A new species of helicosporium with siderophore production and its application in the prevention and treatment of plant diseases as a biocontrol agent

By developing a new species of Clonostachys Hainanensis HNU01 to produce iron-binding ligands to chelate Fe2+, the biological control problem of avocado root rot was solved, and effective inhibition of multiple plant pathogens was achieved, reducing the use of chemical pesticides and protecting the environment.

CN119372064BActive Publication Date: 2025-10-17HAINAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411379346.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-30
Publication Date
2025-10-17
Estimated Expiration
2044-09-30

AI Technical Summary

Technical Problem

The existing technology lacks effective biological control measures to control avocado root rot, chemical pesticide control causes environmental pollution, and there are few existing microbial preparations that make it difficult to effectively inhibit a variety of plant pathogens.

Method used

A new strain of Clonostachys Hainanensis HNU01 is provided. It has the ability to produce siderophores and can chelate Fe2+ by producing iron-binding ligands, thereby inhibiting the growth of various plant pathogens, including harmful red dermatophytes and cinnamon phytophthora.

Benefits of technology

Clonostachys Hainanensis HNU01 significantly inhibits a variety of plant pathogens, reduces the use of chemical pesticides, protects the environment, and provides a new biocontrol agent option suitable for the prevention and control of root rot in a variety of plants such as avocado, loquat, and longan.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119372064B_ABST
    Figure CN119372064B_ABST
Patent Text Reader

Abstract

The application discloses a Clonostachys Hainanensis HNU01 strain with iron carrier production capacity, and application of the strain as a biocontrol bacterium in prevention and treatment of plant diseases. The application identifies a fungus Clonostachys Hainanensis HNU01 with extremely strong iron carrier production capacity and inhibition effect on various pathogenic bacteria from rhizosphere soil in a Chinese olive production area. The fungus is identified as a new Clonostachys strain, has broad-spectrum inhibition capacity, can inhibit growth of various plant pathogenic bacteria, has great prospects as a biocontrol bacterium for preventing and treating olive root rot, and is expected to provide a new biocontrol selection for prevention and treatment of plant diseases.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of microorganisms and plant disease control, and particularly relates to a new species of helicosporium with iron carrier production capacity and application of the new species as a biocontrol agent in plant disease control. BACKGROUND

[0002] Persea americana Mill. is also known as avocado, and is a kind of fast-growing evergreen fruit tree in tropical and subtropical regions, which can be used as woody oil tree species, and originates from Central America and Mexico. The planting area of avocado is second only to mango in the world's tropical fruits, and is one of the rare fruit trees with remarkable economic benefits in the tropical regions of China. Avocado has multiple uses such as grain, fruit, oil and medicine, and has high nutritional value, with high unsaturated fatty acids, high protein, high heat and low sugar, and contains rich vitamins, calcium, magnesium, sodium and other mineral elements and various amino acids, and is a high-energy low-sugar and easily-digestible health food. China began to introduce avocado in 1918, and in 1975, through introduction experiments, regional experiments and variety comparison experiments, suitable avocado varieties for planting in China were selected from multiple domestic and foreign strains, and the avocado tree is a shallow-rooted fruit tree that likes light, warm and humid climate and is not cold and waterlogging tolerant.

