Specific molecular lock for detecting DNA methylation and application

Abstract

The invention provides a DNA molecular lock for DNA fragment methylation detection, the DNA molecular lock and a sequence for replacing cytosine into uracil in a DNA fragment are complementary in the same direction, and cytosine basic groups in the DNA molecular lock are replaced into isocytosine basic groups. The invention further provides a simple and efficient qPCR method beneficial to detection of trace target gene methylation on the basis of the DNA molecular lock, stable homodromous parallel DNA double strands are formed by combining the DNA molecular lock with the non-methylated DNA fragment, amplification of the non-methylated DNA fragment is inhibited, specific amplification of the target methylated DNA fragment is helped, and the detection accuracy of the methylated target gene is improved. The methylation degree detection of trace DNA fragments is further improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular lock for specifically detecting DNA methylation and its application. Background Art

[0002] DNA methylation is an important biological process that regulates gene expression by adding methyl groups to specific locations on DNA molecules, mainly on the 5th carbon atom of cytosine at CpG sites. This mechanism plays a key role in a variety of biological processes, including cell differentiation, tissue development, and the occurrence and development of diseases. DNA methylation plays an important role in various diseases, including cancer, neurological diseases, cardiovascular diseases, and autoimmune diseases.

[0003] DNA methylation detection methods mainly include methylation-specific PCR (MSP) based on bisulfite treatment, methylation-sensitive restriction endonuclease analysis, and high-throughput sequencing technology. These methods have their own characteristics and are suitable for different research purposes and sample types. However, in clinical practice, except for high-throughput sequencing technology, which has a higher methylation detection accuracy, other methods are limited by the trace amount of sample detection and low detection efficiency.

[0004] DNA syntropic parallel double helix is ​​the opposite of traditional anti-parallel double helix, which means that the two complementary paired DNA chains are in the same direction. During the DNA complementary pairing process, the DNA chain composed of normal deoxyribonucleotides is more inclined to form anti-parallel double helix with the template chain, and when isomeric cytosine or isomeric guanine is incorporated into the DNA chain, it will be more inclined to form syntropic complementary double helix with the template. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a simple and efficient qPCR method that helps to detect trace amounts of target gene methylation. The method utilizes the combination of a specially synthesized DNA molecule lock and non-methylated DNA fragments to form a stable, parallel DNA double-strand, inhibit the amplification of non-methylated DNA fragments, thereby helping to specifically amplify the target methylated DNA fragments, and further improving the detection of the methylation degree of trace DNA fragments.

[0006] The term "molecular lock" described herein refers to a DNA sequence that is complementary to the non-methylated target fragment after bisulfite conversion, and is a single-stranded DNA synthesized by replacing cytosine with cytosine isomers, which can bind to the target DNA fragment in the same direction and in parallel.

[0007] The specific technical solutions of the present invention are as follows:

[0008] A DNA molecular lock for detecting methylation of a DNA fragment, wherein the DNA molecular lock is complementary in the same direction (5' end to 3' end) to a sequence in which cytosine in the DNA fragment is replaced by uracil, and the cytosine base in the DNA molecular lock is replaced by an isocytosine base. The isocytosine base is a base in which the -NH2 group on C4 of cytosine is exchanged with the -OH group on C2.

[0009] Preferably, the ratio of isocytosine in the DNA molecular lock to the number of molecular lock bases is greater than or equal to 1:4.

[0010] The binding position of the DNA molecular lock described in the present invention to the DNA fragment in which cytosine is replaced by uracil may or may not overlap with the primer and / or probe used to amplify the DNA fragment.

[0011] The annealing temperature of the DNA molecular lock should be much higher than the annealing temperature of the probe, so it can be short in length but high in GC content, or long in length but high in AT content. Preferably, the length of the DNA molecular lock is within 100 bases.

[0012] The cytosine base without -CH3 group modification on carbon atom 5 of the CpG site in the DNA fragment is converted into uracil by bisulfite to form an unmethylated sequence, while the CpG with methylated -CH3 group on carbon atom 5 is not affected by the conversion and maintains the CpG structure.

[0013] Preferably, the adenine deoxyribonucleotide in the DNA molecular lock is replaced by adenine LNA. The adenine LNA is a locked nucleic acid analog of adenine. When LNA hybridizes with a complementary DNA strand, the melting temperature (Tm value) of the double strand can be significantly increased. Each embedded LNA monomer can increase the Tm value of the double strand by 2 to 8°C. The role of the locked nucleic acid can ensure that the annealing temperature of the DNA molecular lock is higher than that of the primer probe.

[0014] The DNA molecular lock of the present invention covers the CpG sites of the DNA fragment. The number of DNA molecular locks depends on the number and distribution of CpG sites in the DNA fragment to be measured, which can be multiple DNA molecular sequences or one DNA molecular sequence, covering all CpG sites in the detected DNA fragment.

[0015] Another object of the present invention is to provide a method for detecting DNA fragment methylation, using the DNA molecular lock described in the present invention for detection.

[0016] The method specifically comprises: converting cytosine in a DNA fragment into uracil; if there is no methylation site in the DNA fragment, the converted DNA fragment will be parallel and complementary to the DNA molecular lock, and the amplification of the DNA fragment will be inhibited; if there is a methylation site in the parallel complementary region between the DNA fragment and the DNA molecular lock, the converted DNA fragment will not be able to be complementary to the molecular lock DNA sequence, and the DNA fragment can be amplified normally; and the methylation degree of the DNA fragment can be determined by detecting the amplified product.

[0017] In the method of the present invention, it is preferred that sufficient amount of DNA molecular lock and DNA fragment sample are added to the buffer solution and mixed before amplification, reacted at 95°C (parallel and unidirectional binding) for 5 minutes and then cooled to room temperature (25°C), which can promote the binding of DNA molecular lock and DNA fragment in advance and avoid competitive binding with primers and probes in the amplification stage. Furthermore, by introducing locked nucleic acid, the chain can be kept from melting during amplification, thereby improving the effect of DNA molecular lock in blocking the amplification of DNA fragments.

[0018] In the method of the present invention, the DNA polymerase used in the PCR amplification system is Taq enzyme. Taq enzyme only has the exonuclease activity from 5' to 3' end, but not from 3' to 5' end, so it can prevent the DNA molecular lock from being invalidated due to the exonuclease activity of DNA polymerase during DNA amplification.

[0019] Another object of the present invention is to provide the use of the DNA molecular lock in preparing a DNA fragment methylation detection reagent.

[0020] Another object of the present invention is to provide a methylation detection reagent, comprising the DNA molecular lock described in the present invention.

[0021] The methylation detection reagent also includes upstream and downstream primers for PCR amplification, a detection probe and a PCR amplification system, and the primers specifically amplify the DNA fragment to be detected (target gene) with potential methylation sites.

[0022] Preferably, the length of the DNA molecular lock is no more than 100 bases, and the annealing temperature should be higher than the probe annealing temperature.

[0023] Preferably, the DNA molecular lock fragment overlaps with one or more of the upstream and downstream primers and probes, and has no other sequence coverage. Preferably, three DNA molecular lock fragments are selected to bind to the regions where the upstream and downstream primers and probes bind to the DNA fragments, respectively.

[0024] Preferably, the DNA molecular lock only overlaps with the CpG site in the target DNA fragment, and the length is not less than 20 bases, and the annealing temperature is 10° C. higher than the probe annealing temperature. More preferably, the DNA molecular lock is 20-40 bases long, and the annealing temperature is 20° C. higher than the probe annealing temperature.

[0025] Preferably, any segment of the multiple segments of the DNA molecular lock can cover multiple CpG sites, and the CpG to be detected can be located in the middle or at both ends of the molecular lock nucleic acid segment.

[0026] Preferably, the 3' end of each DNA molecule lock should cover at least one CpG site, and more preferably, the 3' end of each DNA molecule lock should cover 3 or more CpG sites.

[0027] When the DNA content in the sample is extremely low, in order to accurately detect methylated DNA fragments, it is necessary to block the non-methylated DNA fragments before PCR amplification, so as to avoid the interference of non-methylated DNA fragments on the amplification of methylated DNA fragments. Especially in the case of a small number of CpG sites, effective blocking of non-methylated DNA fragments can improve the detection accuracy of methylated DNA fragments.

[0028] Based on the above considerations, the present invention utilizes synthetic DNA fragments in which isocytosine deoxyribonucleotides replace cytosine deoxyribonucleotides and adenine locked nucleotide analogs replace adenine deoxyribonucleotides to bind in the same direction to the unmethylated DNA fragments to be detected, thereby forming a same-direction DNA double-strand, hindering PCR amplification and inhibiting the amplification of unmethylated DNA fragments.

[0029] The specific application of the present invention is to detect the methylation degree of the CpG site of the target gene fragment. When the sample is a completely methylated DNA fragment, the fluorescence signal of qPCR reaches the threshold value first. When the sample is a completely unmethylated DNA fragment, the fluorescence signal of qPCR will not be detected. When the sample is a partially methylated DNA fragment, the fluorescence signal will be delayed in reaching the threshold value compared to the completely methylated DNA fragment.

[0030] In a preferred example, the methylation detection reagent includes a gene methylation detection reagent or a disease diagnostic reagent, including multiple gene methylation detection and multiple disease diagnostic reagents. The diseases include, but are not limited to, tumors, genetic abnormalities, metabolic abnormalities, and diseases caused by resistant pathogens. For example, blood tumors, solid tumors such as colorectal cancer, congenital genetic diseases such as thalassemia, multidrug-resistant tuberculosis complex infection, human immunodeficiency virus resistant infection, etc.

[0031] Another object of the present invention is to provide a detection kit, characterized in that it comprises the DNA molecular lock described in the present invention, and the kit also includes a PCR reaction system, wherein the PCR reaction system comprises upstream and downstream primers for specifically amplifying the target gene and a probe for qPCR detection, and the DNA molecular lock is a DNA oligonucleotide that is complementary to the converted non-methylated target gene fragment in the same direction.

[0032] Advantages of the present invention:

[0033] The present invention establishes a simple, rapid, highly sensitive, highly specific and low-cost method for improving the detection of the methylation degree of a target gene. The method utilizes the combination of a DNA molecule locked nucleic acid fragment synthesized from isocytosine deoxyribonucleotides as raw materials and a non-methylated target gene fragment converted by bisulfite to form a stable DNA double-strand parallel in the same direction. A specific reaction system is used to promote the formation of a specific DNA double-strand with only the non-methylated DNA strand. The introduced adenine locked nucleic acid analog can maximize the stability of the DNA double-strand of the DNA molecule lock and the DNA template, thereby inhibiting the progress of the PCR reaction and promoting the amplification of the methylated DNA fragment.

