A TaC3H72-6B gene and its CAPS marker and application

Abstract

The present invention relates to a TaC3H72-6B gene and a CAPS marker and application thereof, relating to the field of plant genetic engineering technology, the TaC3H72-6B gene having a nucleotide sequence as shown in SEQ ID NO.1, and the TaC3H72-6B gene positively regulates plant seed spike germination resistance. The present invention identifies an anti-spike germination gene TaC3H72-6B by the transcriptome results of infiltration treatment of susceptible spike germination wheat Jing 411 and resistant spike germination wheat Hongmangchun 21, develops a CAPS marker, namely TaC3H72-6B-C450, based on the sequence difference of the gene in resistant / susceptible spike germination wheat materials, and verifies that the CAPS marker is extremely significantly correlated with the seed germination index GI using 431 wheat varieties, and the CAPS marker is clearly distinguishable after electrophoresis detection, and the band type difference between different resistant / susceptible spike germination wheat varieties is obvious and easy to detect. The CAPS marker can effectively distinguish resistant / susceptible spike germination wheat varieties, and is helpful to improve the efficiency of genetic improvement of wheat spike germination resistance.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a TaC3H72-6B gene and a CAPS marker and application thereof. Background Art

[0002] Wheat is my country's second largest staple food crop, and its safe production is particularly important for ensuring my country's food security. However, with global warming, rainy weather has become frequent during the wheat harvest period, and the phenomenon of grains sprouting directly on the wheat ears (i.e., germination before harvest) has frequently occurred, resulting in a decrease in wheat yield and deterioration in quality, which seriously threatens my country's food security.

[0003] Although chemical agents can improve the spike sprout resistance of wheat varieties to a certain extent, the potential risks they pose to ecological and environmental safety and human health are unpredictable. Therefore, breeding and planting spike sprout-resistant wheat varieties is the most fundamental way to solve the spike sprout problem. Cloning key spike sprout-resistant genes and developing molecular markers are particularly critical for improving the spike sprout resistance of modern wheat varieties through molecular design breeding. However, few wheat spike sprout-resistant genes and functional markers have been cloned, which seriously hinders the breeding process of new spike sprout-resistant wheat varieties. Summary of the Invention

[0004] The purpose of the present invention is to provide a TaC3H72-6B gene and its CAPS marker and application in order to solve the above problems.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] A TaC3H72-6B gene having a nucleotide sequence as shown in SEQ ID NO.1.

[0007] The invention discloses an application of a TaC3H72-6B gene in regulating the resistance of plant seed spikes to germination. The TaC3H72-6B gene positively regulates the resistance of plant seed spikes to germination.

[0008] As a further optimized solution of the present invention, the plant is wheat.

[0009] A CAPS marker for identifying wheat ear sprout resistance, wherein the CAPS marker is TaC3H72-6B-C450, and comprises:

[0010] Primers for amplifying a nucleotide sequence containing the nucleotide sequence at position +450 of the coding region of the TaC3H72-6B gene as shown in SEQ ID NO. 1, wherein the nucleotide sequence at position +450 of the coding region of the TaC3H72-6B gene is C or A;

[0011] Restriction enzyme used to verify the base type of TaC3H72-6B-C450.

[0012] As a further optimization solution of the present invention, the restriction endonuclease used to verify the base type of TaC3H72-6B-C450 is Msl I.

[0013] A CAPS marker is used in identifying wheat seed ear sprouting resistance. When the CAPS marker of the wheat seed is of the TaC3H72-6B-C450-C type, it is an ear sprouting-resistant wheat variety. When the CAPS marker of the wheat seed is of the TaC3H72-6B-C450-A type, it is a ear sprouting-susceptible wheat variety.

