitivity, and allows for multiplex detection.

[0007] In a first aspect, the present invention provides a protein detection method, comprising the steps of:

[0008] (s0) Provides a sample to be tested, micromagnetic particles, a second antibody, a third antibody, a ligase, a first ligation element, and a second ligation element, wherein the micromagnetic particles are coupled with the first antibody or the micromagnetic particles (without being coupled with the first antibody) can contact the first antibody to form a first antibody-micromagnetic particle conjugate, the second antibody is coupled with a second nucleic acid element (second antibody-nucleic acid conjugate), and the third antibody is coupled with a third nucleic acid element (third antibody-nucleic acid conjugate);

[0009] (s1) The sample to be tested is mixed with the first antibody, the second antibody, the third antibody and the micromagnetic particles, so that the second antibody, the third antibody and the micromagnetic particles bind to the target protein in the sample to form a three-antibody sandwich protein-micromagnetic particle complex, and the three-antibody sandwich protein-micromagnetic particle complex is separated.

[0010] (s2) The triantibody sandwich protein-micromagnetic particle complex is mixed with ligase and the first linker element, so that the ends of the second nucleic acid element and the third nucleic acid element are complementary to the bases of the first linker element to form a double-stranded structure;

[0011] There is a gap of ≤1nt in length between the second and third nucleic acid elements;

[0012] The gaps are joined by ligase to form an amplification template; and

[0013] (s3) Perform nucleic acid amplification reaction on the amplification template to obtain protein detection results.

[0014] In another preferred embodiment, the micromagnetic particles without conjugation to the first antibody are conjugated with the first antibody in step (s1) to form a first antibody-micromagnetic particle conjugate.

[0015] In another preferred embodiment, in step (s1), the amount of the micromagnetic particles is 1 to 20 μL, more preferably 1 to 10 μL, for example, about 5 μL.

[0016] In another preferred embodiment, the first antibody is conjugated to a first nucleic acid element labeled with biotin, and the micromagnetic particles are modified with avidin.

[0017] In another preferred embodiment, the length of the first nucleic acid element is 5 to 30 nucleotides, more preferably 10 to 25 nucleotides, and even more preferably 10 to 20 nucleotides.

[0018] In another preferred embodiment, the lengths of the second and third nucleic acid elements are each independently 40 to 100 nucleotides, more preferably 40 to 90 nucleotides, and even more preferably 40 to 80 nucleotides.

[0019] In another preferred embodiment, the length of the first connecting element is 15 to 40 nucleotides, more preferably 20 to 35 nucleotides, and even more preferably 23 to 30 nucleotides.

[0020] In another preferred embodiment, the second nucleic acid element has the structure shown in formula (I):

[0021] Z1-Z2(I)

[0022] In the formula, Z1 consists of 35–95 nucleotides;

[0023] Z2 consists of 5–15 nucleotides;

[0024] The third nucleic acid element has the structure shown in formula (II):

[0025] X1-X2(II)

[0026] In the formula, X1 represents 5 to 15 nucleotides;

[0027] X2 consists of 35–95 nucleotides;

[0028] The first connecting element has the structure shown in formula (III):

[0029] L1-X1'-Z2'-L2(III)

[0030] In the formula, L1 and L2 are each independently 1 to 5 nucleotides;

[0031] X1' is complementary to X1;

[0032] Z2' is complementary to Z2.

[0033] In another preferred embodiment, L1 and L2 are each independently 2-4 nucleotides, for example 3 nucleotides.

[0034] In another preferred embodiment, Z1 is 40 to 90 nucleotides, more preferably 50 to 80 nucleotides, and even more preferably 60 to 75 nucleotides.

[0035] In another preferred embodiment, Z2 is 7 to 13 nucleotides, more preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0036] In another preferred embodiment, X1 is 7 to 13 nucleotides, more preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0037] In another preferred embodiment, X2 is 35 to 80 nucleotides, more preferably 35 to 60 nucleotides, and even more preferably 35 to 50 nucleotides.

[0038] In another preferred embodiment, the nucleotide sequence of the first nucleic acid element is shown in SEQ ID NO:3.

[0039] In another preferred embodiment, the nucleotide sequence of the second nucleic acid element is shown in SEQ ID NO:1.

[0040] In another preferred embodiment, the nucleotide sequence of the third nucleic acid element is shown in SEQ ID NO:2.

[0041] In another preferred embodiment, the nucleotide sequence of the first linker is shown in SEQ ID NO:4.

[0042] In another preferred embodiment, the 5' end of the second nucleic acid element is covalently linked to the second antibody.

[0043] In another preferred embodiment, the 3' end of the third nucleic acid element is covalently linked to the third antibody.

[0044] In another preferred embodiment, step (s1) is performed at 20–50°C, more preferably 25–40°C, more preferably 30–40°C, for example, about 37°C.

[0045] In another preferred embodiment, in step (s1), the mixing time is 0.5 to 3 hours, more preferably 1 to 2.5 hours, more preferably 1 to 2 hours, for example, about 1 hour.

[0046] In another preferred embodiment, in step (s1), the amount of the micromagnetic particles is 1 to 20 μL, more preferably 1 to 10 μL, for example, about 5 μL.

[0047] In another preferred embodiment, in step (s1), the amount of the sample to be tested is 10 to 100 μL.

[0048] In another preferred embodiment, in step (s1), the content of the target protein in the sample to be tested is 50 fg / mL to 1 μg / mL, more preferably 50 fg / mL to 500 pg / mL, more preferably 50 fg / mL to 300 pg / mL, for example, about 75 fg / mL, about 150 fg / mL, about 1.5 pg / mL, about 15 pg / mL or 150 pg / mL.

[0049] In another preferred embodiment, the sample to be tested includes a plasma sample.

[0050] In another preferred embodiment, in step (s1), the ratio of the second antibody to the third antibody is 10:1 to 1:10, more preferably 5:1 to 1:5, more preferably 3:1 to 1:3, for example, about 1:1.

[0051] In another preferred embodiment, in step (s1), the concentration of the first antibody is 0.1 to 50 nM, more preferably 0.5 to 10 nM, more preferably 1 to 5 nM, for example, about 1.5 nM.

