Recombinant microorganism with high yield of leucine as well as construction method and application of recombinant microorganism

Abstract

The invention provides a recombinant microorganism with high yield of leucine as well as a construction method and application of the recombinant microorganism, two key exogenous enzymes, namely acetohydroxy acid synthase which is not subjected to feedback inhibition of leucine and an NADH-dependent acetohydroxy acid isoreductase mutant, are introduced to relieve the feedback inhibition effect of the leucine and improve the H balance of coenzyme NAD (P); therefore, the yield of the escherichia coli leucine is improved.

Description

Technical Field

[0001] The present invention relates to the field of amino acid fermentation, and in particular to a recombinant microorganism with high leucine production, and a construction method and application thereof. Background Art

[0002] Leucine is an essential amino acid in mammals and is widely used in biomedicine, food, feed and other fields. Microbial fermentation is the main way to produce leucine, and commonly used chassis cells include Corynebacterium glutamicum and Escherichia coli. However, the enzymes in the leucine synthesis pathway are subject to complex metabolic regulation, and the multi-step reactions in the pathway highly overlap with the synthesis pathways of other members of the branched-chain amino acid family, resulting in low leucine production, many by-products, low conversion rate and high production cost. Therefore, the development of high-leucine-producing strains has become an urgent problem to be solved.

[0003] The synthesis of leucine in Escherichia coli is subject to a series of complex metabolic regulation, among which acetohydroxyacid synthase, the first key enzyme in the leucine synthesis pathway, is subject to feedback inhibition by leucine and is a key metabolic target that limits the high production of leucine. Currently, the main method for relieving the feedback inhibition of acetohydroxyacid synthase is to perform random mutagenesis or site-directed mutagenesis on the endogenous acetohydroxyacid synthase of Escherichia coli or acetohydroxyacid synthase derived from Corynebacterium glutamicum to obtain mutants of acetohydroxyacid synthase. Although these mutants can reduce the sensitivity to leucine, they usually also lead to a decrease in their catalytic activity. Therefore, it is crucial to obtain an acetohydroxyacid synthase with high catalytic activity and not inhibited by leucine for leucine.

[0004] The second step of the leucine synthesis pathway is catalyzed by acetohydroxyacid isomeroreductase. Currently known acetohydroxyacid isomeroreductases are all NADPH-dependent, and a large amount of NADPH is consumed during the leucine synthesis process. Since cells mainly produce NADH through central metabolism (glycolysis and citric acid cycle), there is a coenzyme imbalance between leucine synthesis and cellular carbon metabolism, which is also one of the key factors limiting leucine synthesis. Screening or designing acetohydroxyacid isomeroreductases that can directly utilize NADH is of great significance for balancing the utilization of cellular coenzymes and increasing the production of leucine. Summary of the invention

[0005] The purpose of the present invention is to provide a recombinant microorganism with high leucine production, and a construction method and application thereof.

[0006] The concept of the present invention is as follows: through scientific analysis, suitable exogenous acetohydroxyacid synthase and acetohydroxyacid isomeroreductase mutants are found to alleviate feedback inhibition and improve NADPH deficiency, thereby increasing the yield of leucine. The present invention screens exogenous acetohydroxyacid synthase that is not easily bound to leucine molecules by molecular docking method, and combines sequence alignment to site-directedly mutate NADPH-dependent exogenous acetohydroxyacid isomeroreductase, and finally integrates the two exogenous key enzyme genes into high-copy plasmid pTrc99a and expresses them in Escherichia coli.

[0007] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides an acetohydroxyacid isomeroreductase mutant, wherein the acetohydroxyacid isomeroreductase mutant comprises Neurospora crassa ( Neurospora crassa ) derived from acetohydroxyacid isomeroreductase, a mutation from V to D at amino acid position 113 and a mutation from R to F at amino acid position 114.

[0008] The amino acid sequence of the acetohydroxyacid isomeroreductase mutant of the present invention is shown in SEQ ID NO:4.

[0009] In a second aspect, the present invention provides a gene encoding the acetohydroxyacid isomeroreductase mutant, the nucleotide sequence of which is shown in SEQ ID NO:3.

[0010] In a third aspect, the present invention provides biological materials containing the gene.

[0011] The biological material includes but is not limited to recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacteria.

[0012] In a fourth aspect, the present invention provides an engineered bacterium that produces leucine, wherein the engineered bacterium overexpresses an exogenous gene budB coli ( Escherichia coli ).