[0014] A method for identifying wheat seed spike germination resistance using CAPS markers comprises the following steps:

[0015] S1, extract total RNA from wheat seeds and reverse transcribe it into cDNA;

[0016] S2. Using the nucleotide sequence consisting of the TaC3H72-6B-C450 polymorphic site and its upstream and downstream nucleotides as an amplification template, CAPS primers were designed and PCR amplification was performed to obtain an amplification product containing the TaC3H72-6B-C450 polymorphic site;

[0017] S3. Use restriction endonuclease Msl I to verify the base type of TaC3H72-6B-C450, determine the gene type of the amplified product based on the base type of TaC3H72-6B-C450, and determine the ear sprouting resistance of the wheat seeds based on the gene type.

[0018] As a further optimization scheme of the present invention, the CAPS primers are specifically as follows:

[0019] SEQ ID NO.12: TaC3H72-6B-C450-F: CAGGCACAATGATGGG;

[0020] SEQ ID NO. 13: TaC3H72-6B-C450-R: AAGGAAGGCAGCAAAA.

[0021] The beneficial effects of the present invention are:

[0022] The present invention identified an anti-sprouting gene TraesCS6B02G386600 encoding a CCCH-type zinc finger transcription factor through the transcriptome results of infiltration treatment of susceptible wheat Jing 411 and resistant wheat Hongmangchun 21. The gene was named TaC3H72-6B, which has the function of positively regulating wheat spike sprout resistance. Based on the sequence differences of the gene in resistant / susceptible wheat materials (in the resistant / susceptible wheat materials, the coding region of the TaC3H72-6B gene at the +450bp position is the same as the TaC3H72-6B gene), the anti-sprouting gene TraesCS6B02G386600 encoding a CCCH-type zinc finger transcription factor was identified through infiltration treatment of susceptible wheat Jing 411 and resistant wheat Hongmangchun 21. Mutations lead to changes in the encoded amino acids) and developed a gene function marker CAPS marker, namely TaC3H72-6B-C450, which is easy to detect on a large scale. 431 wheat varieties were used to verify that the CAPS marker was extremely significantly correlated with the seed germination index GI. The CAPS marker had clearly distinguishable bands after electrophoresis detection, and the band types were significantly different between different resistant / susceptible ear sprouting wheat varieties. The detection method is simple, which helps to improve the targeting and specificity of molecular marker selection, thereby improving the efficiency of genetic improvement of wheat ear sprouting resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The expression analysis of TaC3H72-6B gene in wheat seeds of Jing 411 (J411, susceptible to ear germination) and Hongmangchun 21 (HMC21, resistant to ear germination) at different infiltration times, **P<0.01( Figure 1 A is based on transcriptome sequencing data analysis; Figure 1 B is based on qRT-PCR analysis);

[0024] Figure 2 This is a map showing the nucleotide sequence differences of the TaMADS-3B gene between Jing 411 (J411, susceptible to ear sprouting) and Hongmangchun 21 (HMC21, resistant to ear sprouting) wheat;

[0025] Figure 3 Agarose gel electrophoresis pattern;

[0026] Figure 4 Figure 2 is the TaC3H72-6B gene overexpression and RNA interference test ( Figure 4 A is an analysis of the relative expression levels of the TaC3H72-6B gene in overexpression lines, wild-type wheat Fielder, and silencing interference lines; Figure 4 B, C, and D are the seed germination and whole-ear germination test phenotypes of the TaC3H72-6B gene overexpression line, wild-type wheat Fielder, and TaC3H72-6B gene RNA silencing interference line, respectively. The recipients of the overexpression and RNA silencing interference lines were all Fielder wheat. DETAILED DESCRIPTION

[0027] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0028] 1. Materials

[0029] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.