[0003] Root rot is caused by a variety of pathogens, which is a soil-borne disease with complex fungi and oomycetes. Soil-borne pathogens infect plant roots, causing the release of toxic mobile metabolites, leading to the imbalance of plant hormone levels and affecting the plant photosynthesis system, resulting in disease. Avocado root rot first infects the root tip, then gradually spreads to the lateral roots, main roots and stem base, causing the roots to turn black and rot, damaging the plant root tissue, causing water deficiency in the aboveground part, yellowing of the leaves, blackening of the leaf edges, and eventually leading to the withering and death of the whole plant. Root rot has a long incubation period, and factors such as soil moisture, poor drainage, and large temperature differences are closely related to the occurrence of avocado root rot. Generally, the occurrence of root rot is more serious in low-lying areas after heavy rain, and once it breaks out, it will spread rapidly, causing a large number of trees to die, which may greatly reduce the yield of avocado trees all over the world and limit the development of the avocado industry. The pathogens that have been reported to cause avocado root rot at home and abroad include Pythium spp., Phytophthora spp., and Fusaritun spp., among which Phytophthora root rot is the main factor limiting the productivity of avocado orchards. Phytophthora cinnamomi is a soil-borne, semi-biological nutrient plant pathogenic oomycete that is the pathogen of root rot, ulcer disease and death of thousands of plant species worldwide. It has a very wide host range and can cause root rot disease in thousands of woody plants worldwide. In recent years, researchers have found that brown root rot caused by Pyrrhoderma noxium is the key factor leading to the death of young avocado plants. Currently, the damage caused by Pyrrhoderma noxium has been reported in economic crops such as loquat, longan, lychee, wax apple, and camphor tree.

[0004] Chemical pesticides can effectively control root rot pathogens, but chemical control methods can easily cause pesticide residues, leading to environmental pollution and food safety problems, prompting people to start looking for alternative measures. Biological control is very friendly to agricultural sustainable development and is a measure worth popularizing and developing, but there are few commercial microbial preparations in China and even the world, and microbial preparations targeting avocado root rot pathogens are even rarer. In order to promote green agricultural development and strengthen the research and development of green production technology, it is a breakthrough point in disease control to use environmentally friendly and cost-effective biological resources to manage diseases while controlling fertilizers and pesticides. It is of great significance to actively explore and screen new biocontrol agents and their metabolites for the prevention and control of avocado root rot and other plant-related diseases. Many effective antagonistic substances are only expressed under specific conditions, and blind intervention of foreign microorganisms may harm other beneficial microorganisms in the local or natural habitat. Therefore, it is necessary to find new biocontrol agents from healthy avocado tissues and their production areas to provide new options for biological control of avocado root rot. SUMMARY

[0005] The application aims at the above problems, and provides a Clonostachys Hainanensis HNU01 strain with siderophore production capacity and application of the strain as a biocontrol agent in preventing and treating plant diseases.

[0006] In order to achieve the purpose, the application adopts the technical scheme of:

[0007] The first aspect of the application provides a Clonostachys Hainanensis HNU01 strain, which is preserved in the China General Microbiological Culture Collection Center and has a preservation registration number of CGMCC No.41461.

[0008] The second aspect of the application provides application of the above Clonostachys Hainanensis HNU01 or a fermentation liquor thereof in any of the following aspects:

[0009] (1) application in inhibiting a root rot pathogen or preventing and treating a plant root rot;

[0010] (2) application in preparing a product for inhibiting a root rot pathogen or preventing and treating a plant root rot.

[0011] Preferably, in the application technical scheme, the plant includes avocado, loquat, longan, litchi, wax apple, camphor tree.

[0012] Preferably, in the application technical scheme, the root rot pathogen includes Pyrrhoderma noxium and Phytophthora cinnamomi.

[0013] The third aspect of the application provides application of the above Clonostachys Hainanensis HNU01 or a fermentation liquor thereof in inhibiting a plant pathogenic fungus or preventing and treating a plant disease caused by the plant pathogenic fungus, wherein the plant pathogenic fungus includes Phytophthora infestans, Phytophthora capsici, Peronophthora litchii, Colletotrichum acutatum, Colletotrichum fragariae, Fusarium oxysporum f.sp, Fusarium oxysporum (Schl.) F. sp cucumerinum Owen. anamorph and Curvularia fallax.

[0014] The fourth aspect of the present application provides a product for inhibiting plant pathogenic bacteria or preventing plant diseases, wherein the active ingredient comprises any one of the following:

[0015] (1) the Clonostachys Hainanensis HNU01 mentioned above;

[0016] (2) the fermentation liquor of the Clonostachys Hainanensis HNU01.