[0034] The present invention utilizes the formation of DNA unidirectional parallel double strands as blocking probes, which can achieve good consistency between theoretical design and experimental results. It not only avoids competitive binding between primers and DNA molecular locks, but also avoids the failure of the molecular lock caused by the exonuclease activity of DNA polymerase. It has lower requirements on the position of CpG sites relative to primer probes and on the number of CpG sites. Its applicability and effectiveness are much better than those of blocking probe designs of other technologies. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the technical solution of the present invention, the accompanying drawings required for use in the embodiments of the present invention are briefly introduced below.

[0036] Obviously, the drawings described below are only drawings of some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work, but these other drawings also belong to the drawings required for use in the embodiments of the present invention.

[0037] Figure 1 The figure is a schematic diagram of the working mechanism of the DNA molecular lock of the present invention.

[0038] Figure 2 This is the amplification curve of the internal reference channel for the blocking effect of the detection molecular lock on templates with different degrees of methylation in Example 1 of the present invention.

[0039] Figure 3The amplification curves of the blocking effect of the detection molecular lock on methylated templates of different degrees in Example 1 of the present invention, A is the amplification curve without the addition of the molecular lock, B is the amplification curve with the addition of the DNA molecular lock described in the present invention, and C is the amplification curve with the addition of the Block molecule as a comparison.

[0040] Figure 4 The figures are representative amplification curves of the blocking effect of the detection molecular lock on templates with different degrees of methylation according to Example 1 of the present invention, A is a representative amplification curve of the blocking effect on completely methylated templates with or without the addition of the molecular lock of the present invention or the addition of the control molecular lock Block; B is a representative amplification curve of the blocking effect on completely non-methylated templates with or without the addition of the molecular lock of the present invention or the addition of the control molecular lock Block; C is a representative amplification curve of the blocking effect on templates with different degrees of methylation without the addition of any molecular lock; D is a representative amplification curve of the blocking effect on templates with different degrees of methylation after the addition of the DNA molecular lock of the present invention; E is a representative amplification curve of the blocking effect on templates with different degrees of methylation after the addition of the control Block.

[0041] Figure 5 This is the amplification curve of the internal reference channel of the experiment for detecting the blocking effect of the molecular lock of the present invention on different numbers of CpG sites in Example 2 of the present invention.

[0042] Figure 6 This is an amplification curve of an experiment in Example 2 of the present invention to detect the blocking effect of the molecular lock of the present invention on different numbers of CpG sites in templates that do not contain methylation.

[0043] Figure 7 This is an amplification curve diagram of an experiment to detect the blocking effect of the molecular lock of the present invention on different numbers of CpG sites that do not contain any non-methylated templates in Example 2 of the present invention.

[0044] Figure 8 This is the internal reference channel amplification curve of the experiment for detecting the blocking effect of different numbers of molecular locks in Example 3 of the present invention.

[0045] Fig. 9 This is an amplification curve of the experiment for detecting the blocking effect of different numbers of molecular locks on a template completely free of methylation in Example 3 of the present invention.

[0046] Fig.10 This is an amplification curve of an experiment to detect the blocking effect of different numbers of molecular locks on a template completely free of non-methylated molecules in Example 3 of the present invention.

[0047] Fig.11 This is the internal reference channel amplification curve of the blocking effect experiment for detecting the difference in the positional relationship between the molecular lock and the primer probe in Example 4 of the present invention.

[0048] Fig.12This is an amplification curve diagram of an experiment for detecting the blocking effect of the positional relationship difference between the molecular lock and the primer probe on a template completely free of methylation according to Example 4 of the present invention.

[0049] Fig.13 This is an amplification curve diagram of an experiment for detecting the blocking effect of the difference in the positional relationship between the molecular lock and the primer probe on a completely non-methylated template according to Example 4 of the present invention.

[0050] Fig.14 This is an internal standard channel amplification curve diagram for detecting the effect of the isocytosine content in the molecular lock on the blocking of the non-methylated template by the molecular lock according to Example 5 of the present invention.

[0051] Fig.15 This is an amplification curve diagram of Example 5 of the present invention for detecting the effect of the isocytosine content in the molecular lock on the molecular lock blocking the methylated template.

[0052] Fig.16 This is an internal standard channel amplification curve diagram for detecting the effect of the locked nucleic acid content in the molecular lock on the molecular lock blocking the non-methylated template according to Example 6 of the present invention.

[0053] Fig.17 This is an amplification curve diagram of Example 6 of the present invention for detecting the effect of the locked nucleic acid content in the molecular lock on the molecular lock blocking the methylated template.

[0054] Fig.18 Amplification curves of the highly methylated genes RPS4Y2, RHOXF1, MAGEB2, and POF1B detected in real samples.

[0055] Fig.19 This is the internal standard channel amplification curve for detecting highly methylated genes RPS4Y2, RHOXF1, MAGEB2, and POF1B in real samples.

[0056] Fig. 20 Amplification curves of hypomethylated genes EIF1AY, ZFY, TXLNGY, and TTTY15 detected in real samples.

[0057] Fig.21 This is the internal standard channel amplification curve for detecting low-methylation genes EIF1AY, ZFY, TXLNGY, and TTTY15 in real samples. DETAILED DESCRIPTION

[0058] In order to make the purpose, technical solution, beneficial effects and significant improvements of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings provided in the embodiments of the present invention.

[0059] Obviously, all the described embodiments are only partial embodiments of the present invention, rather than all the embodiments; based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work are within the scope of protection of the present invention.

[0060] For those skilled in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0061] The term "forward primer sequence" in the present invention refers to the primer located upstream and downstream of the DNA double strand. If used for sequencing, the sequence of the DNA positive strand is read from the 5' to the 3' direction.

[0062] The term "reverse primer sequence" in the present invention means that the reverse primer (downstream primer) is extended along the positive strand. In vitro amplification of DNA, the double helix is ​​partially or completely opened, there is no Okazaki fragment, and it will not be extended in segments. In theory, both the forward and reverse primers are extended continuously, which is different from the self-replication of DNA in vivo.

[0063] The term "probe" in the present invention refers to: a nucleic acid sequence (DNA or RNA) with a detection label and a known sequence that is complementary to the target gene. The gene probe binds to the target gene through molecular hybridization to generate a hybridization signal, which can display the target gene from the vast genome. According to the hybridization principle, the nucleic acid sequence used as a probe must meet at least the following two conditions: ① It should be single-stranded. If it is double-stranded, it must be denatured first. ② It should carry a label that is easily detected. It can include the entire gene or just a part of the gene; it can be DNA itself or RNA transcribed from it.

[0064] The term "qPCR" in the present invention refers to: Real-time Quantitative PCR Detecting System, that is, real-time fluorescence quantitative nucleic acid amplification detection system, also called real-time quantitative gene amplification fluorescence detection system.

[0065] In the present invention, except for Examples 5 and 6, the C nucleotides in the DNA molecular locked sequences of all other Examples are isocytosine deoxyribonucleotides, and all A are adenine deoxyribonucleotide locked nucleic acid analogs.

[0066] It should also be noted that the following specific embodiments may be combined with each other, and the same or similar concepts or processes therein may not be repeated in some embodiments.

[0067] The technical solution of the present invention is described in detail below with specific embodiments.

[0068] Example 1 Blocking effect of DNA molecular lock on templates with different degrees of methylation

[0069] 1.1 Design of synthetic and bisulfite-converted amplification template

[0070] In this example, the purpose is to verify that the DNA molecular lock described in the present invention has a good blocking effect in DNA templates with different methylation degrees, and at the same time prove that the DNA molecular lock described in the present invention has no amplification inhibitory effect on methylated templates.

[0071] For this reason, two groups of sequences were artificially designed and synthesized in this example: methylated sequences and completely unmethylated sequences.

[0072] The nucleotide sequence of the completely unmethylated sequence is shown in SEQ ID NO.1.

[0073] The methylated sequence is a sequence in which three CpG sites in the sequence shown in SEQ ID NO. 1 are methylated.

[0074] ACTGCTGAGACTGTGTCTGCCCTGTGAGCACAGAGCCTTGCCTTTGCTGATCTGCTGCCTGTCCA CACCTGCTGCCAGGTAAGCCTGGCCAGCTGACTGGGGCAGGTGGCTCATGGCCTGGCTGCAGGTGGC TGTGGCCCCTTTGCCTGTGC CH3 GAGCTGCTGTCC CH3 GGGCTGCAGC CH3 GGGTGCATGGGAATGACTG CTGTGGGTGTGGGTGAAGCCCCTGGGCCTCTGGAGATGGACACCCCATGCCAGTTTGGAGGTGTGAG GCTGTGCTTGGGAGGTGTGCTCTGGGTGCTGCTTGGTGGCAACTGGAAGTCTTTGTCTGAGCTGG CTCTTGCCAATGGATTGCAGGTGGGTGTGGTGGAGCCCCTGCCAGGCCTGGTGGGCTGGG.

[0075] Completely unmethylated amplification template (DNA template 2): A bisulfite conversion experiment was performed on the completely unmethylated template to obtain a DNA template for qPCR amplification, which is a DNA sequence after all cytosines in the completely unmethylated template were replaced with uracil.

[0076] Methylation amplification template (DNA template 1): A bisulfite conversion experiment was performed on the methylated sequence to obtain a DNA template for qPCR amplification, which is a DNA sequence in which all cytosines at non-methylated sites in the methylated sequence are replaced by uracil.

[0077] 1.2 Design of amplification primers and probes

[0078] In this example, a primer probe set was designed for the sequence in step 1.1, and a verification experiment was performed, which included:

[0079] Forward primer F1: 5′GGTTGTAGGTGGTTGTGGTTTTTTTGT3′;

[0080] Reverse primer R1: 5′CACCCACACCCAACAATCAA3′;

[0081] Probe P1: 5′FAM-CCATACACCCGCTACAACCCGAACAACAACTCGC-BHQ13′;

[0082] DNA molecule lock L1: 5'ACTCAACAACAAACCCAACATCACCCAC3' (where C is iC);

[0083] Block molecular lock B: 5'CACCCACTACAACCCAAACAACAACTCA3'. (Control molecular lock, reverse parallel complementary to the template to be amplified, competitive binding with primers and probes).

[0084] 1.3 Experimental methods

[0085] The binding reaction conditions of the DNA molecule lock and the DNA template in this embodiment are as follows:

[0086] Table 1: DNA molecular lock and DNA template binding reaction system

[0087] Reagents Volume μL / reaction DNA Molecular Lock (10μM) 0.6 Hybridization buffer (20 mM PBS, pH 7.0) 3.8 DNA template (0.00002ng / μL) 0.6

[0088] The detection method qPCR containing DNA molecular lock of this embodiment, the reaction system is shown in Table 2 below, wherein Sample 1 is a system after 0.6 μL DNA template 2 is combined with DNA molecular lock L, Sample 2 is a system after 0.1 μL DNA template 1 and 0.5 μL DNA template 2 are mixed and reacted with DNA molecular lock L, Sample 3 is a system after 0.2 μL DNA template 1 and 0.4 μL DNA template 2 are mixed and reacted with DNA molecular lock L, Sample 4 is a system after 0.4 μL DNA template 1 and 0.2 μL DNA template 2 are mixed and reacted with DNA molecular lock L, and Sample 5 is a system after 0.6 μL DNA template 1 is reacted with DNA molecular lock L.