[0030] 2. Methods

[0031] 2.1 Identification and analysis of wheat gene TaC3H72-6B

[0032] 2.1.1 Transcriptome analysis of wheat gene TaC3H72-6B

[0033] Seeds of the wheat cultivars Jing 411 (J411, susceptible to ear germination) and Hongmangchun 21 (HMC21, resistant to ear germination) were soaked in water. Seed samples were collected at different soaking times (1 h, 6 h, 9 h, 12 h, and 36 h). Transcriptome sequencing (https: / / www.ncbi.nlm.nih.gov / bioproject / PRJNA895954) was used to analyze the transcriptome data of Jing 411 (J411, susceptible to ear germination) and Hongmangchun 21 (HMC21, resistant to ear germination). A gene encoding a CCCH-type zinc finger transcription factor, TaC3H72-6B (TraesCS6B02G386600, named TaC3H72-6B), which is associated with seed ear germination resistance, was identified. The expression patterns of TaC3H72-6B at different soaking times in the seeds of the two wheat cultivars (Jing 411 and Hongmangchun 21) were studied.

[0034] The transcriptome sequencing (RNA-seq) data of wheat varieties Jing 411 (J411, susceptible to ear sprouting) and Hongmangchun 21 (HMC21, resistant to ear sprouting) seeds were analyzed. Figure 1 As shown, Figure 1 A is the statistical graph of the expression level (Fragments Per Kilobase Milli on) of TaC3H72-6B gene in wheat varieties Jing 411 and Hongmangchun 21 seeds at 1h, 6h, 9h, 12h, and 36h of infiltration (**P<0.01), based on Figure 1 From the data of A, it can be seen that the gene expression levels of TaC3H72-6B gene in Hongmangchun 21 seeds were significantly higher than those in Jing 411 at 1h, 6h, 9h, 12h and 36h of infiltration.

[0035] 2.1.2. qRT-PCR analysis of wheat gene TaC3H72-6B.

[0036] Quantitative Real-time PCR (qRT-PCR) is a method that uses fluorescent chemicals to measure the total amount of product after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. The basic principle is to add a fluorescent group to the PCR reaction system, use the accumulated fluorescent signal to monitor the entire PCR process in real time, and finally use a standard curve to quantitatively analyze the unknown template. The fluorescent substances used in real-time fluorescence quantitative PCR include fluorescent probes and fluorescent dyes. This test uses SYBR fluorescent dye. The principle is that when an excess of SYBR fluorescent dye is added to the PCR reaction system, the SYBR fluorescent dye non-specifically incorporates into the DNA double strand and emits a fluorescent signal. SYBR dye molecules not incorporated into the strand will not emit any fluorescent signal, thus ensuring that the increase in fluorescent signal is completely synchronized with the increase in PCR product. SYBR only binds to double-stranded DNA, so the specificity of the PCR reaction can be determined by the melting curve.

[0037] Wheat seeds were infiltrated at different times (1 h, 9 h, and 36 h), and RNA was extracted and reverse transcribed into cDNA. Reverse transcription was performed using the Prime Script RT reagent kit (Takara Biotechnology, Dalian, China). Fluorescence quantitative PCR was performed according to the instructions of the SYBR Premix Ex Taq GC kit (Takara Biotechnology, Dalian, China). The PCR primer sequences, PCR reaction system, and PCR reaction procedure are as follows:

[0038] The PCR amplification primer sequences are as follows:

[0039] SEQ ID NO.2: TaC3H72-6B-qRT-PCR-F: CAAGCAATCACTCGACCATGCG;

[0040] SEQ ID NO.3: TaC3H72-6B-qRT-PCR-R: TTTCTCGCGGTGTATGCTTCGG;

[0041] PCR reaction system: The total qPCR reaction system is 20 μL, including 10 μL of SYBR Advantage Premix (2×), 2.0 μL of reverse-transcribed cDNA, and 7.2 μL of ddH2O, and 0.4 μL of each of the 10 μM upstream and downstream primers for mRNA quantification.

[0042] PCR reaction program: For quantification, the mRNA quantification program was 95°C for 2 min, 95°C for 10 sec, and 60°C for 30 sec, with 40 cycles. The fluorescence quantitative PCR process was run on a 7500 Real-Time PCR System (Bio-Rad Laboratories, Shanghai, China). Actin was selected as the internal reference gene for mRNA. Each sample was replicated four times, and the Ct value corresponding to each group of samples was 2 -△△Ct The algorithm calculates the changes in relative gene expression.