[0017] The plant pathogenic bacteria in the product technical solution include Pyrrhoderma noxiu, Phytophthora cinnamomi, Phytophthora infestans, Phytophthora capsici, Peronophthora litchii, Colletotrichum acutatum, Colletotrichum fragariae, Fusarium oxysporum f.sp, Fusarium oxysporum (Schl.) F.sp cucumerinum Owen. anamorph, and Curvularia fallax.

[0018] The plants in the product technical solution include oil olive, loquat, longan, litchi, lotus, camphor tree, potato, tomato, pepper, mango, strawberry, banana, and cucumber.

[0019] The present application has the following beneficial effects:

[0020] The present application isolates and identifies a strain of Clonostachys Hainanensis HNU01 from the rhizosphere soil in a healthy production area of Chinese olive, which has a strong ability to produce iron carrier and has a bacteriostatic effect on a variety of pathogenic bacteria. The fungus Clonostachys Hainanensis HNU01 is a new species of Clonostachys, which has a broad-spectrum bacteriostatic ability, can inhibit the growth of a variety of plant pathogenic bacteria, has strong growth ability, strong salt and alkali tolerance, can utilize a variety of carbon and nitrogen sources, has the ability to produce iron carrier, and can chelate Fe 2+The membrane-bound protein receptor specifically recognizes and absorbs the siderophore-Fe complex, preventing pathogens from acquiring iron, thereby reducing plant pathogen infection. This is a broad-spectrum biocontrol fungus with significant pathogen inhibition effects. The fungus Clonostachys Hainanensis HNU01, described in the present invention, has great potential as a biocontrol agent for avocado root rot, potentially providing a new biocontrol option for plant disease control, reducing the use of chemical pesticides, and protecting the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a phylogenetic tree constructed based on the TEF gene sequence of Polysporidium spiralis HNU01, with Trichoderma as the outgroup, using the neighbor-joining method.

[0022] Figure 2 The ANI values ​​of the strain HNU01 were calculated based on the alignment of the Scaffold sequence of the Agrobacterium spiralis with other species identified by KmerFinder (using the OrthoANI algorithm and BLAST calculations performed by the ANI tool OAT software).

[0023] Figure 3 These are the results of the antagonistic activity experiment of Clonostachys Hainanensis HNU01 against the avocado root rot pathogens Pyrrhoderma noxium A20 and Phytophthora cinnamomi YLPC0321.

[0024] Figure 4 This is a scanning electron micrograph of a Clonostachys Hainanensis HNU01 plate against the avocado root rot pathogens Pyrrhoderma noxium A20 and Phytophthora cinnamomi YLPC0321.

[0025] Figure 5Fig. 1 is a morphological chart and a mycelium spore chart of Clonostachys Hainanensis HNU01 cultured at 26°C in the dark for different days, wherein a is a 10x100 microscope observation chart of mycelium spores of the strain cultured at 26°C in the dark for 3 days, b is a 10x40 microscope observation chart of mycelium spores of the strain cultured at 26°C in the dark for 7 days, c is a 10x100 microscope observation chart of mycelium spores of the strain cultured at 26°C in the dark for 7 days, d is a morphological chart of the strain cultured at 26°C in the dark for 3 days, e is a morphological chart of the strain cultured at 26°C in the dark for 7 days, and f is a morphological chart of mature fungi of the strain cultured at 26°C in the dark for 20 days.

[0026] Figure 6 Fig. 4 is a result of a temperature tolerance experiment of Clonostachys Hainanensis HNU01.

[0027] Figure 7 Fig. 5 is a result of an acid and alkali tolerance experiment of Clonostachys Hainanensis HNU01.

[0028] Figure 8 Fig. 6 is a result of a carbon and nitrogen source utilization ability experiment of Clonostachys Hainanensis HNU01.