[0052] In another preferred embodiment, in step (s1), the concentration of the second antibody-nucleic acid conjugate is 0.01 to 10 nM, more preferably 0.05 to 5 nM, more preferably 0.1 to 1 nM, for example, about 0.5 nM.

[0053] In another preferred embodiment, in step (s1), the concentration of the third antibody-nucleic acid conjugate is 0.01 to 10 nM, more preferably 0.05 to 5 nM, more preferably 0.1 to 1 nM, or 0.2 nM.

[0054] In another preferred embodiment, in step (s2), the concentration of the first connecting element is 0.1 to 50 μM, more preferably 0.5 to 20 μM, more preferably 0.5 to 10 μM, for example, about 3 μM.

[0055] In another preferred embodiment, in step (s2), the ligase is a ligase for connecting sticky ends.

[0056] In another preferred embodiment, in step (s2), the ligase is selected from the group consisting of T4 ligase, T7 ligase, or combinations thereof.

[0057] In another preferred embodiment, in step (s2), the amount of the ligase is 1 to 10 U / reaction, more preferably 2 to 8 U / reaction, more preferably 3 to 6 U / reaction, for example, about 5 U / reaction.

[0058] In another preferred embodiment, in step (s3), the nucleic acid amplification reaction is selected from the group consisting of PCR, qPCR, dye PCR, ddPCR, RPA, or LAMP.

[0059] In another preferred embodiment, in step (s3), the nucleic acid amplification reaction includes an upstream primer, a downstream primer, and a probe targeting the amplification template.

[0060] In another preferred embodiment, in step (s3), the nucleic acid amplification reaction includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO:5, a downstream primer having a nucleotide sequence as shown in SEQ ID NO:6, and a probe having a nucleotide sequence as shown in SEQ ID NO:7.

[0061] In another preferred embodiment, the PCR reaction conditions are: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, for 45 cycles.

[0062] In another preferred embodiment, the detection limit of the method is ≤200 fg / mL, more preferably ≤100 fg / mL, and even more preferably ≤75 fg / mL.

[0063] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0064] In another preferred embodiment, the target protein is selected from the group consisting of pTau217, carcinoembryonic antigen, or combinations thereof.

[0065] In another preferred embodiment, the criterion for determining the method is:

[0066] When CT≥35, it indicates that the target protein is not present in the sample being tested;

[0067] When CT < 35, it indicates that the target protein is present in the sample to be tested.

[0068] In a second aspect, the present invention provides a protein detection system comprising:

[0069] (a) Primary antibody-micromagnetic particle conjugate;

[0070] (b) Secondary antibody-nucleic acid conjugates and tertiary antibody-nucleic acid conjugates; and

[0071] (c) First connecting element;

[0072] Optional (d) The protein to be tested;

[0073] Among them, the first antibody, the second antibody, and the third antibody are antibodies that specifically bind to the target protein;

[0074] The first antibody-micromagnetic particle conjugate refers to a micromagnetic particle conjugate with a first antibody, the second antibody-nucleic acid conjugate refers to a second antibody conjugate with a second nucleic acid element, and the third antibody-nucleic acid conjugate refers to a third antibody conjugate with a third nucleic acid element.

[0075] The second nucleic acid element has the structure shown in formula (I):

[0076] Z1-Z2(I)

[0077] In the formula, Z1 consists of 35–95 nucleotides;

[0078] Z2 consists of 5–15 nucleotides;

[0079] The third nucleic acid element has the structure shown in formula (II):

[0080] X1-X2(II)

[0081] In the formula, X1 represents 5 to 15 nucleotides;

[0082] X2 consists of 35–95 nucleotides;

[0083] The first connecting element has the structure shown in formula (III):

[0084] L1-X1'-Z2'-L2(III)

[0085] In the formula, L1 and L2 are each independently 1 to 5 nucleotides;

[0086] X1' is complementary to X1;

[0087] Z2' is complementary to Z2.

[0088] In another preferred embodiment, the length of the first nucleic acid element is 5 to 30 nucleotides, more preferably 10 to 25 nucleotides, and even more preferably 10 to 20 nucleotides.

[0089] In another preferred embodiment, the lengths of the second and third nucleic acid elements are each independently 40 to 100 nucleotides, more preferably 40 to 90 nucleotides, and even more preferably 40 to 80 nucleotides.

[0090] In another preferred embodiment, the length of the first connecting element is 15 to 40 nucleotides, more preferably 20 to 35 nucleotides, and even more preferably 23 to 30 nucleotides.

[0091] In another preferred embodiment, L1 and L2 are each independently 2-4 nucleotides, for example 3 nucleotides.

[0092] In another preferred embodiment, Z1 is 40 to 90 nucleotides, more preferably 50 to 80 nucleotides, and even more preferably 60 to 75 nucleotides.

[0093] In another preferred embodiment, Z2 is 7 to 13 nucleotides, more preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0094] In another preferred embodiment, X1 is 7 to 13 nucleotides, more preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0095] In another preferred embodiment, X2 is 35 to 80 nucleotides, more preferably 35 to 60 nucleotides, and even more preferably 35 to 50 nucleotides.

[0096] In another preferred embodiment, the nucleotide sequence of the first nucleic acid element is shown in SEQ ID NO:3.

[0097] In another preferred embodiment, the nucleotide sequence of the second nucleic acid element is shown in SEQ ID NO:1.

[0098] In another preferred embodiment, the nucleotide sequence of the third nucleic acid element is shown in SEQ ID NO:2.

[0099] In another preferred embodiment, the nucleotide sequence of the first linker is shown in SEQ ID NO:4.

[0100] In another preferred embodiment, the 5' end of the second nucleic acid element is covalently linked to the second antibody.

[0101] In another preferred embodiment, the 3' end of the third nucleic acid element is covalently linked to the third antibody. In another preferred embodiment, the amount of the micromagnetic particles in the protein detection system is 5-10 μL.

[0102] In another preferred embodiment, the concentration of the first antibody in the protein detection system is 0.1–50 nM, more preferably 0.5–10 nM, more preferably 1–5 nM, for example, about 2 nM.