[0043] Analyze the qRT-PCR test data of wheat varieties Jing 411 and Hongmangchun 21 seeds. Figure 1 B is the statistical graph of the gene expression level (Fragments Per Kilobase Million) of TaC3H72-6B gene in wheat varieties Jing 411 and Hongmangchun 21 seeds at 1h, 9h, and 36h of infiltration (**P<0.01);

[0044] The data in the figure show that, consistent with the results of transcriptome analysis, the gene expression levels of TaC3H72-6B gene in Hongmangchun 21 were significantly higher than those in Jing 411 at 1h, 9h, and 36h of infiltration, indicating that the TaC3H72-6B gene is related to seed spike germination resistance and has the function of positively regulating wheat spike germination resistance.

[0045] 2.2 Development of CAPS markers for the TaC3H72-6B gene

[0046] Cleaved Amplified Polymorphism Sequences (CAPS), also known as RFLP-PCR, is a method that screens DNA sequences containing known restriction sites and designs corresponding specific PCR primers. These primers are then used to amplify the DNA fragment at that site. The resulting amplified product is then cleaved using a restriction endonuclease specific for that site. The fragments are then separated by gel electrophoresis, stained, and analyzed for changes in the site. CAPS markers are codominant markers, making them relatively simple to use and can be directly detected by agarose gel electrophoresis. However, CAPS markers require the appropriate restriction endonuclease, making their development process labor-intensive.

[0047] 2.2.1. Cloning of candidate genes

[0048] Gene cloning refers to the process of using enzymatic methods to reassemble DNA molecules from different sources into hybrid molecules in vitro through enzyme cutting, ligation and other operations, and amplify them in appropriate host cells to form a large number of progeny DNA molecules; by comparing the obtained first-generation sequencing sequence with the reference genome, the sequence inconsistency caused by different bases carried by different wheat varieties is analyzed.

[0049] The TaC3H72-6B gene was cloned using the genome sequence of Chinese Spring wheat (CS) as a reference to obtain the full-length gene. Using this as a template, specific primers (shown in SEQ ID NOs. 4-11) were designed using Primer Premier 5.0 (https: / / www.PremierBiosoft.com) software for fragment amplification. The full-length gene was cloned in the susceptible and resistant ear sprouting cultivar Jing 411 and the resistant ear sprouting cultivar Hongmangchun 21 as follows;

[0050] Since the full-length sequence of the TaC3H72-6B gene is long, four pairs of specific primers were used to clone it. The specific primer sequences are as follows:

[0051] SEQ ID NO.4: TaC3H72-6B.1-F: TAGCGATGCTGACTCCT;

[0052] SEQ ID NO.5: TaC3H72-6B.1-R: GTTCGGGTCCAATACG;

[0053] SEQ ID NO.6: TaC3H72-6B.2-F: ATGGCTGAAGGAAAGGTA;

[0054] SEQ ID NO.7: TaC3H72-6B.2-R: CGAGGCAGGTAGTAGGG;

[0055] SEQ ID NO.8: TaC3H72-6B.3-F: CGCTTCTTATCTTTCTCG;

[0056] SEQ ID NO.9: TaC3H72-6B.3-R: GGATGTCCCACCTTTTAT;

[0057] SEQ ID NO.10: TaC3H72-6B.4-F: GCCGAAGCATACACCG;

[0058] SEQ ID NO.11: TaC3H72-6B.4-R: AGACCAGACCTGACCAAA;

[0059] PCR amplification was performed using the high-fidelity 2× Phanta Max Master Mix, a high-efficiency, fast-acting enzyme, using the following reaction system: 12.5 μL Phanta Max Master Mix, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 2 μL template DNA (50-100 ng / μL), and distilled water to 25 μL. The reaction procedure was as follows: initial denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at the desired annealing temperature for each primer pair, extension at 72°C (extension time calculated based on fragment length and the amplification efficiency of 2× Phanta Max Master Mix, 1 kb / min), 38 cycles of denaturation-annealing-extension, and a supplemental extension at 72°C for 5 min. The product was stored at 4°C.