[0029] Figure 9 Fig. 7 is a result of an iron carrier production ability experiment of Clonostachys Hainanensis HNU01.

[0030] Figure 10 Fig. 8 is a result of a broad-spectrum antibacterial experiment of Clonostachys Hainanensis HNU01. DETAILED DESCRIPTION

[0031] The present application will be further described below in conjunction with examples, but the present application is not limited by the examples.

[0032] In the following examples, the experimental methods are conventional methods unless otherwise specified.

[0033] The main reagent sources are as follows:

[0034] The culture media used in the examples are conventional culture media in the art unless otherwise specified.

[0035] Example 1, Isolation, Identification and Antagonistic Activity of Clonostachys Hainanensis HNU01 Strain

[0036] I. Isolation of the strain HNU01

[0037] In November 2022, we went to the Camellia oleifera Germplasm Garden of Danzhou Campus of Hainan University and the C. oleifera plantation in Chengmai County of Hainan Province to collect the root tissues and rhizosphere soil of C. oleifera with different disease severity. More than 300 strains of endophytic fungi were isolated from C. oleifera tissues, among which 70 strains of representative fungi and 70 strains of bacteria were obtained. Gradient dilution method and confrontation culture method were used to screen potential biocontrol fungal strains HNU01 with strong inhibitory effect on Phytophthora cinnamomi and harmful Laetiporus cinnabarreus. After 5 days of inoculation and culture, 5 mm fungal cakes were punched along the edge of the colony and transferred to new PDA culture medium for purification culture. The purified strain HNU01 was preserved by glycerol preservation method at -20℃ and test tube preservation method at 4℃.

[0038] II. Identification of strain HNU01

[0039] DNA extraction: 0.1 g of fresh mycelium was scraped with a sterile key, and genomic DNA was extracted using a fungal DNA extraction kit (OMEGA BIO-TEK). TEF gene sequence was used for fungal PCR amplification. The amplification system and program were adjusted according to the sequence of the universal primer of fungal PCR amplification. The reaction system is shown in Table 1, and the amplification primer sequence is shown in Table 2. The PCR reaction program is as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ final extension for 2 min.

[0040] Table 1 Sequence amplification system

[0041]

[0042] Table 2 PCR amplification universal primer gene sequence

[0043]

[0044] The amplified products were detected by 1% agarose gel electrophoresis and purified, and then sent to a sequencing company for DNA sequence determination. The fungal spliced sequence was submitted to NCBI for BLAST comparison; after comparison, the target gene sequence was submitted to GenBank, and the TEF gene sequence of strain HNU01 was submitted to GeneBank for homologous comparison. It was found that the TEF sequence of strain HNU01 had a high homology of 99%~100% with Clonostachys pseudochroleuca culture CBS:191.94 (OQ944678.1). The MEGA 11.0 software was used to construct a phylogenetic tree Figure 1), HNU01 was determined as Clonostachys genus fungi, but the specific classification strain could not be determined, and whole genome sequencing was carried out again, based on the ANI value calculation of the fungal Scaffold sequence alignment of HNU01 strain and other similar genus and species of KmerFinder species identification, the classification threshold (ANI <95%) identified HNU01 as a new species of Clonostachys genus fungi (Clonostachys) Figure 2 ), which is named as Clonostachys Hainanensis HNU01.

[0045] The TEF sequence of Clonostachys hainanensis HNU01 is as follows (SEQ ID NO.3): CACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCTATTCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTTAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAACTGGTCTGAGGCCCGTTTCCAGGAAATCATCAAGGAGACCTCCTCTTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTGCCTTCGTCCCCATCTCCGGTTTCCACGGTGACAACATGCTGTCCCCCTCCACCAACGCCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCTGGCAAGTCCTCCGGCAAGACCCTCCTCGAGGCCATTGACTCCATTGAGCCCCCCAAGCGTCCTCTTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATCGGCACAGTACCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTTGAGATGCACCACGAGCAGCTCGCCGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGATATCCGCCGTGGTAACGTCGCTTCCGACTCCAAGAACGACCCTGCTTCAGGTGCCGCTTCTTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGACAGGTCGGTGCTGGTTACGCTCCCGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTTCTCGAGAAGATCGATCGCCGAACTGGTAAGGCTACTGAGGCCAACCCCAAGTTCATCAAGTCTGGTGACTCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTCACCGACTACCCTCCTCTGGGCC.