[0089] Table 2: DNA molecular lock blocking effect detection experiment qPCR reaction system table

[0090] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.3 R primer (10 μM) 0.3 Probe (10 μM) 0.3 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 10.1 Samples: Sample1, Sample2, Sample3, Sample4, Sample5 5

[0091] The detection method qPCR containing Block molecular lock in this embodiment has a reaction system as shown in Table 3 below, wherein Sample 6 is 0.6 μL DNA template 2, Sample 7 is a template obtained by mixing 0.1 μL DNA template 1 and 0.5 μL DNA template 2, Sample 8 is a template obtained by mixing 0.2 μL DNA template 1 and 0.4 μL DNA template 2, Sample 9 is a template obtained by mixing 0.4 μL DNA template 1 and 0.2 μL DNA template 2, and Sample 10 is a template obtained by mixing 0.6 μL DNA template 1.

[0092] Table 3: Block molecular lock blocking effect detection experiment qPCR reaction system table

[0093] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.3 R primer (10 μM) 0.3 Probe (10 μM) 0.3 Block(10μM) 0.6 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 13.9 Samples: Sample6, Sample7, Sample8, Sample9, Sample10 0.6

[0094] The control qPCR reaction system of this embodiment without any molecular lock is shown in Table 4 below, wherein Sample 11 is 0.6 μL DNA template 2, Sample 12 is a template obtained by mixing 0.1 μL DNA template 1 and DNA template 2, Sample 13 is a template obtained by mixing 0.2 μL DNA template 1 and 0.4 μL DNA template 2, Sample 14 is a template obtained by mixing 0.4 μL DNA template 1 and 0.2 μL DNA template 2, and Sample 15 is a template obtained by mixing 0.6 μL DNA template 1.

[0095] Table 4: qPCR reaction system table for DNA molecular lock blocking effect detection control experiment

[0096] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.3 R primer (10 μM) 0.3 Probe (10 μM) 0.3 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 14.5 Samples: Sample11, Sample12, Sample13, Sample14, Sample15 0.6

[0097] qPCR reaction program: All QPCR programs in the present invention are pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 20 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 20 seconds; the three steps of denaturation, annealing, and extension are cycled 40 to 50 times.

[0098] 1.4 Experimental Results

[0099] like Figure 2 , Figure 3 , Figure 4 As shown, the amplification curves of the qPCR reactions performed with or without the addition of the DNA molecular lock described in the present invention or the addition of the Block probe are all normal, indicating that the qPCR reactions are normal and the results are reliable.

[0100] As shown in Table 5, it is a statistical table of qCPR reaction results of this embodiment, and Table 6 is a statistical table of internal standard channel results of qPCR reaction of this embodiment.

[0101] Table 5: CT value statistics of qPCR reaction results of DNA molecular lock blocking effect detection experiment

[0102]

[0103]

[0104] Table 6: CT value statistics of the internal standard channel results of qPCR reaction in DNA molecular lock blocking effect detection experiment

[0105] Sample name Parallel Replication 1 Parallel Repeat 2 Parallel Replication 3 Sample1 27.54 27.77 27.47 Sample6 27.46 27.46 27.48 Sample11 27.27 27.27 27.29 Sample2 27.2 27.21 27.26 Sample7 27.22 27.11 27.02 Sample12 27.04 27.16 27.08 Sample3 27.35 27.51 27.32 Sample8 27.31 27.42 27.48 Sample13 27.23 27.43 27.4 Sample4 27.26 27.2 27.34 Sample9 27.2 27.11 27.03 Sample14 27.16 27.33 27.29 Sample5 27.33 27.43 27.35 Sample10 27.42 26.93 27.38 Sample15 27.2 27.43 26.85

[0106] From the amplification curve and results, it can be seen that for completely non-methylated samples, when no DNA molecular lock or Block molecular lock is added, it can be amplified by the primer probe designed for methylation amplification. When the DNA molecular lock is added, the amplification of the non-methylated template can be completely inhibited, while the amplification of the non-methylated template cannot be completely inhibited after the addition of the traditional Block molecular lock, and the complete blocking effect cannot be achieved; for completely methylated samples, the addition of DNA molecular lock has no inhibitory effect on the amplification reaction of the methylated sample, while the addition of Block molecular lock significantly inhibits the amplification reaction of the methylated template; for incompletely methylated templates, when the molecular lock is not added, due to the non-specific amplification of the non-methylated template by the primer probe, the increase in the methylated template does not cause a change in the result, while the addition of DNA molecular lock can significantly improve the detection accuracy of the methylated template. With the increase of the methylated template, the detection result also changes accordingly. Finally, due to the blocking effect of Block on the methylated sample, after the addition of Block, the detection results in all cases are larger than those after the addition of DNA molecular lock. In summary, the DNA molecular lock described in the present invention has three advantages over the traditional Block molecular lock. First, the inhibition effect on the target blocked fragment is more complete; second, the non-specific binding ability to the amplified fragment is lower; third, the accuracy of methylation detection can be greatly improved. Therefore, the present invention will greatly improve the qPCR detection effect of DNA methylation.

[0107] Example 2 Blocking effect of DNA molecular lock on methylated templates with different numbers of CpG sites

[0108] 2.1 Design of synthetic and bisulfite-converted amplification template

[0109] In this example, the purpose is to verify that the DNA molecular lock described in the present invention has a good blocking effect in methylated templates containing different numbers of CpG sites.

[0110] For this purpose, ten groups of sequences were artificially designed and synthesized in this example. The first group was a completely methylated DNA sequence containing 3 CpG sites. The sequence and its conversion template information were the same as in Example 1.

[0111] The second group is a completely unmethylated DNA sequence containing 3 CpG sites. The sequence and its transformation template information are the same as those in Example 1.

[0112] The third group is a completely methylated DNA sequence 3 containing 5 CpG sites, and its nucleotide sequence is that the 5 CpG sites of the sequence shown in SEQ ID NO.2 are completely methylated:

[0113] ACTGCTGAGACTGTGTCTGCCCTGTGAGCACAGAGCCTTGCCTTTGCTGATCTGCTGCCTGTCCA CACCTGCTGCCAGGTAAGCCTGGCCAGCTGACTGGGGCAGGTGGCTCATGGCCTGGCTGCAGGTGGC TGTGGCCCCTTTGCCTGTGC CH3 GAGCTGCTGTCC CH3 GGGCTGCAGC CH3 GGGTGC CH3 GTGC CH3 GAATG ACTGCTGTGGGTGTGGGTGAAGCCCCTGGGCCTCTGGAGATGGACACCCCATGCCAGTTTGGAGGTG TGAGGCTGTGCTTGGGAGGTGTGCTCTGGGTGCTGCTCTTGGTGGCAACTGGAAGTCTTTGTCTGAG CTGGCTTCTTGCCAATGGATTGCAGGTGGGTGTGGTGGAGCCCCTGCCAGGCCTGGTGGGCTGGG.

[0114] The third group of designed and synthesized DNA sequences 3 were subjected to a bisulfite conversion experiment to obtain DNA template 3 for qPCR amplification, which is a DNA sequence after all non-methylated cytosines in DNA sequence 3 were replaced with uracil.

[0115] The fourth group is a completely unmethylated DNA sequence 4 containing 5 CpG sites, and its nucleotide sequence is shown in SEQ ID NO.2.

[0116] The fourth group of designed and synthesized DNA sequences 4 were subjected to a bisulfite conversion experiment to obtain DNA template 4 for qPCR amplification, which is a DNA sequence after all cytosines in DNA sequence 4 were replaced with uracil.

[0117] The fifth group is a completely methylated DNA sequence 5 containing 7 CpG sites, and its nucleotide sequence is the 7 CpG sites of the sequence shown in SEQ ID NO.3 are completely methylated:

[0118] ACTGCTGAGACTGTGTCTGCCCTGTGAGCACAGAGCCTTGCCTTTGCTGATCTGCTGCCTGTCCA CACCTGCTGCCAGGTAAGCCTGGCCAGCTGACTGGGGCAGGTGGCTCATGGCCTGGCTGCAGGTGGC TGTGGCCCCTTCCH3 GCCTGTGC CH3 GAGTC CH3 GCTGTCC CH3 GGGCTGCAGC CH3 GGGTGC CH3 GTGC CH3 GAATGACTGCTGTGGGTGTGGGTGAAGCCCCTGGGCCTCTGGAGATGGACACCCCATGCCAGTTTGGAGGTGTGAGGCTGTGCTTGGGAGGTGTGCTCTGGGTGCTGCTCTTGGTGGCAACTGGAAGTCTTTGTCTGAGCTGGCTCTTGCCAATGGATTGCAGGTGGGTGTGGTGGAGCCCCTGCCAGGCCTGGTGGGCTGGG.

[0119] The fifth group of designed and synthesized DNA sequences 5 were subjected to a bisulfite conversion experiment to obtain DNA template 5 for qPCR amplification, which was a DNA template after all non-methylated cytosines in DNA sequence 5 were replaced with uracil.

[0120] The sixth group is a completely unmethylated DNA sequence 6 containing 7 CpG sites, and its nucleotide sequence is shown in SEQ ID NO.3.

[0121] The sixth group of designed and synthesized DNA sequences 6 were subjected to a bisulfite conversion experiment to obtain DNA template 6 for qPCR amplification, which was a DNA sequence after all cytosines in DNA sequence 6 were replaced with uracil.

[0122] The seventh group is a completely methylated DNA sequence 7 containing 10 CpG sites, and its nucleotide sequence is the 10 CpG sites of the sequence shown in SEQ ID NO.4 are completely methylated:

[0123] ACTGCTGAGACTGTGTCTGCCCTGTGAGCACAGAGCCTTGCCTTTGCTGATCTGCTGCCTGTCCA CACCTGCTGCCAGGTAAGCCTGGCCAGCTGACTGGGGCAGGTGGCTCATGGCCTGGCTGCAGGTGGC TGTGGCCCCTTC CH3 GCCTGTGC CH3 GAGTC CH3 GCTGTCC CH3 GGGCC CH3 GCAGC CH3 GGGTGC CH3GTGC CH3 GAATGACTGCC CH3 GTGC C H3 GTGTGGGTGAAGCCCCTGGGCCTCTGGAGATGGACACCCCATGCCA GTTTGGAGGTGTGAGGCTGTGCTTGGGAGGTGTGCTCTGGGTGCTGCTCTTGGTGGCAACTGGAAGT CTTTGTCTGAGCTGGCTCTTGCCAATGGATTGCAGGTGGGTGTGGTGGAGCCCCTGCCAGGCCTGGTG GGCTGGG.