[0013] The foreign gene budB Enterobacter aerogenes ( Enterobacter aerogenes ) acetohydroxyacid synthase gene budB (The nucleotide sequence is shown in SEQ ID NO: 1), and the amino acid sequence of the acetohydroxyacid synthase encoded by it is shown in SEQ ID NO: 2.

[0014] Preferably, the Escherichia coli is SIJ488 CP, which is a leucine-producing strain metabolically engineered on the basis of Escherichia coli SIJ488, i.e., an additional leuABCD gene is inserted into the Escherichia coli SIJ488 genome using the CRISPR-transposition system (Programming Cells by Multicopy Chromosomal Integration Using CRISPR-Associated Transposases. Zhang Y, YangJ, Yang S, Zhang J, Chen J, Tao R, Jiang Y, Yang J, Yang S. CRISPR J. 2021Jun;4(3):350-359.), including α-isopropylmalate synthase gene leuA, α-isopropylmalate isomerase gene leuB, and β-isopropylmalate dehydrogenase gene leuCD, whose ID numbers in NCBI are 947465, 944798, 945076 and 945042, respectively.

[0015] Preferably, the exogenous gene is introduced into the budB Introduced into the E. coli.

[0016] In a fifth aspect, the present invention provides a recombinant microorganism that produces high leucine yield, characterized in that the recombinant microorganism is an Escherichia coli that overexpresses a gene encoding the acetohydroxyacid isomeroreductase mutant; The Escherichia coli is the above-mentioned engineered bacterium producing leucine.

[0017] In a sixth aspect, the present invention provides a method for constructing a recombinant microorganism with high leucine production, wherein the acetohydroxyacid synthase gene of Enterobacter aerogenes is budB The acetohydroxyacid isomeroreductase mutant gene is codon-optimized and then introduced into Escherichia coli via a plasmid or integrated into the chromosome of Escherichia coli via genetic engineering.

[0018] Preferably, the plasmid is pTrc99a.

[0019] Preferably, the Escherichia coli is SIJ488 CP.

[0020] In a seventh aspect, the present invention provides the use of the engineered bacteria, the recombinant microorganism or the recombinant microorganism constructed according to the above method in the fermentation production of leucine.

[0021] In an eighth aspect, the present invention provides a method for increasing leucine fermentation yield, comprising the following steps: a) culturing the engineered bacteria, the recombinant microorganism or the recombinant microorganism constructed according to the above method to obtain a culture; b) collecting the produced leucine from the culture obtained in step a).

[0022] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The method of the present invention can significantly increase the yield of leucine in Escherichia coli. By introducing the acetohydroxyacid synthase of Enterobacter aerogenes, the feedback inhibition of leucine is relieved, and the metabolic flux from pyruvate to leucine synthesis is increased; by introducing a mutant from Neurospora crassa, NADH can be effectively utilized, and the balance of coenzyme utilization is achieved, thereby increasing the yield of leucine in Escherichia coli. DETAILED DESCRIPTION

[0023] The present invention provides a method for improving the production of leucine in Escherichia coli, wherein novel acetohydroxyacid synthase and NADH-dependent acetohydroxyacid isomerase mutants that are not subject to leucine feedback inhibition are screened and obtained mainly by a bioinformatics analysis method. The genes of the two enzymes are overexpressed in Escherichia coli, thereby significantly improving the production and yield of leucine in Escherichia coli.

[0024] The present invention adopts the following technical solution: (1) Using molecular docking method to screen acetohydroxyacid synthase that is not inhibited by leucine feedback; (2) Overexpression of Enterobacter aerogenes in Escherichia coli Enterobacter aerogenes ) acetohydroxyacid synthase gene budB (the sequence is shown in SEQ ID NO: 1); (3) Site-directed mutagenesis of Neurospora crassa ( Neurospora crassa ) to obtain a NADH-dependent acetohydroxyacid isomerase gene (sequence shown in SEQ ID NO: 3), and overexpressed it in Escherichia coli; (4) Fermenting the above-mentioned strains and detecting the growth status of the bacteria, the intracellular NADPH content and the leucine production.