[0046] The preservation information of Clonostachys Hainanensis HNU01 is as follows:

[0047] Clonostachys Hainanensis HNU01 was sent to China General Microbiological Culture Collection Center (CGMCC) for preservation on July 2024. The address of the preservation unit is No. 3, Beichen West Road, Haidian District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The preservation date is July 8, 2024, the preservation number is CGMCC NO. 41461, and the classification and naming is Clonostachys Hainanensis.

[0048] III. Antagonistic activity of Clonostachys Hainanensis HNU01 strain on oil pear root rot:

[0049] A20 (abbreviated as A20) and Phytophthora cinnamomi YLPC0321 (abbreviated as PC, provided by Professor Xie Changping's team from the College of Plant Protection, Hainan University) were used as target pathogens for antagonistic screening of the isolated strain HNU01. A 5mm diameter target fungus cake was inoculated in the center of the corresponding medium (A20 was inoculated in potato medium, and PC was inoculated in rye medium). The antagonistic bacteria HNU01 were inoculated at a distance of 2.5cm from the pathogen using the four-point method, and the blank medium was used as a control. Each endophytic fungus was repeated three times. The medium inoculated with A20 was incubated at 25℃ in the dark for 20 days, and the medium inoculated with PC was incubated at 20℃ in the dark for 15 days. The growth of the colonies was observed daily, and the diameter of the target colony was measured using the cross method.

[0050]

[0051] The growth of the pathogen was observed daily when HNU01 was co-cultured with the root rot fungi (A20 and PC) and not co-cultured. The mycelial growth of the co-cultured pathogen in the treatment group was inhibited. Compared with the control group, A20 was inhibited on the seventh day, and on the tenth day, the A20 mycelium was significantly inhibited, the colony began to wither and shrivel from the surrounding, and on the fifteenth day, most of the A20 colonies were inhibited and showed withered or shriveled state. On the twentieth day, the A20 colony was completely inhibited, and the mycelium was in a withered or shriveled state. The colony diameter of the A20 culture was reduced by 86.92mm compared with the A20 colony alone, with an inhibition rate of 96.58% Figure 3) ; PC colonies in confrontation with HNU01 were inhibited, antagonism occurred at the seventh day, and the tenth day, PC hyphae were attached and inhibited by HNU01, and at the fifteenth day, the fluffy PC colonies were completely inhibited, and the hyphae could not grow around, the diameter of PC colonies in confrontation with HNU01 was reduced by 81.20 mm, and the inhibition rate was 89.10% compared with PC colonies cultured alone. Figure 3 The results showed that the mycelium of pathogenic fungi in the control group was thick, full, straight, uniform and regular; the mycelium of pathogenic fungi in the treatment group was shriveled and wrinkled, the mycelium was broken, bent and short, the mycelium was parasitized or wrapped by the antagonistic bacteria and inhibited growth, the mycelium structure was severely damaged, and the pathogenic fungi showed abnormal growth or stopped growing. After detection, the plates were placed at room temperature for several months, and when observed again, it was found that the root rot fungi were still in the state of inhibited growth, which indicated that HNU01 had a significant antibacterial effect on the root rot fungi A20 and PC Figure 3

[0052] Four, scanning electron microscopy observation of Clonostachys hainanensis HNU01 strain antagonizing Phytophthora cactorum

[0053] At 20 days of confrontation culture, the antagonistic bacteria and pathogenic bacteria at the junction on the plate were transferred to a 2 ml centrifuge tube containing electron microscope fixing solution by scalpel, and then fixed at 4°C for 10 hours before being sent to the China Science and Technology Measurement Center for scanning electron microscopy observation.