[0124] The seventh group of designed and synthesized DNA sequence 7 was subjected to a bisulfite conversion experiment to obtain DNA template 7 for qPCR amplification, which is a DNA template after all non-methylated cytosines in DNA sequence 7 were replaced with uracil.

[0125] The eighth group is a completely unmethylated DNA sequence 8 containing 10 CpG sites, and its nucleotide sequence is shown in SEQ ID NO.4.

[0126] The eighth group of designed and synthesized DNA sequences 8 were subjected to a bisulfite conversion experiment to obtain DNA template 8 for qPCR amplification, which was a DNA template after all cytosines in DNA sequence 8 were replaced with uracil.

[0127] The ninth group is a completely methylated DNA sequence 9 containing 15 CpG sites, and its nucleotide sequence is the 15 CpG sites of the sequence shown in SEQ ID NO.5 are completely methylated:

[0128] ACTGCTGAGACTGTGTCTGCCCTGTGAGCACAGAGCCTTGCCTTTGCTGATCTGCTGCCTGTCCA CACCTGCTGCCAGGTAAGCCTGGCCAGCTGACTGGGGCAGGTGGCTCATGGCCTGGCTGCAGGTGGC TGTGGCCCCTTC CH3 GCCTATAC CH3 GAGTC CH3 GCTATCC CH3 GAACC CH3 GCAGC CH3 GGATAC CH3 GTAC CH 3 GAATGACTACC CH3 GTAC CH3 GTGC CH3 GAAC CH3 GAC CH3 GCCCCC CH3 GGGCCTCC CH3 GGAGATGGACA CCCCATGCCAGTTTGGAGGTGTGAGGCTGTGCTTGGGAGGTGTGCTCTGGGTGCTGCTCTTGGTGGC AACTGGAAGTCTTTGTCTGAGCTGGCTCTTGCCAATGGATTGCAGGTGGGTGTGGTGGAGCCCCTGC CAGGCCTGGTGGGCTGGG.

[0129] The ninth group of designed and synthesized DNA sequences 9 were subjected to a bisulfite conversion experiment to obtain DNA template 9 for qPCR amplification, which was a DNA template after all non-methylated cytosines in DNA sequence 9 were replaced with uracil.

[0130] The tenth group is a completely unmethylated DNA sequence 10 containing 15 CpG sites, and its nucleotide sequence is shown in SEQ ID NO.5.

[0131] The tenth group of designed and synthesized DNA sequences 10 were subjected to a bisulfite conversion experiment to obtain a DNA template 10 for qPCR amplification, which is a DNA template after all cytosines in the DNA sequence 10 are replaced with uracil.

[0132] 2.2 Design of amplification primers and probes

[0133] In this embodiment, a primer probe set is designed for DNA template 1 and DNA template 2 in step 2.1, and a verification experiment is performed, which includes: forward primer F1, reverse primer R1, probe P1 and DNA molecular lock L1, and the sequence information is the same as described above.

[0134] In this embodiment, a primer probe set is designed for DNA template 3 and DNA template 4 in step 2.1, and a verification experiment is performed. The experiments include:

[0135] Forward primer F2: 5′TGTGCGAGTTGTTGTTCGGGT3′;

[0136] Reverse primer R2: 5′CCAAAAACTTCACCCACACCCA3′;

[0137] Probe P2: 5′FAM-GCGGGTGCGTGCGAATGATTGT-BHQ13′;

[0138] DNA molecular lock L2: 5'ACTCAACAACAAACCCAACATCACCCACACACAC3' (where C is iC).

[0139] In this embodiment, a primer probe set is designed for DNA template 5 and DNA template 6 in step 2.1, and a verification experiment is performed. The experiments include:

[0140] Forward primer F3: 5′TTTTCGTTTGTGCGAGTCGTTG3′;

[0141] Reverse primer R3: 5′CAAAAACTTCACCCACACCCACAA3′;

[0142] Probe P: 5′FAM-CGGGTTGTAGCGGGTGCGTGCGA-BHQ13′;

[0143] DNA molecular lock L3: 5'ACAAACACACTCAACAACAAACCCAACATCACCCACACACAC3' (where C is iC).

[0144] In this embodiment, a primer probe set is designed for DNA template 7 and DNA template 8 in step 2.1, and a verification experiment is performed. The experiments include:

[0145] Forward primer F4: 5′CGTTTGTGCGAGTCGTTGTTCG3′;

[0146] Reverse primer R: 5′AAAAACTTCACCCACACGCACG3′;

[0147] Probe P4: 5'FAM-TCGTAGCGGGTGCGTGCGAATGATTG-BHQ13';

[0148] DNA molecule lock L4: 5'ACAAACACACTCAACAACAAACCCAACATCACCCACACACACTTACTAACAACACAC3' (where C is iC).

[0149] In this embodiment, a primer probe set is designed for DNA template 9 and DNA template 10 in step 2.1, and a verification experiment is performed. The experiments include:

[0150] Forward primer F5: 5′CGTTTATACGAGTCGTTATTCGAATCGT3′;

[0151] Reverse primer R5: 5′ATCTCCGAAAACCCGAAAACG3′;

[0152] Probe P5: 5'FAM-CGGATACGTACGAATGATTATCGTACGTGCGAACG-BHQ1 3';

[0153] DNA molecule lock L5: 5'ACAAATATACTCAACAATAAACTTAACATCACCTATACATACTTACTAATAACATACACACTTACTACAAAAACCCAAAAAC3' (where C is iC).

[0154] 2.3 Experimental methods

[0155] The binding reaction conditions of the DNA molecule lock and the DNA template in this embodiment are as follows:

[0156] Table 7: DNA molecular lock and DNA template binding reaction system

[0157] Reagents Volume μL / reaction DNA Molecular Lock (10μM) 0.6 Hybridization buffer (20 mM PBS, pH 7.0) 3.8 DNA template (0.00002ng / μL) 0.6

[0158] The detection method qPCR of this embodiment is used to detect the reaction system added with the DNA molecular lock as shown in Table 8 below, wherein Sample 16 is a system after 0.6 μL of DNA template 1 is combined with the DNA molecular lock, Sample 17 is a system after 0.6 μL of DNA template 2 is combined with the DNA molecular lock, Sample 18 is a system after 0.6 μL of DNA template 3 is combined with the DNA molecular lock, Sample 19 is a system after 0.6 μL of DNA template 4 is combined with the DNA molecular lock, Sample 20 is a system after 0.6 μL of DNA template 5 is combined with the DNA molecular lock, Sample 21 is a system after 0.6 μL of DNA template 6 is combined with the DNA molecular lock, Sample 22 is a system after 0.6 μL of DNA template 7 is combined with the DNA molecular lock, Sample 23 is a system after 0.6 μL of DNA template 8 is combined with the DNA molecular lock, Sample 24 is a system after 0.6 μL of DNA template 9 is combined with the DNA molecular lock, and Sample 25 is a system after 0.6 μL of DNA template 10 is combined with the DNA molecular lock.

[0159] Table 8: qPCR reaction system for testing the blocking effect of adding DNA molecular lock

[0160]

[0161] The detection method qPCR of this embodiment is used to detect the control reaction system without adding the DNA molecular lock as shown in Table 9 below, wherein Sample 26 is the template of DNA template 1, Sample 27 is the template of DNA template 2, Sample 28 is the template of DNA template 3, Sample 29 is the template of DNA template 4, Sample 30 is the template of DNA template 5, Sample 31 is the template of DNA template 6, Sample 32 is the template of DNA template 7, Sample 33 is the template of DNA template 8, Sample 34 is the template of DNA template 9, and Sample 35 is the template of DNA template 10.

[0162] Table 9: DNA molecular lock blocking effect detection control experiment qPCR reaction system table

[0163]

[0164] 2.4 Experimental Results

[0165] like Figure 5 , Figure 6 , Figure 7 As shown, the amplification curves of the qPCR reactions performed with or without the addition of the DNA molecular lock of the present invention are normal, indicating that the qPCR reactions are normal and the results are reliable.

[0166] As shown in Table 10, it is a statistical table of qCPR reaction results of this embodiment, and Table 11 is a statistical table of internal standard channel results of qPCR reaction of this embodiment.

[0167] Table 10: CT value statistics of qPCR reaction results of DNA molecular lock on different numbers of CpG template blocking effects

[0168] Sample name Parallel Replication 1 Parallel Repeat 2 Sample16 27.45 27.76 Sample26 27.52 27.74 Sample17 nd nd Sample27 35.31 34.01 Sample18 27.96 27.61 Sample28 27.55 27.71 Sample19 nd nd Sample29 36.71 38.64 Sample20 27.76 27.4 Sample30 27.48 27.34 Sample21 nd nd Sample31 nd 39.61 Sample22 27.87 27.06 Sample32 27.46 27.34 Sample23 nd nd Sample33 37.7 nd Sample24 27.56 27.6 Sample34 27.19 27.06 Sample25 nd nd Sample35 nd nd

[0169] Table 11: CT value statistics of the internal standard channel results of qPCR reaction in DNA molecular lock blocking effect detection experiment

[0170]

[0171]

[0172] From the amplification curve and the results, it can be seen that for completely non-methylated samples, when no DNA molecular lock is added, the primer probe designed for methylation amplification can be partially amplified, and non-specific amplification can be avoided only when the number of CpG sites reaches 15. When the DNA molecular lock is added, the amplification of the non-methylated template can be completely inhibited; for completely methylated samples, the addition of the DNA molecular lock does not inhibit the amplification reaction of the methylated sample. In summary, the DNA molecular lock described in the present invention has a good blocking effect on methylated DNA templates with various CpG site numbers, which can greatly improve the sensitivity and accuracy of DNA methylation detection and greatly reduce the false detection rate of methylation.

[0173] Example 3 Blocking effect of the number of DNA molecular locks on non-methylated templates

[0174] 3.1 Design of synthetic and bisulfite-converted amplification template

[0175] In this example, the purpose is to verify that the DNA molecular lock described in the present invention has a good blocking effect on non-methylated DNA templates in single or multiple fragments.

[0176] For this purpose, two groups of sequences were artificially designed and synthesized in this embodiment. The first group is a completely methylated DNA sequence 11 containing 5 CpG sites, and its nucleotide sequence is the 5 CpG sites of the sequence shown in SEQ ID NO.6 are completely methylated:

[0177] ACTGCTGAGACTGTGTCTGCCCTGTGAGCACAGAGCCTTGCCTTTGCTGATCTGCTGCCTGTCCA CACCTGCTGCCAGGTAAGCCTGGCCAGCTGACTGGGGCAGGTGGCTCATGGCCTGGCTGCAGGTGGC TGTGGCCCCTTTGCCC CH3 GTGCAGAGCTGCC CH3 GTCTGGGCTGCAGC CH3 GGGTGCAC CH3 GGGAACC CH3GGACTGCTGTGGGGGGTGGGAGAAGCCCCTGGGCCTCTGGAGATGGGGGACACCCCATGCCA GTTTGGAGGTGTGAGGCTGTGCTTGGGAGGTGTGCTCTGGGGGTGCTCTTGGGGTGGGGGCAAC TGGTGGGGTCTTTGTCTGAGCTGGGCTCTTGCCAATGGGGATTGCAGGGTGGGTGTGGTGGAGCCCC TGCCAGGCCTGGTGGGGGCTGGGG.