[0060] Aspirate 4 μL of the PCR product and add 2 μL of 6× DNA loading buffer. Then, perform electrophoresis on a 1.5% agarose gel. If a single band is detected at the target size, the remaining PCR product can be sent to a biotechnology company for sequencing.

[0061] 2.2.2 Sequence analysis of candidate genes

[0062] The splicing, alignment and structural analysis of gene sequencing results were completed by DNAMAN software (https: / / www.lynnon.com / dnaman.html). The sequences of Hongmangchun 21 (HMC21, resistant to ear sprouting) and Jing 411 (J411, susceptible to ear sprouting) were aligned and found to have sequence differences in the coding region (such as Figure 2 A mutation at position +450 bp in the coding region of the TaC3H72-6B gene (from base C (HMC21) to base A (J411)) resulted in a change in the encoded amino acid. Specific primers were designed for this mutation using PrimerPremier5.0 (http: / / www.premierbiosoft.com) software and developed into a CAPS marker, TaC3H72-6B-C450.

[0063] The nucleotide sequences of the specific primers are as follows:

[0064] SEQ ID NO.12: TaC3H72-6B-C450-F: CAGGCACAATGATGGG;

[0065] SEQ ID NO. 13: TaC3H72-6B-C450-R: AAGGAAGGCAGCAAAA.

[0066] 2.2.3. CAPS-labeled amplification, enzyme digestion, and electrophoresis

[0067] PCR amplification was performed using 2× Rapid Taq Master Mix. The PCR reaction program was as follows: 95°C for 5 min; 95°C for 15 s; annealing temperature for 15 s; 72°C for 15 s / kb at 38×; and 72°C for 8 min. After amplification, PCR products were detected and digested with enzymes. 5 μL of PCR product was aspirated, 3.9 μL of sterile water, 1 μL of CutSmart buffer, and 0.1 μL of a specific restriction endonuclease (Msl I) for 8–10 h at 37°C. The digested products were analyzed by gel electrophoresis on 2.0% agarose gel, and the genotypes of different wheat varieties were recorded using a gel imager. Association analysis between different allele types and ear sprouting traits was performed using IBM SPSS Statistics 26 (http: / / www.spss.com).

[0068] The results are as follows Figure 3 As shown, when the specific restriction endonuclease (Msl I) was used for enzyme digestion, the band of Jing 411 (susceptible to ear sprouting, TaC3H72-6B-C450-A allelic variation) could not be digested by enzyme, while the band of Hongmangchun 21 (resistant to ear sprouting, TaC3H72-6B-C450-C allelic variation) could be digested by enzyme. Figure 3 It can be seen that the PCR product of Hongmangchun 21 was cut into two bands by enzyme, indicating that it was of TaC3H72-6B-C450-C type, and Jing 411 was one band, indicating that it was of TaC3H72-6B-C450-A type. The bands were clearly visible and easy to identify.

[0069] 2.2.4 Validation of CAPS markers in natural populations

[0070] The seed germination index (GI) is used to evaluate the ear germination resistance level of wheat varieties. Germination index (GI) determination:

[0071] Wheat test materials (431 wheat varieties) were harvested at the end of May in 2021 and 2022. 50 seeds with intact embryos were selected for each material, rinsed with 0.1% sodium hypochlorite solution for 5 minutes, and then rinsed with distilled water 3 times to rinse off the sodium hypochlorite residues on the surface of the seeds. Place the treated seeds in a 90mm round glass culture dish (with two layers of sterile filter paper) with the abdomen facing down, and add 10mL of distilled water to moisten the germination paper. Culture in an incubator for 3 days (20°C, 80% humidity, 16h day / 8h night), and record the germination of seeds every day. After 3 days, calculate the seed germination index (GI) value, and the calculation formula is:

[0072] GI=[(3×n1+2×n2+1×n3) / (3×N)]×100%;

[0073] Where N represents the total number of seeds, n1, n2, and n3 represent the number of germinated seeds on the first, second, and third days, respectively; the seed germination standard is the rupture of the seed coat at the embryo.