[0054] The observation results Figure 4 ) showed that the results were consistent with the above naked eye observation results, A20 was observed at 1000 times, the colony was dense and regular, at 200 times, the mycelium was observed to be dense and overlapped layer by layer, and at 100 times and 50 times, the observation results were consistent, and under 1000 times of HNU01 confrontation culture, the colony was observed to be irregular, at 200 times, the A20 mycelium was observed to be attached and inhibited by the broom-like mycelium, and the original thick mycelium wall was damaged, at 100 times and 50 times, it was observed that the A20 mycelium was broken and damaged and could not grow and reproduce normally; PC was observed at 1000, 200, 100 and 50 times, the colony was regularly distributed, the mycelium was healthy and had a tendency to grow, and under 1000 times of HNU01 confrontation culture, the colony was observed to be irregular, at 200 times, the PC mycelium was observed to be attached and inhibited by the broom-like mycelium, and the original thick mycelium wall was damaged and could not grow normally, at 100 times and 50 times, it was observed that the PC mycelium was different from that cultured alone, only the HNU01 mycelium was in good condition, and the PC mycelium was shriveled and twisted and was wrapped by HNU01 and could not grow and reproduce normally. In summary, the pathogenic bacteria were attached and inhibited by the broom-like mycelium of the antagonistic bacteria, the pathogenic bacteria mycelium was broken or showed a wrinkled phenomenon, and the control group colonies grew well, were fluffy and regular, and the mycelium was dense. ​

[0055] Example 2, Morphological and growth force test experiment of Clonostachys Hainanensis HNU01 strain

[0056] I. Morphological identification of Clonostachys Hainanensis HNU01

[0057] After isolation and purification, Clonostachys Hainanensis HNU01 was inoculated in potato medium for 20 days, and the apparent growth state was observed under microscope to observe the growth and development state of spores and mycelium.

[0058] Photographs were taken to record the growth of the colonies at 3 days, 7 days, and 20 days when the colonies showed obvious changes Figure 5 ). The mycelium of HNU01 grew slowly in the early stage and was densely distributed. After 20 days of dark culture at 26°C, the mycelium diameter reached about 6 cm. In the early stage of growth, the center of the colony was light yellow, gradually changing to white at the edge, and the mycelium grew radially outward. In the later stage of culture, the colony collapsed and thickened, with yellow powder attached, and the mycelium was short and slightly irregular flower-shaped. Microscopic observation showed that the early spores of HNU01 were small and dense, oval-shaped, and the later mycelium was broom-shaped, with a large number of motile spores densely distributed around the mycelium.

[0059] II. Temperature tolerance experiment of Clonostachys Hainanensis HNU01

[0060] Long and well-grown HNU01 was taken, and mycelium blocks (5 mm in diameter) were punched at the edge of the colony and inoculated in the center of PDA plates (90 mm in diameter). Each treatment was inoculated in 3 plates as 3 replicates. The plates were inverted at 4°C, 20°C, 26°C, 34°C, and 38°C, respectively, and the colony diameter of each plate was measured every 24 hours until the tenth day Figure 6 ). The optimal growth temperature for fungi is generally 20-30°C. After 36 hours of culture, it was found that HNU01 did not show obvious growth at 4°C and 38°C, and even after 10 days, there was still no obvious growth trend. The growth of plates at 20°C and 26°C was stronger, and after 10 days of culture, 26°C > 20°C > 34°C. After 10 days of culture at 26°C, the plates at 4°C and 38°C were transferred to the best growth condition, and it was found that HNU01 could still recover normal growth and was consistent with the growth of HNU01 at 26°C. This indicates that Clonostachys Hainanensis HNU01 has strong growth ability, temperature tolerance, and the best growth condition at 26°C.