[0178] A bisulfite conversion experiment is performed on the first group of designed and synthesized DNA sequences 11 to obtain a DNA template 11 for QPCR amplification, which is a DNA template after all non-methylated cytosines in the DNA sequence 11 are replaced with uracil.

[0179] The second group is a completely unmethylated DNA sequence 12 containing 5 CpG sites, and its nucleotide sequence is shown in SEQ ID NO.6.

[0180] A bisulfite conversion experiment is performed on the second group of designed and synthesized DNA sequences 12 to obtain DNA templates 12 for QPCR amplification, which are DNA templates after all cytosines in the DNA sequences 12 are replaced with uracil.

[0181] 3.2 Design of amplification primers and probes

[0182] In this example, a primer probe set was designed for the sequence in step 3.1, and a verification experiment was performed, which included:

[0183] Forward primer F6: 5′TTTGTTCGTGTAGAGTTGTCGTTTGG3′;

[0184] Reverse primer R6: 5′CAAAAACCCAAAAACTTCTCCCACAC3′;

[0185] Probe P6: 5'FAM-TAGCGGGTGTACGGGAATCGGATTGTTGT-BHQ1 3';

[0186] DNA molecular lock L6: 5'CAAACACATCTCAACAACAAACCCAACATCACCCACATACCCTTAACCTAACAA3' (where C is iC);

[0187] DNA molecular lock L7: 5'CAAACACATCTCAACAACAAACCC, 5'ATCACCCACATACCCTTAACCTAACAA3' (where C is iC);

[0188] DNA molecular lock L8: 5'CCACCAACACCAAAAAAACAAACACAT3', 5'TCAACAACAAACCCAACATCACCCAC3', 5'TACCCTTAACCTAACAACACCCC3' (where C is iC).

[0189] 3.3 Experimental methods

[0190] The reaction condition system for the binding of the DNA molecular lock and the DNA template in this embodiment (the volume of the molecular lock represents the volume of one molecular lock segment DNA molecular lock L6, two molecular lock segment DNA molecular lock L7 and three molecular lock segment DNA molecular lock L8, that is, the volume of each molecular lock segment is 0.6 μL).

[0191] Table 12: DNA molecular lock and DNA template binding reaction system

[0192] Reagents Volume μL / reaction DNA Molecular Lock (10μM) 0.6、1.2、1.8 Hybridization buffer (20 mM PBS, pH 7.0) 3.8、3.2、2.6 DNA template (0.00002ng / μL) 0.6

[0193] The detection method of this embodiment is qPCR, and the reaction system is shown in Table 13 below, wherein Sample 36, Sample 37, and Sample 38 are respectively the systems after 0.6 μL DNA template 11 reacts with DNA molecular locks L6, L7, and L8, and Sample 39, Sample 40, and Sample 41 are respectively the systems after 0.6 μL DNA template 12 reacts with DNA molecular locks L6, L7, and L8.

[0194] Table 13: DNA molecular lock blocking effect detection experiment qPCR reaction system table

[0195] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10uM) 0.3 R primer (10uM) 0.3 Probe (10uM) 0.3 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 10.1 Samples: Sample36, Sample37, Sample38, Sample39, Sample40, Sample41 5

[0196] In the detection method qPCR of this embodiment without adding molecular lock DNA, the reaction system is shown in Table 14 below, wherein Sample 42 is DNA template 11 and Sample 43 is DNA template 12.

[0197] Table 14: Molecular lock blocking effect detection experiment control qPCR reaction system table

[0198] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.3 R primer (10 μM) 0.3 Probe (10 μM) 0.3 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 14.5 Samples: Sample42, Sample43 0.6

[0199] 3.4 Experimental Results

[0200] like Figure 8 , Fig. 9 , Fig.10 As shown, the amplification curves of the qPCR reactions performed with or without adding different amounts of the DNA molecular locks described in the present invention are all normal, indicating that the qPCR reactions are normal and the results are reliable.

[0201] As shown in Table 15, it is a statistical table of the qCPR reaction results of this embodiment, and Table 16 is a statistical table of the internal standard channel results of the qPCR reaction of this embodiment.

[0202] Table 15: CT value statistics of qPCR reaction results of DNA molecular lock blocking effect detection experiment

[0203] Sample name Parallel Replication 1 Parallel Repeat 2 Parallel Replication 3 Sample36 26.56 26.89 26.38 Sample37 26.3 26.61 26.46 Sample38 26.67 26.45 26.53 Sample39 38.29 Nd Nd Sample40 Nd Nd Nd Sample41 Nd Nd Nd Sample42 26.75 26.75 26.49 Sample43 38.3 37.41 38.42

[0204] Table 16: CT value statistics of the internal standard channel results of qPCR reaction in DNA molecular lock blocking effect detection experiment

[0205] Sample name Parallel Replication 1 Parallel Repeat 2 Parallel Replication 3 Sample36 27.2 27.36 27.29 Sample37 27.19 27.18 27.27 Sample38 27.31 27.24 27.19 Sample39 27.25 27.32 27.1 Sample40 27.23 27.25 27.23 Sample41 27.32 27.26 27.22 Sample42 26.97 27.25 27.18 Sample43 27.4 27.43 27.37

[0206] From the amplification curve and results, it can be seen that for completely non-methylated samples, when no DNA molecular lock is added, the primer probe designed for methylation amplification can be amplified, and when the DNA molecular lock is added, the amplification of the non-methylated template can be completely inhibited, and the two-segment and three-segment DNA molecular lock fragments have a better blocking effect; for completely methylated samples, the addition of one, two or three segments of DNA molecular locks does not inhibit the amplification reaction of the methylated sample. In summary, the blocking effect of the DNA molecular lock on the non-methylated template does not depend on the number of DNA molecular locks, and has no non-specific binding effect on the methylated DNA template.

[0207] Example 4 The blocking effect of the relative position of DNA molecular lock and primer probe on the non-methylated template

[0208] 4.1 Design of synthetic and bisulfite-converted amplification template

[0209] In this example, the purpose is to verify that the DNA molecular lock described in the present invention has a good blocking effect on the non-methylated DNA template at different relative positions of the amplification primer probe.

[0210] For this purpose, two groups of sequences were artificially designed and synthesized in this embodiment. The first group is a completely methylated DNA sequence 13 containing 5 CpG sites, and its nucleotide sequence is the 5 CpG sites of the sequence shown in SEQ ID NO.7 are completely methylated:

[0211] ACTGCTGAGACTGTGTCTGCCCTGTGAGCACAGAGCCTTGCCTTTGCTGATCTGCTGCCTGTCCA CACCTGCTGCCAGGTAAGCCTGGCCAGCTGACTGGGGCAGGTGGCTCATGGCCTGGCTGCAGGTGGC TGTGGCCCCTTC CH3 GCCC CH3 GTGCAGC CH3 GCTGCAGTCTGGGCTGCAGGGGTGCAGGGAACGGACC CH3 GCTGC CH3 GGTGTGGGAGAAGCCCCTGGGCCTCTGGAGATGGGGGACACCCCATGCCAGTTTGGA GGTGTGAGGCTGTGCTTGGGAGGTGTGCTCTGGGGGTGCTCTCTTGGGGTGGGGGCAACTGGTGGG GTCTTTGTCTGAGCTGGGCTCTTGCCAATGGGGATTGCAGGGTGGGTGTGGTGGAGCCCCTGCCAGG CCTGGTGGGGGCTGGGG.

[0212] A bisulfite conversion experiment was performed on the first group of designed and synthesized DNA sequences 13 to obtain DNA template 13 for qPCR amplification, which is a DNA template after all non-methylated cytosines in the DNA sequence 13 were replaced with uracil.

[0213] The second group is a completely unmethylated DNA sequence 14 containing 5 CpG sites, and its nucleotide sequence is shown in SEQ ID NO.7.

[0214] The second group of designed and synthesized DNA sequences 14 were subjected to a bisulfite conversion experiment to obtain DNA templates 14 for qPCR amplification, which were DNA templates after all cytosines in the DNA sequences 14 were replaced with uracils.

[0215] 4.2 Design of amplification primers and probes

[0216] In this example, a primer probe set was designed for the sequence in step 4.1, and a verification experiment was performed, which included:

[0217] Primer probe set 1:

[0218] Forward primer F7: 5′GGTTTGGTTGTAGGTGGTTGTGG3′;

[0219] Reverse primer R7: 5′CCTCACACCTCCAAACTAACATAAATATC3′;

[0220] Probe P7: 5'FAM-GGGAGAAGTTTTTGGGTTTTTGGAGATGGG-BHQ13';

[0221] Primer probe set 2:

[0222] Forward primer F8: 5′GTGGTTTTTTCGTTCGTGTAGCG3′;

[0223] Reverse primer R8: 5′TTCTCCCACACCGCAACG3′;

[0224] Probe P8: 5'FAM-GGGAGAAGTTTTTGGGTTTTTGGAGATGGG-BHQ13';

[0225] Primer probe set 3:

[0226] Forward primer F9: 5′GGTTTGGTTGTAGGTGGTTGTGG3′;

[0227] Reverse primer R9: 5′CCTCACACCTCCAAACTAACATAAATATC3′;

[0228] Probe P9: 5'FAM-CGTTCGTGTAGCGTTGTAGTTTGGGTTGTAGGG-BHQ13';

[0229] Primer probe set 4:

[0230] Forward primer F10: 5′GTGGTTTTTTCGTTCGTGTAGCG3′;

[0231] Reverse primer R10: 5′TTCTCCCACACCGCAACG3′;

[0232] Probe P10: 5'FAM-CGTTCGTGTAGCGTTGTAGTTTGGGTTGTAGGG-BHQ13';

[0233] DNA molecule lock L9: 5'ACAAACACATCACAACATCAAACCCAACATCCCCACATCCCTTACCTAACAACAC3' (where C is iC).

[0234] Primer probe group 1 has no overlapping parts between primer and probe and DNA molecule; primer probe group 2 has only overlapping parts between primer and DNA molecule; primer probe group 3 has only overlapping parts between probe and DNA molecule; primer probe group 4 has both overlapping parts between primer and probe and DNA molecule.