[0103] In another preferred embodiment, in the protein detection system, the concentration of the second antibody or the second antibody-nucleic acid conjugate is 0.01 to 10 nM, more preferably 0.05 to 5 nM, more preferably 0.1 to 1 nM, for example, 0.5 nM.

[0104] In another preferred embodiment, the concentration of the third antibody or the third antibody-nucleic acid conjugate in the protein detection system is 0.01–10 nM, more preferably 0.05–5 nM, even more preferably 0.1–1 nM, or 0.2 nM.

[0105] In another preferred embodiment, in the protein detection system, the ratio of the second antibody to the third antibody or the second antibody-nucleic acid conjugate to the third antibody-nucleic acid conjugate is 10:1 to 1:10, more preferably 5:1 to 1:5, more preferably 3:1 to 1:3, for example, about 1:1.

[0106] In another preferred embodiment, in the protein detection system, the concentration of the first linker element is 0.1–50 μM, more preferably 0.5–20 μM, more preferably 0.5–10 μM, for example, about 3 μM.

[0107] In another preferred embodiment, the protein detection system further includes a ligase.

[0108] In another preferred embodiment, the amount of the ligase in the protein detection system is 1–10 U, more preferably 2–8 U, more preferably 3–6 U, for example, about 5 U.

[0109] In another preferred embodiment, the ligase is a ligase for connecting sticky ends.

[0110] In another preferred embodiment, the ligase is selected from the group consisting of T4 ligase, T7 ligase, or combinations thereof.

[0111] In another preferred embodiment, the amount of the ligase is 1 to 10 U, more preferably 2 to 8 U, more preferably 3 to 6 U, for example, about 5 U.

[0112] In another preferred embodiment, the protein detection system further comprises a buffer solution selected from the following components: 10–50 mM Na₂HPO₄, 1–10 mM NaH₂PO₄, 20–70 mM NaCl, 0.01%–0.5% Tween 20, 0.1%–5% BSA, 50–150 nM IgG, 0.01–1 mg / mL salmon sperm DNA, and 1–10 mM EDTA.

[0113] In another preferred embodiment, the protein detection system further comprises a linkage system selected from the following components: 10–50 mM Tris-HCl, 1.0–5.0 mM MgCl2, 0.1–1 mM NAD, 1.0–3.0 mM ATP, and 1–50 mM DTT.

[0114] In another preferred embodiment, the protein detection system further includes primers and probes, preferably an upstream primer having a nucleotide sequence as shown in SEQ ID NO:5, a downstream primer having a nucleotide sequence as shown in SEQ ID NO:6, and a probe having a nucleotide sequence as shown in SEQ ID NO:7.

[0115] In a third aspect, the present invention provides a protein detection kit, comprising:

[0116] (i) a first container and micromagnetic particles and a first antibody or a first antibody-micromagnetic particle conjugate located in the first container;

[0117] (ii) a second container and a second antibody, a third antibody, a second nucleic acid element, and a third nucleic acid element located within the second container, or a second antibody-nucleic acid conjugate and a third antibody-nucleic acid conjugate; and

[0118] (iii) The third container and the first connecting element located in the third container;

[0119] The micromagnetic particles are not conjugated with a primary antibody.

[0120] The first antibody, the second antibody, and the third antibody are antibodies that specifically bind to the target protein;

[0121] The first antibody-micromagnetic particle conjugate refers to a micromagnetic particle conjugate with a first antibody, the second antibody-nucleic acid conjugate refers to a second antibody conjugate with a second nucleic acid element, and the third antibody-nucleic acid conjugate refers to a third antibody conjugate with a third nucleic acid element.

[0122] The second nucleic acid element has the structure shown in formula (I):

[0123] Z1-Z2(I)

[0124] In the formula, Z1 consists of 35–95 nucleotides;

[0125] Z2 consists of 5–15 nucleotides;

[0126] The third nucleic acid element has the structure shown in formula (II):

[0127] X1-X2(II)

[0128] In the formula, X1 represents 5 to 15 nucleotides;

[0129] X2 consists of 35–95 nucleotides;

[0130] The first connecting element has the structure shown in formula (III):

[0131] L1-X1'-Z2'-L2(III)

[0132] In the formula, L1 and L2 are each independently 1 to 5 nucleotides;

[0133] X1' is complementary to X1;

[0134] Z2' is complementary to Z2.

[0135] In another preferred embodiment, the first antibody-micromagnetic particle conjugate is obtained by conjugating a first antibody and micromagnetic particles.

[0136] In another preferred embodiment, the micromagnetic particles and the first antibody located in the first container and the second antibody, the third antibody, the second nucleic acid element and the third nucleic acid element or the second antibody conjugate and the third antibody conjugate located in the second container are in the same container.

[0137] In another preferred embodiment, the first antibody, the second antibody, and the third antibody bind to different sites on the target protein.

[0138] In another preferred embodiment, the micromagnetic particles may or may not be coupled with a first antibody.

[0139] In another preferred embodiment, the first antibody is conjugated to a first nucleic acid element labeled with biotin, and the micromagnetic particles are modified with avidin.

[0140] In another preferred embodiment, the length of the first nucleic acid element is 5 to 30 nucleotides, more preferably 10 to 25 nucleotides, and even more preferably 10 to 20 nucleotides.

[0141] In another preferred embodiment, the lengths of the second and third nucleic acid elements are each independently 40 to 100 nucleotides, more preferably 40 to 90 nucleotides, and even more preferably 40 to 80 nucleotides.

[0142] In another preferred embodiment, the length of the first connecting element is 15 to 40 nucleotides, more preferably 20 to 35 nucleotides, and even more preferably 23 to 30 nucleotides.

[0143] In another preferred embodiment, L1 and L2 are each independently 2-4 nucleotides, for example 3 nucleotides.

[0144] In another preferred embodiment, Z1 is 40 to 90 nucleotides, more preferably 50 to 80 nucleotides, and even more preferably 60 to 75 nucleotides.

[0145] In another preferred embodiment, Z2 is 7 to 13 nucleotides, more preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0146] In another preferred embodiment, X1 is 7 to 13 nucleotides, more preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0147] In another preferred embodiment, X2 is 35 to 80 nucleotides, more preferably 35 to 60 nucleotides, and even more preferably 35 to 50 nucleotides.