[0061] III. Acid and alkali tolerance experiment of Clonostachys Hainanensis HNU01

[0062] The pH value of the potato solid medium was adjusted to 3, 4, 5, 6, 7, 8, 9, 10 by 0.1 mol / L HCl and NaOH solution respectively, and 5mm fungus cake was transferred to 60mm potato medium with different pH values in turn, and cultured in a 26℃ incubator for 7 days. Different pH gradients of solid medium were formed by preparing different pH potato solid medium to explore the influence of different pH on the growth of HNU01. Figure 7 Because agar does not solidify at pH 3 and 4, the final experiment pH was set to 5, 6, 7, 8, 9, 10. It was found that HNU01 grew normally under different pH conditions, with vigorous colony growth and dense mycelial growth under pH 5-10.

[0063] Example 3, Carbon and nitrogen source utilization ability and iron carrier production ability experiment of Clonostachys Hainanensis HNU01 strain

[0064] Different carbon sources (D-galactose, sucrose, D-fructose, glucose, D-mannitol, soluble starch) and nitrogen sources (ammonium sulfate, urea, peptone, ammonium nitrate, sodium nitrate, yeast extract) were used to replace the carbon and nitrogen sources in Czapek's medium to prepare solid medium. The medium was sterilized, and HNU01 with good growth potential was taken from the edge of the colony and punched to take mycelium blocks (5mm in diameter). Three plates were inoculated in the center of each treatment, and three replicates were used. The plates were inverted and cultured in the dark at 26℃ for 7 days, and the colony diameter was measured.

[0065] The results( Figure 8 ) showed that HNU01 could grow in different carbon sources (D-galactose, sucrose, D-fructose, glucose, D-mannitol, soluble starch) and nitrogen sources (ammonium sulfate, urea, peptone, ammonium nitrate, sodium nitrate, yeast extract), and grew best in yeast extract as carbon source and glucose as nitrogen source. HNU01 has strong carbon and nitrogen source utilization ability, which can convert and decompose various carbon and nitrogen sources in the growth environment that cannot be absorbed by plants to promote plant growth or inhibit the reproduction of pathogenic bacteria.

[0066] II. Iron carrier production ability experiment of Clonostachys Hainanensis HNU01

[0067] The fungus HNU01 was inoculated in CAS detection medium (siderophore detection medium, prepared according to the instructions of the reagent), pH 7.4, sterilized at 121 ℃ for 20 min, and cultured at 26 ℃, with 3 repeats for each treatment group. During the culture process, the four corners of the colony were continuously observed for the presence or absence of a yellow transparent circle. If there was one, it proved that the antagonistic bacteria had the ability to produce siderophores.

[0068] Siderophores are produced by microorganisms in an iron-deficient environment to chelate Fe 3+ in the rhizosphere soil and reduce it to Fe 2+ for plants to absorb nutrients. The test results Figure 9 showed that HNU01 formed an orange-yellow transparent circle on the CAS medium. It can be seen that HNU01 has strong siderophore secretion ability and can inhibit the growth of root rot pathogens by producing siderophores to chelate iron in the soil.

[0069] Example 4, Inhibition of Clonostachys hainanensis HNU01 Strain on Common Pathogenic Fungi of Plants