[0074] In a natural population consisting of 431 wheat cultivars (Table 1), the Manny-Whitney test (U-test) analysis between different allele types (resistance to ear sprouting TaC3H72-6B-C450-C and susceptible to ear sprouting TaC3H72-6B-C450-A) and ear sprouting resistance traits was performed using IBM SPSS Statistics 20 (www.spss.com) software.

[0075] Table 1 Correlation between two allelic variants of the CAPS marker (TaC3H72-6B-C450-C and TaC3H72-6B-C450-A) and spikelet germination phenotype using 431 wheat varieties

[0076]

[0077] Note: 2022GI-HF, 2022GI5-LK, 2021GI-HF, and 2021GI-HB represent the ear sprouting phenotypes of 431 wheat varieties measured in Hefei, Anhui (HF) and Longkang Town, Anhui (LK) in 2022, and in Hefei, Anhui (HF) and Huaibei, Anhui (HB) in 2021, respectively.

[0078] *Indicates that there is a significant correlation between the two different allelic variant types of the marker and the seed dormancy phenotype at the 0.05 level;

[0079] **Indicates that there is a highly significant correlation between the two different allelic variant types of the marker and the seed dormancy phenotype at the 0.01 level.

[0080] As shown in Table 1, the differences in seed dormancy phenotype values ​​(GI) between wheat varieties carrying the two allelic variations of TaC3H72-6B-C450-C and TaC3H72-6B-C450-A reached extremely significant levels (P < 0.05 or 0.01).

[0081] 2.3TaC3H72-6B gene overexpression and RNA interference assay

[0082] Genetic modification refers to the addition of regulatory elements upstream of the target gene through artificially constructed vectors, which enables the gene to be overexpressed under artificially controlled conditions, thereby achieving large-scale transcription and translation of the gene product; RNA interference (RNAi) refers to the introduction of double-stranded RNA (dsRNA) consisting of sense RNA and antisense RNA corresponding to mRNA into cells, which can cause the specific degradation of mRNA, leading to the silencing of its corresponding gene.

[0083] 2.3.1 Vector construction

[0084] The full-length CDS sequence of the TaC3H72-6B anti-ear sprouting allele (i.e., the full-length CDS sequence of the TaC3H72-6B anti-ear sprouting allele of Hongmangchun 21, as shown in SEQ ID NO.1) was constructed into the BamH I and Spe I restriction sites of the pWMB006 vector driven by the maize Ubiquitin promoter. The constructed vector was then double-digested with HindIII and EcoR I and constructed into the corresponding restriction sites of pCAMBIA3301 by a one-step cloning method. The one with correct sequencing was the TaC3H72-6B overexpression vector;

[0085] Partial gene fragments (200-500 bp) of the full-length CDS sequence of the TaC3H72-6B anti-ear sprouting allele were ligated into the upper and lower multiple cloning sites of the pWMB006 vector in the forward and reverse directions. After successful ligation and sequencing, the large fragment was recovered by double digestion with Hind III and EcoR I enzymes and then ligated into the pCAMBIA3301 vector digested with the same enzymes (Hind III and EcoR I). The correctness of the TaC3H72-6B-RNAi vector was verified by sequencing.