[0148] In another preferred embodiment, the nucleotide sequence of the first nucleic acid element is shown in SEQ ID NO:3.

[0149] In another preferred embodiment, the nucleotide sequence of the second nucleic acid element is shown in SEQ ID NO:1.

[0150] In another preferred embodiment, the nucleotide sequence of the third nucleic acid element is shown in SEQ ID NO:2.

[0151] In another preferred embodiment, the nucleotide sequence of the first linker is shown in SEQ ID NO:4.

[0152] In another preferred embodiment, the 5' end of the second nucleic acid element is covalently linked to the second antibody.

[0153] In another preferred embodiment, the 3' end of the third nucleic acid element is covalently linked to the third antibody.

[0154] In another preferred embodiment, the kit further includes a fourth container and a ligase located in the fourth container.

[0155] In another preferred embodiment, the ligase is selected from the group consisting of T4 ligase, T7 ligase, or combinations thereof.

[0156] In another preferred embodiment, the kit further includes an upstream primer, a downstream primer, and a probe, preferably having an upstream primer having a nucleotide sequence as shown in SEQ ID NO:5, a downstream primer having a nucleotide sequence as shown in SEQ ID NO:6, and a probe having a nucleotide sequence as shown in SEQ ID NO:7.

[0157] In another preferred embodiment, the kit further includes a buffer containing a selection of the following components: 10–50 mM Na₂HPO₄, 1–10 mM NaH₂PO₄, 20–70 mM NaCl, 0.01%–0.5% Tween 20, 0.1%–5% BSA, 50–150 nM IgG, 0.01–1 mg / mL salmon sperm DNA, and 1–10 mM EDTA.

[0158] In another preferred embodiment, the kit further includes a ligation system comprising the following components: 10–50 mM Tris-HCl, 1.0–5.0 mM MgCl2, 0.1–1 mM NAD, 1.0–3.0 mM ATP, and 1–50 mM DTT.

[0159] In another preferred embodiment, the first container, the second container, the third container, and / or the fourth container are the same or different containers.

[0160] In another preferred embodiment, the kit further includes a nucleic acid amplification reaction solution for nucleic acid amplification reactions.

[0161] In another preferred embodiment, the first antibody, the second antibody, and the third antibody specifically bind to the protein.

[0162] In a fourth aspect, the present invention provides the use of a protein detection system as described in the second aspect of the present invention or a protein detection kit as described in the third aspect of the present invention for detecting proteins in a sample to be tested.

[0163] In another preferred embodiment, the sample to be tested contains a protein, preferably pTau217 and / or carcinoembryonic antigen.

[0164] In another preferred embodiment, the use is for disease diagnosis purposes.

[0165] In another preferred embodiment, the use is for non-disease diagnosis purposes.

[0166] In a fifth aspect, the present invention provides a protein detection method, comprising the steps of:

[0167] The sample to be tested is processed using the antigen detection system as described in the second aspect of the present invention or the antigen detection kit as described in the third aspect of the present invention, and a nucleic acid amplification reaction is performed to obtain the detection result.

[0168] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0169] Figure 1 A schematic diagram of the method of the present invention is shown.

[0170] Figure 2 The results of detecting pTau217 using the method of the present invention are shown.

[0171] Figure 3 The standard curve for detecting pTau217 standard using the method of the present invention is shown.

[0172] Figure 4 The results show the detection of total Tau antibody 1 as a capture antibody.

[0173] Figure 5 The results show the detection of total Tau antibody 2 as a capture antibody.

[0174] Figure 6 The results of detecting carcinoembryonic antigen using the method of the present invention are shown.

[0175] Figure 7 The results of the comparative tests are shown. Detailed Implementation

[0176] Through extensive and in-depth research, and after numerous experiments and screenings, the inventors unexpectedly discovered a protein detection method for the first time. This method introduces magnetic beads to capture antibodies that bind to the target protein structure, forming a triple-antibody sandwich protein-magnetic bead complex. This complex is then detected to obtain the target protein detection result. The method of this invention exhibits good stability, high sensitivity, high efficiency, low background signal, and simple operation. Based on this, the present invention was completed.

[0177] the term

[0178] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing the invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can vary. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be restrictive; the scope of the invention will be limited only by the appended claims.

[0179] As used herein, the term “comprising” or its variations such as “including” or “comprising” are understood to include the said element or component without excluding other elements or other components.

[0180] The term “about” can refer to a value or composition within an acceptable margin of error for a particular value or composition as determined by a person skilled in the art, depending in part on how the value or composition is measured or determined. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0181] As used herein, unless otherwise stated, any concentration range, percentage range, proportion range, or integer range shall be understood to include any integer value within the range and, where appropriate, its fractional value (e.g., one-tenth and one-hundredth of an integer).

[0182] As used herein, the term “and / or” refers to and covers any and all possible combinations of one or more of the related listed items.

[0183] As used in this article, the terms “BSA” and “bovine serum albumin” are used interchangeably.

[0184] As used herein, the terms “EDTA” and “ethylenediaminetetraacetic acid” are used interchangeably.

[0185] As used in this article, the terms “NAD” and “nicotinamide adenine dinucleotide” are used interchangeably.

[0186] As used in this article, the terms “DTT” and “dithiothreitol” are used interchangeably.

[0187] As used in this article, the terms "primary antibody" and "capture antibody" are used interchangeably.

[0188] As used in this article, the terms "second / third antibody" and "detection antibody" are used interchangeably.

[0189] As used in this article, the terms "first nucleic acid element" and "probe 3" are used interchangeably.

[0190] As used in this article, the terms "second / third nucleic acid" and "probe 1 / 2" are used interchangeably.

[0191] pTau217

[0192] pTau217 is a biomarker that plays an important role in the clinical diagnosis of Alzheimer's Disease (AD). The level of pTau217 in the blood is closely related to pathological changes in Tau protein in the brains of AD patients. Studies have shown that pTau217 levels are significantly elevated in AD patients, and this elevation is associated with cognitive decline and brain structural atrophy. pTau217 exhibits excellent diagnostic performance in differentiating AD from other neurodegenerative diseases, and its accuracy is comparable to that of tau PET scans and CSF biomarkers.