[0070] Potato pathogenic pythium, pepper pathogenic pythium, litchi pathogenic pythium, tomato pathogenic pythium, mango anthracnose pathogen, pepper anthracnose pathogen, strawberry anthracnose pathogen, banana wilt pathogen, cucumber wilt pathogen, and banana long-shaped spot pathogen were used as test pathogenic fungi. Among them, the pathogenic pythium was provided by Professor Li Zhengguo's team of the School of Life Sciences of Chongqing University; the rest of the strains were provided by the Institute of Tropical Biological Technology of the Chinese Academy of Tropical Agricultural Sciences (Table 3). A 5mm fungus cake was punched with a puncher and inoculated in the center of the corresponding medium, and the antagonistic bacteria were inoculated at a distance of 2.5 cm from the pathogenic fungi using the two-point method, with the blank medium as a control. Each strain of antagonistic bacteria was repeated 3 times, and the medium inoculated with pathogenic fungi was incubated at 26 ℃ in the dark for 5-7 days, and the medium inoculated with pathogenic fungi was incubated at 20 ℃ in the dark for 7-10 days. The colony diameters of the test pathogenic fungi were measured using the cross method.

[0071] The results of the antagonistic screening of pathogenic fungi from different types of plants are shown in Figure 10 Strain HNU01 has antagonistic effects on 11 types of test pathogenic fungi. This indicates that HNU01 is a good broad-spectrum antagonistic microbial fungus that can effectively inhibit the growth of various pathogenic fungi.

[0072] Table 3 Pathogenic fungi from different types of plants

[0073]

[0074]

Claims

1. A new species of Clonostachys Hainanensis HNU01 was deposited in the General Microbiology Center of China Culture Collection of Microorganisms with the registration number CGMCC No.41461.

2. Use of the Clonostachys Hainanensis HNU01 or its fermentation liquid according to claim 1 in any of the following applications: (1) Application in inhibiting root rot pathogens or preventing and treating plant root rot (2) Application in the preparation of products for inhibiting root rot pathogens or preventing and treating plant root rot; The root rot pathogen is harmful Pyrrhoderma noxium or Phytophthora cinnamomi, and the plant root rot is caused by the root rot pathogen.

3. The use according to claim 2, characterized in that: The plants include avocado, loquat, longan, lychee, wax apple or camphor tree.

4. Use of the Clonostachys Hainanensis HNU01 according to claim 1 or its fermentation liquid in inhibiting plant pathogenic fungi or in preventing and controlling plant diseases caused by the plant pathogenic fungi, wherein the plant pathogenic fungi include Phytophthora infestans, Phytophthora capsici, Peronophthoralitchii, Colletotrichum acutatum, Colletotrichum fragariae, Fusarium oxysporum f.sp.cubense, Fusarium oxysporum (Schl.) F.sp.cucumerinum Owen.anamorph or Curvularia fallax, the pathogen of banana leaf spot.

5. A product for inhibiting plant pathogens or preventing and controlling plant diseases, characterized in that: Its active ingredients include any of the following: (1) Clonostachys Hainanensis HNU01 according to claim 1; (2) the fermentation broth of Clonostachys Hainanensis HNU01 according to claim 1; The plant pathogens include harmful red dermatophytes Pyrrhoderma noxium, cinnamon phytophthora cinnamomi, infestation phytophthora Phytophthora infestans, pepper phytophthora Phytophthora capsici, litchi downy mildew Peronophthora litchii, sharp cell anthracnose fungi Colletotrichum acutatum, strawberry anthracnose fungi Colletotrichum fragariae, oxysporum Fusarium Cuba specialized type Fusarium oxysporum f.sp.cubense, sharp Fusarium cucumber specialized type Fusarium oxysporum (Schl.) F.sp. Cucumerinum Owen.anamorph or Curvularia fallax, the pathogen of banana long spot disease; The plant disease is caused by the plant pathogenic bacteria.

6. The product according to claim 5, characterized in that: The plants include avocado, loquat, longan, lychee, wax apple, camphor tree, potato, tomato, pepper, mango, strawberry, banana or cucumber.

Citation Information

Patent Citations

  • Spiropolyspora pink strain, microbial preparation and application of spiropolyspora pink strain and microbial preparation

    CN116656509A

  • Bacillus velezensis E16 and application of bacillus velezensis E16 as biocontrol bacterium in prevention and treatment of plant diseases

    CN118421539A