[0235] 4.3 Experimental methods

[0236] The binding reaction conditions of the DNA molecule lock and the DNA template in this embodiment are as follows:

[0237] Table 17: DNA molecule lock and DNA template binding reaction system

[0238] Reagents Volume μL / reaction DNA Molecular Lock (10μM) 0.6 Hybridization buffer (20 mM PBS, pH 7.0) 3.8 DNA template (0.00002ng / μL) 0.6

[0239] The detection method of this embodiment is qPCR, and the reaction system is shown in Table 18 below, wherein Sample 44 is the system after 0.6 μL DNA template 13 reacts with the DNA molecule lock, and Sample 45 is the system after 0.6 μL DNA template 14 reacts with the DNA molecule lock.

[0240] Table 18: qPCR reaction system table for blocking effect detection experiment at different DNA molecular lock positions

[0241] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.3 R primer (10 μM) 0.3 Probe (10 μM) 0.3 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 10.1 Samples: Sample44, Sample45 5

[0242] In the detection method qPCR of this embodiment without adding molecular lock DNA, the reaction system is shown in Table 19 below, wherein Sample 46 is DNA template 13 and Sample 47 is DNA template 14.

[0243] Table 19: Molecular lock blocking effect detection experiment control qPCR reaction system table

[0244]

[0245]

[0246] 4.4 Experimental Results

[0247] like Fig.11 , Fig.12 , Fig.13 As shown, the amplification curves of the qPCR reactions performed by adding DNA molecular locks located at different positions are all normal, indicating that there is no abnormality in the qPCR reaction and the results are reliable.

[0248] As shown in Table 20, it is a statistical table of the qCPR reaction results of this embodiment, and Table 21 is a statistical table of the internal standard channel results of the qPCR reaction of this embodiment.

[0249] Table 20: CT value statistics of qPCR reaction results of DNA molecular lock blocking effect detection experiment at different positions

[0250] sample Primer probe set 1 Primer probe set 2 Primer probe set 3 Primer probe set 4 Sample44 26.63 26.62 26.36 26.64 Sample44 26.67 26.66 26.22 26.62 Sample44 26.74 26.59 26.44 26.25 Sample45 nd nd nd nd Sample45 nd nd nd nd Sample45 38.04 nd nd nd Sample46 26.77 26.38 26.76 26.61 Sample46 26.47 26.43 26.96 26.59 Sample46 26.55 26.67 26.51 26.66 Sample47 27.13 35.03 34.8 38.04 Sample47 27.07 37.4 36.16 nd Sample47 26.87 34.34 37.72 33.48

[0251] Table 21: CT value statistics of the internal standard channel results of the qPCR reaction in the DNA molecular lock blocking effect detection experiment at different positions

[0252] sample Primer probe set 1 Primer probe set 2 Primer probe set 3 Primer probe set 4 Sample44 27.75 27.57 27.48 27.6 Sample44 27.71 27.57 27.52 27.4 Sample44 27.54 27.41 27.37 27.37 Sample45 27.6 27.46 27.51 27.68 Sample45 27.63 26.27 27.4 27.73 Sample45 27.28 27.56 27.41 27.6 Sample46 27.46 27.26 27.65 27.41 Sample46 27.49 27.33 27.51 27.43 Sample46 27.38 27.34 27.43 27.36 Sample47 27.52 27.57 27.69 27.44 Sample47 27.35 27.54 27.69 27.53 Sample47 27.18 27.41 27.59 27.68

[0253] From the amplification curve and the results, it can be seen that for completely unmethylated samples, when no DNA molecular lock is added, it can be amplified by the primer probe designed for methylation amplification. When the DNA molecular lock is added, the amplification of the unmethylated template can be completely inhibited, and the DNA molecular lock fragment that overlaps with the primer or probe has a better blocking effect; for completely methylated samples, no matter where the DNA molecular lock is located relative to the primer probe, it has no blocking effect on the amplification reaction of the methylated sample, and when the primer probe does not overlap with the CpG site at all, that is, the unmethylated template can also be well amplified, the addition of the DNA molecular lock can also have a good blocking effect. In summary, the blocking effect of the DNA molecular lock on the unmethylated template described in the present invention does not depend on the relative position of the DNA molecular lock, and has no non-specific binding effect on the methylated DNA template.

[0254] Example 5 Blocking effect of isocytosine content in DNA molecules on non-methylated templates

[0255] 5.1 Design of synthetic and bisulfite-converted amplification template

[0256] In this example, the purpose is to verify that the DNA molecular lock described in the present invention can produce a significant blocking effect on the non-methylated template when the amount of isocytosine contained is within a certain range.

[0257] For this purpose, a group of sequences were artificially designed and synthesized in this embodiment, which were completely unmethylated DNA sequences 14 containing 5 CpG sites, and the sequence information was the same as described above.

[0258] The second group of designed and synthesized DNA sequences were subjected to bisulfite conversion experiments to obtain DNA template 14 for qPCR amplification, and the sequence information was the same as described above.

[0259] 5.2 Design of amplification primers and probes

[0260] In this example, a primer probe set was designed for the sequence in step 5.1, and a verification experiment was performed, which included:

[0261] Forward primer F11: 5′GGTTTGGTTGTAGGTGGTTGTGG3′;

[0262] Reverse primer R11: 5′CCTCACACCTCCAAACTAACATAAATATC3′;

[0263] Probe P11: 5'FAM-GGGAGAAGTTTTTGGGTTTTTGGAGATGGG-BHQ13';

[0264] DNA molecular lock L10: 5'ACAAACACATCACAACATCAAACCCAACATCCCCACATCCCTTACCTAACAACAC3'.

[0265] DNA molecular lock L11: 5'AiCAAACACATiCACAACATiCAAACCiCAACATCCCiCACATCCCTTACCTAACAACAC3'.

[0266] DNA molecular lock L12: 5'AiCAAAiCACATiCACAAiCATiCAAACCiCAACATiCCCiCACATCiCCTTACiC TAACAACAC3'.

[0267] DNA molecular lock L13: 5'AiCAAAiCACATiCAiCAAiCATiCAAAiCCiCAAiCATiCCCiCACATCiCCTTACi CTAAiCAAiCAC3'.

[0268] DNA molecular lock L14: 5'AiCAAAiCAiCATiCAiCAAiCATiCAAAiCiCiCAAiCATiCiCCiCACATiCiCiCTT AiCiCTAAiCAAiCAiC3'.

[0269] DNA molecular lock L15: 5'AiCAAAiCAiCATiCAiCAAiCATiCAAAiCiCiCAAiCATiCiCiCiCAiCATiCiCiCT TAiCiCTAAiCAAiCAiC3'.

[0270] Molecular lock L10 is a molecular lock sequence containing 0% isocytosine; molecular lock L11 is a molecular lock sequence containing 10% isocytosine; molecular lock L12 is a molecular lock sequence containing 20% ​​isocytosine; molecular lock L13 is a molecular lock sequence containing 30% isocytosine; molecular lock L14 is a molecular lock sequence containing 40% isocytosine; molecular lock L15 is a molecular lock sequence containing 44% isocytosine, where the percentage is the ratio of the number of isocytosines to the number of bases in the entire molecular lock.

[0271] 5.3 Experimental methods

[0272] The binding reaction conditions of the DNA molecule lock and the DNA template in this embodiment are as follows:

[0273] Table 22: DNA molecule lock and DNA template binding reaction system

[0274]

[0275]

[0276] The detection method of this embodiment is qPCR, and the reaction system is shown in Table 23 below, wherein Sample 48 is the system after the DNA template 14 and the DNA molecule lock are combined and reacted.

[0277] Table 23: qPCR reaction system for DNA molecular lock blocking effect detection experiment with different isocytosine contents

[0278] Reagents Volume μL / reaction 5*buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10uM) 0.3 R primer (10uM) 0.3 Probe (10uM) 0.3 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 10.1 Sample: Sample48 5

[0279] In the detection method qPCR of this embodiment without adding molecular lock DNA, the reaction system is shown in Table 24 below, where Sample 49 is DNA template 14.

[0280] Table 24: Molecular lock blocking effect detection experiment control qPCR reaction system table

[0281] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.3 R primer (10 μM) 0.3 Probe (10 μM) 0.3 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 14.5 Sample: Sample49 0.6

[0282] 5.4 Experimental Results

[0283] like Fig.14 , Fig.15 As shown, the amplification curves of the qPCR reactions performed by adding DNA molecular locks with different isocytosine contents were all normal, indicating that the qPCR reactions were normal and the results were reliable.

[0284] As shown in Table 25, it is a statistical table of the qCPR reaction results of this embodiment, and Table 26 is a statistical table of the internal standard channel results of the qPCR reaction of this embodiment.

[0285] Table 25: CT value statistics of qPCR reaction results of DNA molecular lock blocking effect detection experiment with different isocytosine contents

[0286]

[0287]

[0288] Table 26: CT value statistics of the internal standard channel results of the qPCR reaction in the DNA molecular lock blocking effect detection experiment with different isocytosine contents

[0289] Molecular lock L7 L8 L9 L10 L11 L12 Sample48 27.20 27.15 27.31 27.12 27.47 27.40 Sample48 27.36 27.22 27.21 27.06 27.31 27.33 Sample49 27.16 27.39 27.10 27.15 27.21 27.56 Sample49 27.30 27.21 27.29 27.31 27.24 27.26

[0290] From the amplification curve and the results, it can be seen that when the isocytosine content in the DNA molecular lock (relative to the total amount of cytosine) is greater than or equal to 20%, a better blocking effect on the non-methylated template can be achieved. In summary, the blocking effect of the DNA molecular lock of the present invention on the non-methylated template is greater than or equal to 20% of the isocytosine content.

[0291] Example 6 Blocking effect of DNA molecule lock nucleic acid content on non-methylated template

[0292] 6.1 Design of synthetic and bisulfite-converted amplification template

[0293] In this example, the purpose is to verify that the DNA molecular lock described in the present invention can produce a significant blocking effect on the non-methylated template when the amount of isocytosine contained is within a certain range.

[0294] For this purpose, a group of sequences were artificially designed and synthesized in this embodiment, which are completely unmethylated DNA sequences 14 containing 5 CpG sites, and the sequence information is the same as described above.

[0295] The second group of designed and synthesized DNA sequences were subjected to bisulfite conversion experiments to obtain DNA template 14 for qPCR amplification, and the sequence information was the same as described above.