[0086] 2.3.2 Agrobacterium transfection and positive strain detection

[0087] All correctly sequenced vector plasmids (TaC3H72-6B overexpression vector and TaC3H72-6B-RNAi vector) were transformed into competent Agrobacterium tumefaciens EHA105 cells via Agrobacterium heat shock transformation, and then into immature embryos of the wheat variety Fielder using Agrobacterium-mediated transformation. T0 generation wheat seedlings were transplanted into floral substrates and placed in an incubator for two weeks to slow down the growth. Leaves were collected and genomic DNA was extracted using the CTAB method. Primers were designed based on the sequence information of the vector and insert (primer sequences are shown in SEQ ID NOs. 14-15) to detect OE strains (overexpression strains) and RNA-silenced strains of TaC3H72-6B.

[0088] Upstream primer: SEQ ID NO. 14: Pubi-F: 5′-TCGATGCTCACCCTGTTGTTTG-3′;

[0089] Downstream primer: SEQ ID NO.15: Nos-R: 5′-TGTATAATTGCGGGACTCTAATC-3′;

[0090] Total RNA was extracted from transgenic wheat leaves and reverse transcribed to obtain cDNA. The expression levels of TaC3H72-6B in each transgenic line (OE line) and RNA silenced line (such as Figure 4 As shown in A, the wild-type strain wheat variety Fielder, OE strains OE#51, 52, 53 and RNA silenced strains RNAi#7, 11, 12 (the recipients of the OE strains and RNA silenced strains were all wheat variety Fielder) were analyzed.

[0091] 2.3.3 Evaluation of spike germination phenotype

[0092] The seed germination index GI (Germination index) and spike germination rate SGR (Spike germination rate) were used to evaluate the spike germination resistance of wheat varieties.

[0093] Seed germination index (GI) phenotype determination: 50 seeds with intact embryos were selected for each material and rinsed with 0.1% sodium hypochlorite solution for 5 minutes, followed by three rinses with distilled water to remove any residual sodium hypochlorite from the seed surface. The treated seeds were placed in a 90 mm round glass Petri dish (lined with two layers of sterile filter paper) with the abdomen facing downward. 10 mL of distilled water was added to moisten the germination paper. The seeds were cultured in an incubator for 4 days (20°C, 80% humidity, 16 hours day / 8 hours night). The phenotype was observed after the seeds were incubated. Seed germination was characterized by the presence of a ruptured seed coat in the embryo.

[0094] Whole-ear SGR phenotype determination: 35 days after anthesis (physiological maturity achieved, with complete loss of green color and yellowing of the ears, stems, and leaves), 15 whole ears were cut and randomly divided into three groups of five ears each. Each group was immersed in tap water for 6 hours (to allow the ears and seeds to fully absorb water), disinfected with 0.5% sodium hypochlorite solution for 15 minutes, rinsed three times, and incubated in an artificial climate chamber (22°C, 100% relative humidity) with simulated field rainfall for 30 minutes every 8 hours. Phenotypes were observed after 4 days of incubation.

[0095] The results are as follows Figure 4 As shown in BD, it can be seen in the figure that the TaC3H72-6B gene positively regulates wheat ear germination resistance.

[0096] 3 Conclusion

[0097] This study used transcriptome sequencing and real-time fluorescence quantitative PCR (qRT-PCR) to identify a spike sprout resistance gene, TraesCS6B02G386600, encoding a CCC H-type zinc finger transcription factor, named TaC3H72-6B. The relative expression level of this gene in the spike sprout resistance wheat variety Hongmangchun 21 at different infiltration stages was significantly higher than that in the spike sprout susceptible variety Jing 411 (P < 0.01) ( Figure 1 );