[0025] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0026] The leucine production strain SIJ488 CP used in the following examples is specifically constructed as follows: Including transformation, induction and elimination of pRE57-Ter, pTet-tns, pTetQCas-8+IS186 and pCutmap plasmids (see Programming Cells by Multicopy Chromosomal Integration Using CRISPR-Associated Transposases. Zhang Y, Yang J, Yang S, Zhang J, Chen J, Tao R, Jiang Y, Yang J, Yang S. CRISPR J. 2021 Jun;4(3):350-359. Plasmids pRE57-Ter, pTet-tns, pTetQCas-8+IS186 and pCutmap were purchased from Addgene). The genome of Escherichia coli SIJ488 was used as a template and PCR was performed with primers leu-F (GGGAATTCCATGGTCGACATGCATATTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCAGTGTAATTC) and leu-R (TCTTAAAGTTAAACAAAATTATTCCTAGGaTTAATTCATAAACGCAGGTTGTTTTGCTTC) to obtain the gene fragment. leuABCD The DNA donor plasmid pRE57-Ter of the CRISPR-transposition system was digested with KpnI, and the pRE57-Ter plasmid backbone and leuABCD The gene fragments were connected in one step, and the obtained recombinant plasmid was named pRE57-leuABCD. pRE57-leuABCD was transformed into Escherichia coli by electroporation using an electroporator (Bio-Rad). The electroporation conditions were 2.5KV, 200Ω, and 25μF (the width of the electroporation cup was 2mm), and the cells were screened on an LB plate containing 100mg / L ampicillin. Then, pTet-tns and pTetQCas-8+IS186 plasmids were co-transformed and screened on an LB plate containing 100mg / L ampicillin, 50mg / L kanamycin, and 50mg / L streptomycin to obtain a recombinant strain containing three plasmids. The positive transformant was then inoculated into LB liquid medium containing 50 ng / mL dehydrated tetracycline and three antibiotics, and after induction, it was spread on a plate containing three resistances. The colonies growing on the plate were randomly selected, and the strains with an additional leuABCD gene inserted into the genome were screened by colony PCR. Finally, the pCutmap plasmid was transformed, and after 1 h of recovery in SOC medium at 37 ° C, the bacterial solution was transferred to a medium containing 50 μg / mL apramycin and 10 mM rhamnose, cultured at 37 ° C for 3 h, and then concentrated and spread on an LB plate containing apramycin. The colonies grown above were streaked onto different resistance and sucrose low-salt plates to screen whether the pRE57-leuABCD, pTetQCas-8+IS186 and pTet-tns plasmids were eliminated and the pCutmap plasmid was eliminated at the same time. Finally, a strain in which all four plasmids were successfully eliminated and an additional leuABCD gene was inserted into the genome was obtained and named SIJ488 CP.

[0027] Example 1 Screening of acetohydroxyacid synthases that are not inhibited by leucine feedback using a molecular docking method

[0028] About 1,000 acetohydroxyacid synthases from different sources were screened from the protein database Uniprot, and Alphafold2 was used to predict the three-dimensional structures of different acetohydroxyacid synthases. Then, the molecular docking software Autodock was used to conduct docking experiments between the L-leucine small molecule and the acetohydroxyacid synthase protein structures from different sources, and the results were sorted according to the binding free energy. The level of binding free energy reflects the binding ability between acetohydroxyacid synthase and L-leucine: a higher binding free energy means that the binding ability with L-leucine is relatively weak and may not be subject to feedback inhibition by L-leucine. The results showed that the acetohydroxyacid synthase from Enterobacter aerogenes ( Enterobacter aerogenes The binding free energy of acetohydroxyacid synthase with L-leucine molecule is the highest. budB gene encoding, and therefore this enzyme was selected for subsequent verification.

[0029] Example 2 Expression of acetohydroxyacid synthase from Enterobacter aerogenes in Escherichia coli

[0030] In this example, Escherichia coli SIJ488 CP is used as the starting strain. SIJ488 CP is a leucine-producing strain that has been metabolically engineered based on Escherichia coli SIJ488.

[0031] Synthesized codon-optimized from Enterobacter aerogenes ( Enterobacter aerogenes )of budB The gene, the sequence of which is shown in SEQ ID NO: 1, was used as a template, budB-F (CGAAGGCGAAGCGGCATGCATTTACGTTTTGACAATTAATCATCCGGCTCGTATAATGTG) and budB-R (TCAGACCGCTTCTGCGTTCTGATTTAATCTTTACAGAATCTGGCTCAGGTGCAG) were used as primers for PCR, and a budB gene fragment of about 1.5 kb was obtained and the PCR product was purified. The high-copy pTrc99a plasmid was used as a template, pTrc-F (AGATTAAATCAGAACGCAGAAGCGGTC) and pTrc-R (AACGTAAATGCATGCCGCTTCG) were used as primers for PCR, and a plasmid backbone of about 2.5 kb was obtained and the PCR product was purified. The pTrc99a plasmid backbone and budB The gene fragments were connected in one step, and the obtained recombinant plasmid was named pTrc99a-budB. pTrc99a-budB was transformed into E. coli SIJ488 CP by electroporation using an electroporator (Bio-Rad). The electroporation conditions were 2.5KV, 200Ω, and 25μF (the width of the electroporation cup was 2mm). The recombinant bacteria were screened on LB plates containing 100mg / L ampicillin and named E .coli / pTrc-budB.