[0296] 6.2 Design of amplification primers and probes

[0297] In this example, a primer probe set is designed for the sequence in step 6.1, and a verification experiment is performed, which includes:

[0298] Forward primer F12: 5′GGTTTGGTTGTAGGTGGTTGTGG3′;

[0299] Reverse primer R12: 5′CCTCACACCTCCAAACTAACATAAATATC 3′;

[0300] Probe P12: 5'FAM-GGGAGAAGTTTTTGGGTTTTTGGAGATGGG-BHQ1 3';

[0301] DNA molecule lock L16:5'ACAAACACATCACAACATCAAACCCAACATCCCCACATCC

[0302] CTTACCTAACAACAC3' (where C is iC);

[0303] DNA molecule lock L17:5'LNACAAACACATCACAACATCAAACCCAACATCC

[0304] CCACATCCCTTACCTAACAACAC3' (where C is iC);

[0305] DNA molecular lock L18:5'LNACAALNACACATCACAACATCAALNACCCAACATCC

[0306] CCLNACATCCCTTACCTLNAACAACAC3' (where C is iC);

[0307] DNA molecular lock L19:5'LNACAALNACACLNATCACAACATCAALNACCCLNAACATCC

[0308] CCLNACLNATCCCTTLNACCTLNAACAACLNAC3' (where C is iC).

[0309] Molecular lock L16 is a molecular lock sequence that does not contain a lock nucleic acid; molecular lock L17 is a molecular lock sequence that contains one lock nucleic acid; molecular lock L18 is a molecular lock sequence that contains 5 lock nucleic acids; and molecular lock L19 is a molecular lock sequence that contains 10 lock nucleic acids.

[0310] 6.3 Experimental methods

[0311] The binding reaction conditions of the DNA molecule lock and the DNA template in this embodiment are as follows:

[0312] Table 27: DNA molecule lock and DNA template binding reaction system

[0313]

[0314]

[0315] The detection method of this embodiment is qPCR, and the reaction system is shown in Table 28 below, where Sample 50 is the system after 0.6 μL of DNA template 14 and DNA molecule lock are combined and reacted.

[0316] Table 28: qPCR reaction system for DNA molecular lock blocking effect detection experiment with different locked nucleic acid contents

[0317] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.3 R primer (10 μM) 0.3 Probe (10 μM) 0.3 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 10.1 Sample: Sample50 5

[0318] In the detection method qPCR of this embodiment without adding molecular locked DNA, the reaction system is shown in Table 29 below, wherein Sample 51 is the DNA template 14.

[0319] Table 29: Table of control qPCR reaction systems for molecular lock blocking effect detection experiments with different locked nucleic acid contents

[0320] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.3 R primer (10 μM) 0.3 Probe (10 μM) 0.3 ACTB Plasmid (CT 27) 1 ACTBF (10 μM) 0.3 ACTBR (10 μM) 0.3 ACTBP (10 μM) 0.3 Taq enzyme 0.35 <![CDATA[H2O]]> 14.5 Sample: Sample51 0.6

[0321] 6.4 Experimental Results

[0322] like Fig.16 , Fig.17 As shown, the amplification curves of the qPCR reactions performed by adding DNA molecular locks with different contents of locked nucleic acid were all normal, indicating that there was no abnormality in the qPCR reaction and the results were reliable.

[0323] As shown in Table 30, it is a statistical table of the qCPR reaction results of this embodiment, and Table 31 is a statistical table of the internal standard channel results of the qPCR reaction of this embodiment.

[0324] Table 30: CT value statistics of DNA molecular lock blocking effect detection experiment qPCR reaction results with different locked nucleic acid contents

[0325]

[0326]

[0327] Table 31: CT value statistics of the internal standard channel results of the qPCR reaction in the DNA molecular lock blocking effect detection experiment with different locked nucleic acid contents

[0328] Molecular lock L13 L14 L15 L16 Sample50 26.98 27.11 27.41 27.55 Sample50 27.1 27.54 27 27.36 Sample51 27.52 27.12 27.4 26.9 Sample51 27.4 27.23 27.36 27.12

[0329] From the amplification curve and results, it can be seen that when the number of locked nucleic acids in the DNA molecular lock reaches one, the blocking effect of the molecular lock on the non-methylated template can be significantly improved. At the same time, as the number of locked nucleic acids in the DNA molecular lock increases, the blocking effect on the non-methylated template can be stably produced. In summary, compared with the DNA molecular lock without locked nucleic acid, the addition of locked nucleic acid can significantly improve the blocking effect of the DNA molecular lock on the non-methylated template, and as the number of locked nucleic acids increases, the blocking effect of the DNA molecular lock on the non-methylated template can be improved.

[0330] Example 7 DNA molecular lock blocking effect test experiment on real gene non-methylated template

[0331] 7.1 Selection of genes for blocking effect experiments

[0332] In this example, the purpose is to verify that the DNA molecular lock described in the present invention can achieve ideal results when blocking the non-methylated sites of genes in real samples, and does not affect the methylated sites.

[0333] To this end, in this embodiment, specific sequences of eight genes were selected, among which the CpG sites in the specific sequences of four genes were all in a low methylation state in the HEK293T cell line, and the CpG sites in the specific sequences of the other four genes were all in a high methylation state in the HEK293T cell line.

[0334] The first gene is EIF1AY, and its sequence is gene sequence 1: GTACTGGCCACTG CG ACCCCAGCACTGTGTT CG GGAAAGGAGCTGGGAATGCCCTATTTGGGTCACATTGGGGTGGGACAGA CG CCATTTTTGTGGGGCCTCCTT CG GAAGATAG CG GGCTTTTGCTG, which contains five CpG sites. These five CpG sites are all in a low methylation state in the HEK293T cell line, and the methylation rates are 0.012, 0.023, 0.054, 0.033, and 0.041, respectively.

[0335] The second gene is ZFY, and its sequence is gene sequence 2: CG AGGGCAGAGGAATAAAATTTCCCCAAGG CG ACTTT TCCCATTTATGTGGAAACACTTTTTTGATGAGCTGTATTTAAA CG AG CG AGCTTTTTTTTAGTC CG TGTA CTTTTTTTGAGTAAGAGATGGAAAATAGGCAGA, which contains five CpG sites. These five CpG sites are all in a low methylation state in the HEK293T cell line, and the methylation rates are 0.122, 0.025, 0.033, 0.012, and 0.024, respectively.

[0336] The third gene is TXLNGY, and its sequence is gene sequence 3: CTGGCTG CG GCCACTTGCCATC CG GTCCTGTGAC TGAGAAGGAAAGGAGACTG CG TAGCTGGGGGTGCAATG CG CAGCTGCAGCTACAAAGCC CG GCTTT CATACTGTGTAACAGCTTCACCTCAACTGGCGTAG CGCAC contains six CpG sites, all of which are in a low-methylation state in the HEK293T cell line, with methylation rates of 0.022, 0.032, 0.045, 0.066, 0.012, and 0.021, respectively.

[0337] The fourth gene is TTTY15, and its sequence is gene sequence 4: GAGACTAGACTCAGACCTACACCTGGGAATGG CG GACAACAAAATATCTGTAAAATATTTTGATATTAGGTACTTTCTAGGCA CGCG GT CG TGACTG CG GCCT GCATGCCTGAGGAAGACATTGCTCACAAATAC CG GGA contains six CpG sites. These six CpG sites are all in a low methylation state in the HEK293T cell line, and the methylation rates are 0.011, 0.013, 0.044, 0.021, 0.024, and 0.026, respectively.

[0338] The fifth gene is RPS4Y2, and its sequence is gene sequence 5: GGGGCCCCAAGAAGCACTTGAAG CG TGTTGCAG CG C CG AAGCATTGGATGCTGGATAAACTAACTGGTGTATTTGTGAGTATAACTGTATTTGCTTTTTACTCA AAAGTGCATGCTGTGTACCTGTGGCTTGCTATTT, which contains three CpG sites. These three CpG sites are all highly methylated in the HEK293T cell line, and the methylation rates are 0.9625, 0.9752, and 0.894, respectively.

[0339] The sixth gene is RHOXF1, and its sequence is gene sequence 6: GCATAAGCAAGTCCCACTCATTGCAACTGTAACC AATACCAAGCATGAGAACAGGAACTAGCTCCACCCTCTAACCCCCACTCCAGCTGCAGA CG CCA CG GAGTTTGTGCAGGGG CG CAG CGCTCC contains four CpG sites. All four CpG sites are highly methylated in the HEK293T cell line, with methylation rates of 0.9562, 0.9236, 0.9145, and 0.8952, respectively.

[0340] The seventh gene is MAGEB2, and its sequence is gene sequence 7: GAACTTTCCAGGTGGAACATTGC CG GA CG GCTTT CG GAGCCTCTCAGGACCAAATGCAGAAG CG GGACTTAGTGGGGCCCTCTTTGTTACAGGTGGGGG TGGTCTCTTCAGTTTACACTCAGGGTCCTCACCTTGACT, which contains four CpG sites. These four CpG sites are all highly methylated in the HEK293T cell line, and the methylation rates are 0.9765, 0.9653, 0.9233, and 0.9536, respectively.

[0341] The eighth gene is POF1B, and its sequence is gene sequence 8: GCC CG TGTCCTCCCCACAACAGCCTCCCT CG TGCC ACTTTGCTTGCA CG CACTCTCCCATGGCCACCCCCAACC CG TCACAT CG TTTTGACAGTG CG TGTGTG CAGAAGGGCCTTGCCTCCCCTTTCCCACTAGCATGAA, which contains six CpG sites. These six CpG sites are all in a high methylation state in the HEK293T cell line, and the methylation rates are 0.9852, 0.9665, 0.8963, 0.9546, 0.9326, and 0.9454, respectively.

[0342] After all gene sequences are converted by bisulfite, all unmethylated cytosines will be converted into uracil, while methylated cytosines remain unchanged.