[0193] The method of the present invention

[0194] The method of the present invention includes the following steps:

[0195] (s0) Provides a sample to be tested, micromagnetic particles, a first antibody, a second antibody, a third antibody, a ligase, and a first connecting element, wherein the first antibody is coupled to the micromagnetic particles or the micromagnetic particles (without the first antibody coupled) can contact the first antibody to form a first antibody-micromagnetic particle conjugate, the second antibody is coupled with a second nucleic acid element (second antibody-nucleic acid conjugate), and the third antibody is coupled with a third nucleic acid element (third antibody-nucleic acid conjugate);

[0196] (s1) The sample to be tested is mixed with the first antibody, the second antibody, the third antibody and the micromagnetic particles, so that the second antibody, the third antibody and the micromagnetic particles bind to the target protein in the sample to form a three-antibody sandwich protein-micromagnetic particle complex, and the three-antibody sandwich protein-micromagnetic particle complex is separated.

[0197] (s2) The triantibody sandwich protein-micromagnetic particle complex is mixed with ligase and the first linker element, so that the ends of the second nucleic acid element and the third nucleic acid element are complementary to the bases of the first linker element to form a double-stranded structure;

[0198] There is a gap of ≤1nt in length between the second and third nucleic acid elements;

[0199] The gaps are joined by ligase to form an amplification template; and

[0200] (s3) Perform nucleic acid amplification reaction on the amplification template to obtain protein detection results.

[0201] In a preferred embodiment, the second nucleic acid element has the structure shown in formula (I):

[0202] Z1-Z2(I)

[0203] In the formula, Z1 consists of 35–95 nucleotides;

[0204] Z2 consists of 5–15 nucleotides;

[0205] The third nucleic acid element has the structure shown in formula (II):

[0206] X1-X2(II)

[0207] In the formula, X1 represents 5 to 15 nucleotides;

[0208] X2 consists of 35–95 nucleotides;

[0209] The first connecting element has the structure shown in formula (III):

[0210] L1-X1'-Z2'-L2(III)

[0211] In the formula, L1 and L2 are each independently 1 to 5 nucleotides;

[0212] X1' is complementary to X1;

[0213] Z2' is complementary to Z2.

[0214] In a preferred embodiment, the nucleotide sequence of the first nucleic acid element is shown in SEQ ID NO:3.

[0215] In a preferred embodiment, the nucleotide sequence of the second nucleic acid element is shown in SEQ ID NO:1.

[0216] In a preferred embodiment, the nucleotide sequence of the third nucleic acid element is shown in SEQ ID NO:2.

[0217] In a preferred embodiment, the nucleotide sequence of the first linker is shown in SEQ ID NO:4.

[0218] In a preferred embodiment, the micromagnetic particles without conjugation to the first antibody are conjugated with the first antibody in step (s1) to form a first antibody-micromagnetic particle conjugate.

[0219] In a preferred embodiment, in step (s1), the mixing is performed in a buffer solution containing the following components: 10–50 mM Na2HPO4, 1–10 mM NaH2PO4, 20–70 mM NaCl, 0.01%–0.5% Tween 20, 0.1%–5% BSA, 50–150 nM IgG, 0.01–1 mg / mL salmon sperm DNA, and 1–10 mM EDTA.

[0220] In a preferred embodiment, in step (s2), the connection is made in a connection system comprising the following components: 10–50 mM Tris-HCl, 1.0–5.0 mM MgCl2, 0.1–1 mM NAD, 1.0–3.0 mM ATP, and 1–50 mM DTT.

[0221] In a preferred embodiment, in step (s2), the connection time is 10 to 60 minutes, more preferably 10 to 40 minutes, more preferably 10 to 30 minutes, for example, about 20 minutes.

[0222] In a preferred embodiment, in step (s2), the connection is performed at 20–40°C, more preferably 20–35°C, even more preferably 20–30°C, for example, about 25°C.

[0223] like Figure 1 As shown, the principle of the method of the present invention is that a first antibody, a second antibody, and a third antibody specifically recognize and bind to a target protein. The first antibody is also coupled with micromagnetic particles, thereby forming a three-antibody sandwich protein-micromagnetic particle complex. The target protein is captured by the micromagnetic particles coupled with the first antibody. The second and third antibodies bind to the target protein, thereby reducing the distance between the second and third antibodies. In the presence of a first linker element, the second and third nucleic acid elements, respectively coupled to the second and third antibodies, undergo base complementary pairing with the first linker element to form a double-stranded structure. Under the action of a ligase, the first and second nucleic acid elements are linked to form an amplification template. The amplification template is isolated and subjected to a nucleic acid amplification reaction to obtain the detection result.

[0224] The main advantages of this invention include:

[0225] 1. The method of the present invention has simple operation steps, low cost, and easy-to-develop supporting instruments.

[0226] 2. The method of the present invention has good specificity, high sensitivity, and low background signal, and can be used for multiple detection.

[0227] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0228] General Method

[0229] 1. Preparation of affinity probes: Monoclonal or polyclonal antibodies are bound to amino-modified oligonucleotides via aromatic hydrazide chemistry to form affinity probes with phosphorylated or biotin-modified 5' or 3' ends.

[0230] Probe 1: An oligonucleotide chain with an amino group modified at the 5' end, ranging in length from 40 to 100 bp, depending on the spatial distance of the antibody used, to ensure sufficient length for splicing.

[0231] Probe 2: An oligonucleotide chain with amino modification at the 3' end, ranging in length from 40 to 100 bp, depending on the spatial distance of the antibody used, to ensure sufficient length for splicing.

[0232] The lengths of probes 1 and 2 can be either one long and one short, or they can be the same length.

[0233] The probe has an amino group modified at the 5' end and a biotin group modified at the 3' end; the modification directions can be reversed. The oligonucleotide length can range from 5 to 30 bp. Biotin can also be used to directly label antibodies.

[0234] 2. Sample incubation and capture: Add the sample to the mixture of affinity probe and magnetic beads, and incubate at 37°C for 0.5 to 2 hours to allow the target analyte to bind to the antibody in the affinity probe and be captured by the magnetic beads.