[0032] As a control, a control strain overexpressing endogenous acetohydroxyacid synthase of Escherichia coli (NCBI ID: 948182 and 948183) driven by the same expression vector and promoter was constructed in this example. The genome of Escherichia coli SIJ488 was used as a template, and ilvBN-F (TCACACAGGAAACAGACCATGGAATTCATGAATGTGGCAGCTTCTCAACAGCCCAC) and ilvBN-R (TCCGCCAAAACAGCCAAGCTTGCATATTAATTGCTGTTTAGATCTTGGCCGGAGCCATG) were used as primers for PCR to obtain the gene fragment. ilvBN The high-copy pTrc99a plasmid was used as a template, and pTrc-F (AGATTAAATCAGAACGCAGAAGCGGTC) and pTrc-R (AACGTAAATGCATGCCGCTTCG) were used as primers for PCR to obtain a plasmid backbone of about 2.5 kb and PCR product purification was performed. The pTrc99a plasmid backbone and ilvBN The gene fragments were connected in one step, and the obtained recombinant plasmid was named pTrc99a-ilvBN. pTrc99a-ilvBN was transformed into Escherichia coli by electroporation using an electroporator (Bio-Rad). The electroporation conditions were 2.5KV, 200Ω, and 25μF (the width of the electroporation cup was 2mm). The recombinant bacteria were screened on LB plates containing 100mg / L ampicillin and named E .coli / pTrc-ilvBN.

[0033] Example 3 Site-directed mutagenesis of acetohydroxyacid isomeroreductase from Neurospora crassa and expression in Escherichia coli

[0034] Neurospora crassa Neurospora crassa ) were used to compare the conservative sequences of acetohydroxyacid isomeroreductase from β -α- β The positively charged amino acids in the motif were replaced with negatively charged amino acids to obtain mutants. ilvC Ncr (including point mutations V113D / R114F), the coding gene was artificially synthesized after codon optimization, and the sequence is shown in Seq ID2. Then, PCR was performed using the gene fragment as a template and Ncr-F (GAGGAATCACCATGGCTGCTCGTAACTGCAC) and Ncr-R (TCAGACCGCTTCTGCGTTCTGATTTAATCTTTATTTCTGGTTTTCCGGACGCAG) as primers to obtain ilvC Ncr The gene fragment was about 1 kb and the PCR product was purified. The pTrc99a-budB plasmid constructed in Example 2 was used as a template and pTrc-budB-F (AGATTAAATCAGAACGCAGAAGCGGTC) and pTrc-budB-R (TGCAGTTACGAGCAGCCATGGTGATTCCTCTTACAGAATCTGGCTCAGGTGCAG) were used as primers for PCR to obtain a plasmid backbone of about 4.5 kb and PCR purification was performed. The pTrc99a-budB plasmid backbone and ilvC Ncr The gene fragments were connected in one step, and the recombinant plasmid obtained was named pTrc99a-budB-ilvC Ncr pTrc99a-budB-ilvC was electroporated using an electroporator (Bio-Rad). Ncr The recombinant bacteria were transformed into Escherichia coli by electroporation under the conditions of 2.5KV voltage, 200Ω resistance, and 25μF capacitance (the width of the electroporation cup was 2mm). The recombinant bacteria were screened on LB plates containing 100mg / L ampicillin and named E .coli / pTrc-budB-ilvC Ncr .

[0035] Example 4 Fermentation and cultivation of recombinant Escherichia coli to produce leucine

[0036] Escherichia coli SIJ488 CP and recombinant strains E.coli / pTrc-budB, E.coli / pTrc-ilvBN, E.coli / pTrc-budB-ilvC Ncr Grow overnight on LB plates. Inoculate a single colony from the fresh plate into a 250 mL baffled shake flask containing 30 mL of seed medium at 37 o C, 200 rpm for 12 hours.

[0037] The formula of the seed culture medium includes (g / L): yeast powder 5, peptone 10, sodium chloride 10.

[0038] The seed solution was inoculated into a 500 ml baffled shake flask containing 30 ml fermentation medium at a 10% inoculation rate. o C, 200 rpm for 36 hours.