[0098] Through cloning and sequencing, it was found that the coding region of TaC3H72-6B gene was located at position +450bp (such as Figure 2As shown in the figure, the mutation of base C (HMC21) to base A (J411) leads to the change of the encoded amino acid. A CAPS (Cleaved Amplified Polymorphic Sequences) marker was developed for the SNP variation (C / A) at the +450bp position in the coding region of the TaC3H72-6B gene, namely TaC3H72-6B-C450 (including two allelic variation types, TaC3H72-6B-C450-C, which is resistant to ear sprouting, and TaC3H72-6B-C450-A, which is susceptible to ear sprouting). A natural population consisting of 431 wheat varieties was used to verify the correlation between the above CAPS marker TaC3H72-6B-C450 (TaC3H72-6B-C450-C, TaC3H72-6B-C450-A) and the seed germination index (germination index). dex, GI) and found that the wheat varieties carrying the TaC3H72-6B-C450-C genotype had significantly higher ear sprout resistance than the wheat varieties carrying the TaC3H72-6B-C450-A genotype (P<0.01), which verified that the sequence variation (C / A) at the +450bp position in the coding region of the TaC3H72-6B gene was significantly correlated with the ear sprout phenotype ( Figure 3 , Table 1);

[0099] The TaC3H72-6B gene was further overexpressed in the wheat variety Fielder, and it was found that the overexpression of the TaC3H72-6B gene significantly improved the spike sprouting resistance of the transgenic lines. At the same time, the expression of the TaC3H72-6B gene was silenced using RNA interference technology, and it was found that the downregulation of the expression of the TaC3H72-6B gene significantly reduced the spike sprouting resistance of wheat. The above results confirmed that the TaC3H72-6B gene has the function of positively regulating the spike sprouting resistance of wheat ( Figure 4 ).

[0100] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A TaC3H72-6B The application of a gene in regulating plant seed spike germination resistance is characterized in that: described TaC3H72-6B The nucleotide sequence of the gene is shown in SEQ ID NO.

1. TaC3H72-6B Genes positively regulate wheat seed spike germination resistance.

2. Application of a CAPS marker in identifying wheat seed spike germination resistance, characterized in that: The CAPS mark is TaC3H72-6B-C450 , which includes: For amplifying the protein represented by SEQ ID NO. TaC3H72-6B A primer for the nucleotide sequence of the +450th base of the gene coding region, TaC3H72-6B The base type at position +450 in the gene coding region is C or A; For verification TaC3H72-6B-C450 Base type restriction enzyme Msl I ; When the CAPS of the wheat seeds is marked TaC3H72-6B-C450-C Type, it is a wheat variety resistant to ear sprouting, when the CAPS mark of the wheat seed is TaC3H72-6B-C450-A Type, it is a wheat variety that is susceptible to ear sprouting.

3. A method for identifying wheat seed spike germination resistance using CAPS markers, characterized in that: The CAPS mark is TaC3H72-6B-C450 , which comprises: for amplifying the sequence of SEQ ID NO. TaC3H72-6B A primer for the nucleotide sequence of the +450th base of the gene coding region, TaC3H72-6B The base type at position +450 in the gene coding region is C or A; For verification TaC3H72-6B-C450 Restriction endonucleases of base type Msl I ; The method for identifying wheat seed spike germination resistance using CAPS markers comprises the following steps: S1, extract total RNA from wheat seeds and reverse transcribe it into cDNA; S2, by TaC3H72-6B-C450 The nucleotide sequence of the polymorphic site and its upstream and downstream nucleotides was used as the amplification template, CAPS primers were designed, and PCR amplification was performed to obtain the TaC3H72-6B-C450 amplification products of polymorphic sites; S3. Use restriction enzymes Msl I verify TaC3H72-6B-C450 The base type, according to TaC3H72-6B-C450 The base type of the amplified product is determined by the gene type, and the ear sprouting resistance of the wheat seeds is determined according to the gene type; When the CAPS of the wheat seeds is marked TaC3H72-6B-C450-C Type, it is a wheat variety resistant to ear sprouting, when the CAPS mark of the wheat seed is TaC3H72-6B-C450-A Type, it is a wheat variety that is susceptible to ear sprouting.

4. The method according to claim 3, characterized in that The CAPS primers are as follows: SEQ ID NO.12: TaC3H72-6B-C450 -F:CAGGCACAATGATGGG: SEQ ID NO.13: TaC3H72-6B-C450 -R: AAGGAAGGCAGCAAAA.

Images