[0235] This invention combines the immune reaction and the purification of the binding product into one step, and the reaction solution is suitable for both steps, enhancing the purification effect of the immune complex. The incubation time and temperature are determined by the properties of the antigen and antibody.

[0236] 3. Ligation steps: After magnetization, discard the supernatant and add the ligation mixture to the incubated magnetic beads. This mixture contains ligation oligonucleotides, ligase, NAD, DTT, etc., and incubate at 25°C for 10-30 minutes to carry out the ligation reaction.

[0237] The ligase can be the common T4 or T7 ligase, or other ligases suitable for sticky end ligation.

[0238] 4. qPCR quantification: Add the ligation product to the PCR reaction solution containing primers and probes, and perform quantitative analysis using real-time qPCR. The qPCR conditions include 95℃ pre-denaturation for 10 minutes, followed by 95℃ denaturation for 15 seconds, and 60℃ extension for 60 seconds, for a total of 40 cycles.

[0239] Depending on the designed oligonucleotide sequence, detection methods can employ variable-temperature and isothermal amplification techniques such as qPCR, ddPCR, RPA, and LAMP.

[0240] 5. Data Analysis: Convert the Ct values ​​of qPCR into an estimated number of ligation molecules and calculate the detection limit. Calibrate by setting up standards and plotting a standard curve, and calculate the actual concentration of the sample based on the Ct values.

[0241] Incubation buffer formulation: Na₂HPO₄, NaH₂PO₄, NaCl, Tween 20, BSA, IgG, salmon sperm DNA, EDTA

[0242] The ligation system formulation consists of Tris-HCl, MgCl2, ATP, NAD, DTT, and T4 ligase.

[0243] Amplification method: 95℃ for 5 min, 95℃ for 30 s, 60℃ for 30 s, 45 cycles.

[0244] Example 1

[0245] 1.1 Method

[0246] This embodiment uses a three-antibody ligation reaction to detect pTau217, and the specific steps are as follows.

[0247] 1. Detection probe and sequence: The detection probe consists of one pTau217 specific antibody and two total Tau antibodies (identical labels indicate sequence complementarity).

[0248] Probe 1: 5'-NH2-C6-TTATCGACTGCCTCTACGGTGATCTCGTATGACCATT AATGTTAATTTGCTCGGCACAACAAACAAGATT TTCCTGCTCG -3'(SEQ ID NO:1)

[0249] Probe 2: 5'-P- TCAGCCGTGC CGCTCCACTGAGAAATCTGGCTGGATCCAT ATCAC-NH2-C6-3'(SEQ ID NO:2)

[0250] Probe 3: 5'-NH2-C6-AAGGAGACTACGAAT-Biotin-3' (SEQ ID NO: 3)

[0251] In this configuration, probe 1 is linked to total Tau antibody 1 via its 5' NH2 end; probe 2 is linked to total Tau antibody 2 via its 3' NH2 end; and probe 3 is linked to pTau217 antibody via its 5' NH2 end. The linking was performed using a conjugation kit (purchased from Abcam). The pTau217 antibody used to link probe 3 is a capture antibody.

[0252] Connection fragment: TTT GCACGGCTGACGAGCAGGAA TTT (SEQ ID NO:4)

[0253] F1:GACCATTAATGTTAATTTGCTCG(SEQ ID NO:5)

[0254] R1:TGGATCCAGCCAGATTTCT(SEQ ID NO:6)

[0255] P1:CAACAAACAAGATTTTCCTGCTCGTCAGC(SEQ ID NO:7)

[0256] 2. Sample incubation and capture: The prepared standard was added to a mixture (200 μl) of affinity probe and magnetic beads (5 μl) and incubated at 37 °C for 1.5 hours to allow the target analyte to bind to the antibody in the affinity probe and be captured by the magnetic beads. The concentration of pTau217 antibody was 1.5 nM, the concentration of total Tau antibody 1 was 0.5 nM, and the concentration of total Tau antibody 2 was 0.2 nM.

[0257] Incubation buffer formulation: 20mM Na2HPO4, 5mM NaH2PO4, 50mM NaCl, 0.1% Tween 20, 1% BSA, 100nM IgG, 0.1mg / mL salmon sperm DNA, 4mM EDTA.

[0258] Preparation of standards: Commercially available antigen and plasma were purchased. The antigen was diluted in the plasma to a concentration of 1 ng / mL. The concentration was determined using the Simao platform from Quanterix. After obtaining the concentration, the antigen was diluted with 1×PBS to 150 pg / mL, 15 pg / mL, 1.5 pg / mL, 150 fg / mL, and 75 fg / mL as standards for the determination of system sensitivity.

[0259] 3. Ligation Steps: After magnetization, discard the supernatant. Add the ligation mixture to the incubated magnetic beads and incubate at 25°C for 20 minutes in a ligation system containing the ligation oligonucleotide (SEQ ID NO:4). The concentration of the ligation oligonucleotide is 3 μM.

[0260] The ligation system formulation is as follows: 20 mM Tris-HCl, 1.5 mM MgCl2, 0.25 mM NAD, 1.5 mM ATP, 10 mM DTT, and 5 U / reaction T4 ligase.

[0261] 4. qPCR quantification: Add the ligation product to the PCR reaction solution containing primers and probes (SEQ ID NO: 5, 6, and 7), and perform quantitative analysis using real-time qPCR. The qPCR conditions include 45 cycles of pre-denaturation at 95°C for 10 minutes, followed by denaturation at 95°C for 15 seconds and extension at 60°C for 60 seconds. The reagents are: 1 μL of 10 μM primers, 0.5 μL of 10 μM probe, 10 μL of 2×PCR mix, and water to a total volume of 20 μL.

[0262] 5. A standard curve can be plotted using the test results of standard samples, which can then be used for the subsequent testing of unknown samples.

[0263] 1.2 Structure

[0264] Table 1. Results of pTau217 detection using the method of the present invention.

[0265] CK 150 pg / mL 15 pg / mL 1.5 pg / mL 150 fg / mL 75 fg / mL Ct1 35.77 25.2 28.47 30.67 33.05 34.06 Ct2 35.95 25.34 28.12 30.65 33.25 34.56 AVE 35.86 25.27 28.295 30.66 33.15 34.31

[0266] Note: AVE stands for average.