[0039] The fermentation medium formula includes (g / L): glucose 20, yeast extract powder 2.5, citric acid 0.8, sodium borate decahydrate 0.02, sodium molybdate dihydrate 0.137, manganese sulfate monohydrate 0.379, calcium chloride dihydrate 2, copper sulfate pentahydrate 1, zinc sulfate heptahydrate 2.2, ferrous sulfate heptahydrate 10, magnesium sulfate heptahydrate 0.8, diammonium hydrogen phosphate 1, potassium dihydrogen phosphate 6.67, and 3-morpholinepropanesulfonic acid 20.9.

[0040] During the fermentation process, the strain OD was measured by visible light spectrophotometer. 600 Levels, leucine concentration at 36 h was measured by high performance liquid chromatography (HPLC), and NADPH / NADP + The detection kit was used to measure the intracellular NADPH level, and the results are shown in Tables 1, 2 and 3. As can be seen from Table 2, the acetohydroxyacid synthase gene of Enterobacter aerogenes was overexpressed. budB The production of leucine can be significantly increased by overexpressing the acetohydroxyacid synthase gene of Escherichia coli. ilvBN It did not increase the production of leucine. At the same time, further overexpression of mutants from Neurospora crassa ilvC Ncr It can also further increase the production of leucine. At the same time, it can be seen from Table 3 that overexpression ilvC Ncr After the mutant, intracellular NADPH / NADP + The ratio of is improved, which means that the high production of leucine does not consume more NADPH in the cell, and thus the balance of coenzymes in the cell is improved.

[0041] Table 1 Growth of different strains (OD 600 )

[0042] Table 2 Leucine production of different strains (g / L)

[0043] Table 3 Intracellular NADPH content of different strains (NADPH / NADP + )

[0044] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. An acetohydroxyacid isomeroreductase mutant, characterized in that: The acetohydroxyacid isomeroreductase mutants include Neurospora crassa ( Neurospora crassa ) derived from acetohydroxyacid isomeroreductase, a mutation from V to D at amino acid position 113 and a mutation from R to F at amino acid position 114.

2. The acetohydroxyacid isomeroreductase mutant according to claim 1, characterized in that The amino acid sequence is shown in SEQ ID NO:

4.

3. A gene encoding the acetohydroxyacid isomeroreductase mutant according to claim 1 or 2 or a biological material containing the gene; The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, virus vector or engineered bacteria.

4. An engineered bacterium producing leucine, characterized in that: The engineered bacteria overexpress exogenous genes budB Escherichia coli ( Escherichia coli ); The foreign gene budB Enterobacter aerogenes ( Enterobacter aerogenes ) acetohydroxyacid synthase gene budB The amino acid sequence of the acetohydroxyacid synthase encoded by it is shown in SEQ ID NO:

2.

5. The engineered bacteria according to claim 4, characterized in that The Escherichia coli is SIJ488 CP; The construction method of strain SIJ488 CP includes: using the CRISPR-transposition system to insert an additional leuABCD gene into the Escherichia coli SIJ488 genome, including α-isopropylmalate synthase gene leuA, α-isopropylmalate isomerase gene leuB, and β-isopropylmalate dehydrogenase gene leuCD, whose ID numbers in NCBI are 947465, 944798, 945076, and 945042, respectively.

6. The engineered bacteria according to claim 4 or 5, characterized in that: The exogenous gene was expressed in the high-copy pTrc99a plasmid. budB Introduced into the E. coli.

7. A recombinant microorganism for high leucine production, characterized in that: The recombinant microorganism is Escherichia coli that overexpresses the gene of claim 3; The Escherichia coli is the engineered bacteria described in any one of claims 4-6.

8. A method for constructing a recombinant microorganism that produces high leucine production, characterized in that: acetohydroxyacid synthase gene budB and the gene of claim 3 is codon-optimized and introduced into Escherichia coli via a plasmid or integrated into the chromosome of Escherichia coli by genetic engineering; Among them, genes budB The amino acid sequence of the encoded acetohydroxyacid synthase is shown in SEQ ID NO: 2; Preferably, the plasmid is pTrc99a; Preferably, the Escherichia coli is SIJ488 CP.

9. Use of the engineered bacteria according to any one of claims 4 to 6, the recombinant microorganism according to claim 7, or the recombinant microorganism constructed according to the method according to claim 8 in the fermentation production of leucine.

10. A method for increasing leucine fermentation yield, characterized in that: The steps include: a) culturing the engineered bacteria according to any one of claims 4 to 6, the recombinant microorganism according to claim 7, or the recombinant microorganism constructed according to the method according to claim 8 to obtain a culture; b) collecting the produced leucine from the culture obtained in step a).

Images