[0267] like Figure 2 As shown in Table 1, the method of the present invention can detect 75 fg / mL of pTau217 samples, which meets the sensitivity requirements for clinical detection of the target. Figure 3 The standard curve is shown based on the pTau217 standard.

[0268] The purification process using probe 3 and the capture antibody effectively reduces the original experimental background of PLA technology and improves the detection sensitivity of low-abundance samples.

[0269] Example 2: Screening of Capture Antibodies

[0270] 2.1 Methods

[0271] The experimental steps in this embodiment are as described in Embodiment 1.

[0272] Option 1: As described in Example 1, the pTau217 antibody is a capture antibody.

[0273] Option 2: Probe 1 is linked to pTau217 antibody via its 5' NH2 end; probe 2 is linked to total Tau antibody 2 via its 3' NH2 end; probe 3 is linked to total Tau antibody 1 via its 5' NH2 end. Total Tau antibody 1 serves as the capture antibody.

[0274] Option 3: Probe 1 is linked to pTau217 antibody via its 5' end NH2; probe 2 is linked to total Tau antibody 1 via its 3' end NH2; probe 3 is linked to total Tau antibody 2 via its 5' end NH2. Total Tau antibody 2 is the capture antibody.

[0275] 2.2 Results

[0276] Table 2. Test results of Scheme 2

[0277] CK 150 pg / mL 15 pg / mL 1.5 pg / mL 150 fg / mL 75 fg / mL Ct1 35.27 24.93 28.22 31.47 33.84 34.88 Ct2 35.41 24.56 27.98 31.59 33.42 34.93 AVE 35.34 24.745 28.1 31.53 33.63 34.905

[0278] Note: AVE stands for average.

[0279] Table 3. Test results of Scheme 3

[0280] CK 150 pg / mL 15 pg / mL 1.5 pg / mL 150 fg / mL 75 fg / mL Ct1 35.84 24.37 28.42 31.53 33.7 34.65 Ct2 35.21 24.98 28.69 31.2 33.52 34.23 AVE 35.525 24.675 28.555 31.365 33.61 34.44

[0281] Note: AVE stands for average.

[0282] The results of Scheme 1 are as described in Example 1, and the results of Scheme 2 are as described in Example 2. Figure 4 As shown in Table 2, the results of Scheme 3 are as follows: Figure 5 As shown in Table 3.

[0283] The above results indicate that when using three antibodies to detect pTau217, the capture antibody can be any one of the three antibodies without affecting the experimental results.

[0284] Example 3: Detection of carcinoembryonic antigen using the method of the present invention

[0285] Using carcinoembryonic antigen (CEA) as the target, the method in this embodiment is as described in Example 1, using an anti-CEA antibody instead of an anti-tau antibody. Specifically, probe 1 is linked to anti-CEA antibody 1; probe 2 is linked to anti-CEA antibody 2; and probe 3 is linked to anti-CEA antibody 3.

[0286] Preparation of standards: Purchase commercially available antigen and plasma. Dilute the antigen into the plasma to a concentration of 10 ng / mL. Use the Simao platform from Quanterix for determination. After obtaining the determination, dilute the antigen to 1 ng / mL, 100 pg / mL, 10 pg / mL, and 1 pg / mL with 1×PBS to obtain standards for the determination of system sensitivity.

[0287] Table 4. Results of carcinoembryonic antigen detection using the method of the present invention.

[0288] CK 1ng / mL 100 pg / mL 10 pg / mL 1 pg / mL Ct1 3719 2595 292 3219 3495 Ct2 3756 2583 2936 3255 347 AVE 37375 2589 2928 3237 34825

[0289] Note: AVE stands for average.

[0290] The results are as follows Figure 6 As shown in Table 4, the method of this invention has high sensitivity and can detect target proteins as low as 1 pg / mL.

[0291] Comparative Example

[0292] Magnetic bead preparation: Wash the magnetic beads. Wash 5 μL of magnetic beads four times with 1xPBS.

[0293] Immune response: Incubate with 200 nM capture antibody for 1 hour.

[0294] Blocking and washing: Wash three times with 1xPBS. Incubate twice with Thermo Fisher's casein blocking solution for 15 minutes each time. Wash three times with 1xTBST (containing 25 mM Tris, 0.15 M NaCl, 0.05% Tween-20, pH 7.5).

[0295] Antibody immobilization: Biotin-labeled oligonucleotides were immobilized on streptavidin-coated magnetic beads.

[0296] Capture and release: Capture antibodies are released using release oligonucleotides via chain substitution.

[0297] Detection: PLA technology is used to identify when both detection antibodies bind to the same analyte. qPCR quantification is performed using TaqMan probes.

[0298] Table 5. Results of carcinoembryonic antigen detection in this embodiment.

[0299] CK 1ng / mL 100 pg / mL 10 pg / mL Ct1 NoCt 2614 3093 3384 Ct2 NoCt 2607 3082 3376 AVE NoCt 26105 30875 338

[0300] The results are as follows Figure 7 As shown in Table 5.

[0301] The comparative results show that the Ct values ​​for samples of the same concentration are delayed. This method involves two purification steps (especially the dT magnetic bead purification step), resulting in some signal loss and preventing the sensitivity from reaching optimal levels. Although this method can reduce background noise, it has been verified that there is a certain degree of sensitivity loss. Furthermore, the magnetic bead purification process is relatively complex, the system stability is relatively poor, and instrument development is also quite difficult.

[0302] In comparison, the method of this invention is simpler, more convenient for both manual operation and instrument development, and yields better stability and sensitivity.

[0303] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A multi-antibody linked capture immunoassay method characterized in that, The method comprises the steps of: (s0) providing a sample to be tested, magnetic micro-particles, a first antibody, a second antibody, a third antibody, a ligase, and a first linking element, wherein the magnetic micro-particles are coupled with the first antibody or the magnetic micro-particles without the first antibody can contact with the first antibody to form a first antibody-magnetic micro-particle conjugate, the second antibody is coupled with a second nucleic acid element, and the third antibody is coupled with a third nucleic acid element; (s1) mixing the sample to be tested with the first antibody, the second antibody, the third antibody, and the magnetic micro-particles at the same time, so that the second antibody, the third antibody, and the magnetic micro-particles bind to target proteins in the sample to be tested to form a three-antibody sandwich protein-magnetic micro-particle complex, and separating the three-antibody sandwich protein-magnetic micro-particle complex; (s2) mixing the three-antibody sandwich protein-magnetic micro-particle complex with the ligase and the first linking element, so that the ends of the second nucleic acid element and the third nucleic acid element base-pair with the first linking element to form a double-stranded structure; a gap with a length of ≤1 nt exists between the second nucleic acid element and the third nucleic acid element; the gap is connected under the action of the ligase, thereby forming an amplification template; and (s3) performing a nucleic acid amplification reaction on the amplification template, thereby obtaining a protein detection result; wherein the first antibody, the second antibody, and the third antibody are antibodies that specifically bind to the same target protein and bind to different sites of the same target protein, thereby forming a three-antibody sandwich protein-magnetic micro-particle complex; in step (s1), the content of the target protein in the sample to be tested is 50 fg / mL to 1 μg / mL; the concentration of the first antibody is 0.1 to 50 nM; the concentration of the second antibody-nucleic acid conjugate is 0.01 to 10 nM; and the concentration of the third antibody-nucleic acid conjugate is 0.01 to 10 nM; and the nucleotide sequence of the second nucleic acid element is shown in SEQ ID NO: 1; the nucleotide sequence of the third nucleic acid element is shown in SEQ ID NO: 2; and the nucleotide sequence of the first linking element is shown in SEQ ID NO:

4.

2. The method of claim 1, wherein, in step (s1), the amount of the magnetic micro-particles is 1 to 20 μL.

3. The method of claim 1, wherein, in step (s1), the amount of the magnetic micro-particles is 1 to 10 μL.

4. The method of claim 1, wherein, the step (s1) is performed at 20 to 50°C, and the mixing time is 0.5 to 3 h.

5. The method of claim 1, wherein, in step (s2), the amount of the ligase is 1 to 10 U per reaction.

6. The method of claim 1, wherein, the 5' end of the second nucleic acid element is covalently linked to the second antibody, and the 3' end of the third nucleic acid element is covalently linked to the third antibody.

7. The method of claim 1, wherein, in step (s1), the concentration of the first antibody is 0.5 to 10 nM; the concentration of the second antibody-nucleic acid conjugate is 0.05 to 5 nM; and the concentration of the third antibody-nucleic acid conjugate is 0.05 to 5 nM.

8. The method of claim 1, wherein, in step (s2), the concentration of the first linking element is 0.1 to 50 µM.

9. The method of claim 1, wherein, in step (s1), the content of the target protein in the sample to be tested is 50 fg / mL to 500 pg / mL.

10. The method of claim 1, wherein, the sample to be tested comprises a plasma sample.

11. The method of claim 1, wherein, In step (s1), the concentration of the first antibody is 1-5 nM; the concentration of the second antibody-nucleic acid conjugate is 0.1-1 nM; and the concentration of the third antibody-nucleic acid conjugate is 0.1-1 nM.

12. The method of claim 1, wherein, In step (s2), the concentration of the first linker is 0.5-20 µM.

13. The method of claim 1, wherein, In step (s1), the ratio of the second antibody to the third antibody is 1:1-1:

10.

14. A protein detection system, characterized by, Comprise: (a) a first antibody-micro-magnetic particle conjugate; (b) a second antibody-nucleic acid conjugate and a third antibody-nucleic acid conjugate; and (c) a first linker; wherein the first antibody, the second antibody, and the third antibody are antibodies that specifically bind to the same target protein and bind to different sites of the same target protein; the first antibody-micro-magnetic particle conjugate refers to a micro-magnetic particle conjugated with a first antibody, the second antibody-nucleic acid conjugate refers to a second antibody conjugated with a second nucleic acid element, and the third antibody-nucleic acid conjugate refers to a third antibody conjugated with a third nucleic acid element; the concentration of the first antibody is 0.1-50 nM; the concentration of the second antibody-nucleic acid conjugate is 0.01-10 nM; and the concentration of the third antibody-nucleic acid conjugate is 0.01-10 nM; and the nucleotide sequence of the second nucleic acid element is shown in SEQ ID NO: 1; the nucleotide sequence of the third nucleic acid element is shown in SEQ ID NO: 2; and the nucleotide sequence of the first linker is shown in SEQ ID NO:

4.

15. The protein detection system of claim 14, wherein the protein is a protein of interest. 15 The protein detection system further comprises (d) a protein to be detected.

16. A protein detection kit, characterized by Comprise: (i) a first container and a micro-magnetic particle and a first antibody or a first antibody-micro-magnetic particle conjugate in the first container; (ii) a second container and a second antibody, a third antibody, a second nucleic acid element, and a third nucleic acid element or a second antibody-nucleic acid conjugate and a third antibody-nucleic acid conjugate in the second container; and (iii) a third container and a first linker in the third container; wherein the micro-magnetic particle is not conjugated with the first antibody; the first antibody, the second antibody, and the third antibody are antibodies that specifically bind to the same target protein and bind to different sites of the same target protein; the first antibody-micro-magnetic particle conjugate refers to a micro-magnetic particle conjugated with a first antibody, the second antibody-nucleic acid conjugate refers to a second antibody conjugated with a second nucleic acid element, and the third antibody-nucleic acid conjugate refers to a third antibody conjugated with a third nucleic acid element; the concentration of the first antibody is 0.1-50 nM; the concentration of the second antibody-nucleic acid conjugate is 0.01-10 nM; and the concentration of the third antibody-nucleic acid conjugate is 0.01-10 nM; and the nucleotide sequence of the second nucleic acid element is shown in SEQ ID NO: 1; the nucleotide sequence of the third nucleic acid element is shown in SEQ ID NO: 2; and the nucleotide sequence of the first linker is shown in SEQ ID NO:

4. A protein detection kit for detecting an Alzheimer's disease biomarker in a sample to be detected.

17. Use of a protein detection system according to claim 14 or a protein detection kit according to claim 16, characterized in that, A protein detection kit for detecting an Alzheimer's disease biomarker in a sample to be detected.

Images