[0343] 7.2 Design of amplification primers and probes

[0344] In this example, a primer probe set is designed for the methylation sequence in step 7.1, and a verification experiment is performed, which includes a primer probe set for detecting the gene EIF1AY:

[0345] Forward primer F13: 5′GCGATTTTAGTATTGTGTTCGGGAAA 3′;

[0346] Reverse primer R13: 5′AAACCCGCTATCTTCCGAAAAAAAC 3′;

[0347] Probe P13: 5'FAM-GGGGTGGGATAGACGTTATTTTTGTGGG-BHQ1 3';

[0348] DNA molecule lock L17: 5'CACTAAAATCATAACACAAACCCTTTCCTCAAC 3',

[0349] 5'CTACAATAAAAACACCCCAAAAAAAACCTTCTATCACCCA 3' (where C is iC and A is LNA);

[0350] Primer probe set for detecting gene ZFY:

[0351] Forward primer F14: 5′AAATTTTTTTAAGGCGATTTTTTTTATTTATG 3′;

[0352] Reverse primer R14: 5′AAAATACACGAACTAAAAAAAAACTCGC 3′;

[0353] Probe P14: 5′FAM-GAAATATTTTTTTGATGAGTTGTATTTAAACG-MGB 3′;

[0354] DNA molecular lock L18: 5'ACTCCCATCTCCTTATTTTAAAAAAATTCCACTAAAAAAAATAAAT 3', 5'CAT AAATTTACTCACTCAAAAAAAAATCAAACACATAAAAAAAACTCATTC 3' (where C is iC and A is LNA); primer probe set for detecting gene TXLNGY:

[0355] Forward primer F15: 5′GGTTGCGGTTATTTGTTATTCGGTTT 3′;

[0356] Reverse primer R15: 5′CTACACCAATTAAAATAAAACTATTACACAATATAAAAAC 3′;

[0357] Probe P15: 5'FAM-AGTTGGGGGTGTAATGCGTAGTTGTAGTTATAAAG-BHQ1 3';

[0358] DNA molecular lock L19: 5'CACCAATAAACAATAAACCAAAACACTAACTCTTCCTTTCCTCTAACAC 3', 5'CACATCAACATCAATATTTCAAACCAAAAATATAACACATTATCAAAATAAAATTAACCACATCACAT 3' (where C is iC and A is LNA);

[0359] Primer probe set for detecting gene TTTY15:

[0360] Forward primer F16: 5′GAGATTAGATTTAGATTTATATTTGGGAATGG 3′;

[0361] Reverse primer R16: 5′CAATATCTTCCTCAAACATACAAACCGC 3′;

[0362] Probe P16: 5'FAM-GTAAAATATTTTGATATTAGGTATTTTTTAGG-MGB 3';

[0363] DNA molecular lock L20: 5'CACCTATTATTTTATAAACATTTTATAAAACTATAATCCATAAAAAATCCATACACC 3', 5'AACACTAACACCAAACATACAAACTCCTTCTATAACAAATATTTATAACC 3' (where C is iC and A is LNA);

[0364] Primer probe set for detecting gene RPS4Y2:

[0365] Forward primer F17: 5′GGGGTTTTAAGAAGTATTTGAAGCGTGT 3′;

[0366] Reverse primer R17: 5′AAATAACAAACCACAAATACACAACATACAC 3′;

[0367] Probe P17: 5′FAM-GTATTGGATGTTGGATAAATTAATT-MGB 3′;

[0368] DNA molecular lock L21: 5'CATAAACTTCACACAACATCACAACTTCATAACCTACAACCTA 3' (where C is iC and A is LNA);

[0369] Primer probe set for detecting the gene RHOXF1:

[0370] Forward primer F18: 5′GTAATTGTAATTAATATTAAGTATGAGAATAGGAATTAG 3′;

[0371] Reverse primer R18: 5′AAACGCTACGCCCCTACACAAACT 3′;

[0372] Probe P18: 5'FAM-TTTTATTTTTTAATTTTTATTTTAGTTGTAGACGTTACGG-MGB 3';

[0373] DNA molecular lock L22: 5'CATCTACAATACCTCAAACACATCCCCACATCACAAAA 3' (where C is iC and A is LNA);

[0374] Primer probe set for detecting gene MAGEB2:

[0375] Forward primer F19: 5′GAATTTTTTAGGTGGAATATTGTCGGAC 3′;

[0376] Reverse primer R19: 5′AATCAAAATAAAAACCCTAAATATAAACTAAAAAAACCA 3′;

[0377] Probe P19: 5'FAM-GGATTTAGTGGGGTTTTTTTTTGTTATAGGT-MGB 3';

[0378] DNA molecular lock L23: 5'TAACAACCTACCAAAATAACCTCAAAAAATCCTAATTTACATCTTCACCCTAAAT 3' (where C is iC and A is LNA);

[0379] Primer probe set for detecting gene POF1B:

[0380] Forward primer F20: 5′GTTCGTGTTTTTTTTATAATAGTTTTTTTCGTGTT 3′;

[0381] Reverse primer R20: 5′CAAAACCCTTCTACACACACGCACTAT 3′;

[0382] Probe P20: 5'FAM-GTTTGTACGTATTTTTTTATGGGTTATTTTTAAT-MGB 3';

[0383] DNA molecular lock L24: 5'AACACAAAAAAAATATTATCAAAAAAAACACAATAAAACAAACATACATAAAAAAATACC 3', 5'TAAACAATATAACAAAACTATCACACACACACATCTT 3' (where C is iC and A is LNA).

[0384] 7.3 Experimental methods

[0385] The binding reaction conditions of the DNA molecular lock and the DNA sample in this embodiment are as follows:

[0386] Table 32: DNA molecule lock and DNA template binding reaction system

[0387] Reagents Volume μL / reaction DNA Molecular Lock (10μM) 0.6 (monomolecule lock), 1.2 (bimolecular lock) Hybridization buffer (20 mM PBS, pH 7.0) 3.8 (monomolecule lock), 3.2 (bimolecular lock) HEK293T cell line genomic DNA (50ng / μL) 0.6

[0388] The detection method of this embodiment is qPCR, and the reaction system is shown in Table 33 below, where Sample 52 is a system after 0.6 μL of HEK293T cell line genomic DNA extraction and transformation product is combined with DNA molecular lock (a sample is set up for each gene of EIF1AY, ZFY, TXLNGY, TTTY15, RPS4Y2, RHOXF1, MAGEB2, and POF1B).

[0389] Table 33: qPCR reaction system table for real sample DNA molecular lock blocking effect detection experiment

[0390] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.75 R primer (10 μM) 0.75 Probe (10 μM) 0.65 Primer F (internal standard ACTB) 0.3 R primer (internal standard ACTB) 0.3 Probe (internal standard ACTB) 0.2 Taq enzyme 0.40 <![CDATA[H2O]]> 4.9 Sample: Sample52 5

[0391] In the detection method qPCR without adding molecular lock DNA in this embodiment, the reaction system is shown in Table 34 below, where Sample 53 is the transformation product extracted from the genomic DNA of the HEK293T cell line.

[0392] Table 34: Control qPCR reaction system table for real sample molecular lock blocking effect detection experiment

[0393] Reagents Volume μL / reaction 5×buffer 5 <![CDATA[Mg 2+ ]]> 1.25 dNTP 0.5 F primer (10 μM) 0.75 R primer (10 μM) 0.75 Probe (10 μM) 0.65 Primer F (internal standard ACTB) 0.3 R primer (internal standard ACTB) 0.3 Probe (internal standard ACTB) 0.2 Taq enzyme 0.4 <![CDATA[H2O]]> 9.3 Sample: Sample53 0.6

[0394] 7.4 Experimental Results

[0395] like Figure 18-21As shown, the amplification curves of the qPCR reactions performed with or without the addition of the DNA molecule lock were normal, indicating that there was no abnormality in the qPCR reaction and the results were reliable.

[0396] As shown in Table 35, it is a statistical table of the qCPR reaction results of this embodiment, and Table 36 is a statistical table of the internal standard channel results of the qPCR reaction of this embodiment.

[0397] Table 35: CT value statistics of qPCR reaction results of DNA molecular lock blocking effect detection experiment of real samples

[0398] Gene EIF1AY ZF TXLNGY TTTY15 RPS4Y2 RHOXF1 MAGEB2 POF1B Sample52 nd nd nd nd 29.82 30.07 30.9 30.82 Sample52 nd nd nd nd 30.08 30.11 30.9 31.06 Sample52 nd nd nd n.d. 30.18 30.11 30.85 31.2 Sample53 37.02 38.75 36.26 37.88 29.75 29.98 30.77 30.91 Sample53 37.13 37.67 37.28 36.31 29.85 30.24 30.93 31.07 Sample53 36.58 36.99 36.04 36.96 29.96 30.16 30.96 30.97

[0399] Table 36: CT value statistics of the internal standard channel results of the qPCR reaction of the real sample DNA molecular lock blocking effect detection experiment

[0400] Gene EIF1AY ZFY TXLNGY TTTY15 RPS4Y2 RHOXF1 MAGEB2 POF1B Sample52 28.26 28.12 28.17 28.21 27.94 27.93 28.05 28.25 Sample52 28.26 28.14 28.24 28.25 28.08 27.95 28.09 28.37 Sample52 28.24 28.19 28.21 28.37 28.09 27.98 28.18 28.28 Sample53 28.02 28.13 28.11 28.31 28.06 27.76 27.91 28.04 Sample53 27.95 28.15 28.12 28.37 27.95 28.09 28.04 28.17 Sample53 27.98 28.02 28.12 28.25 28.02 27.96 28 28.16

[0401] From the amplification curve and results, it can be seen that for extremely low methylation genes, nonspecific amplification, i.e., false positive signals, occurs when the DNA molecular lock is not added. After adding the DNA molecular lock, nonspecific amplification can be effectively avoided, and false positives can be avoided; for extremely high methylation genes, when the DNA molecular lock is not added, the target genes are amplified normally, and they can also be amplified normally after adding the DNA molecular lock, and there is no effect on the amplification efficiency and amplification results of the target genes. In summary, the DNA molecular lock described in the present invention can efficiently inhibit nonspecific non-methylated template amplification, thereby significantly reducing the false positive rate of QPCR detection and improving the accuracy and reliability of the detection results.

Claims

1. A DNA molecular lock for detecting DNA fragment methylation, characterized in that The DNA molecular lock is complementary to the sequence in which cytosine in the DNA fragment is replaced by uracil in the same direction, and the cytosine base in the DNA molecular lock is replaced by an isocytosine base.

2. The DNA molecular lock as claimed in claim 1, characterized in that The ratio of the number of isocytosine in the DNA molecular lock to the number of molecular lock bases is greater than or equal to 1:

4.

3. The DNA molecular lock as claimed in claim 1, characterized in that The DNA molecular lock covers the CPG site of the DNA fragment.

4. The DNA molecular lock according to any one of claims 1 to 3, characterized in that The adenine deoxyribonucleotide in the DNA molecular lock is replaced by adenine LNA.

5. A method for detecting DNA fragment methylation, characterized in that The detection is performed using the DNA molecular lock described in any one of claims 1 to 4.

6. The method according to claim 5, characterized in that The cytosine in the DNA fragment is converted into uracil. If there is no methylation site in the DNA fragment, the converted DNA fragment will be parallel and complementary to the DNA molecular lock, and the amplification of the DNA fragment will be inhibited; if there is a methylation site in the parallel complementary region between the DNA fragment and the DNA molecular lock, the converted DNA fragment cannot be complementary to the molecular lock DNA sequence, and the DNA fragment can be amplified normally. The methylation degree of the DNA fragment can be determined by detecting the amplified product.

7. The method according to claim 5, characterized in that Before amplifying the DNA fragments, the DNA molecular lock and the DNA fragment sample are first added to a pH 6-8 buffer solution and mixed evenly, reacted at 95°C for 5-10 minutes and then cooled naturally.

8. The method according to claim 7, characterized in that The DNA polymerase used in the PCR amplification system is Taq enzyme.

9. Use of the DNA molecular lock according to any one of claims 1 to 4 in preparing a DNA fragment methylation detection reagent.

10. A methylation detection reagent, characterized in that Comprising the DNA molecular lock according to any one of claims 1 to 4.

11. The methylation detection reagent according to claim 10, characterized in that It also includes a PCR amplification system for the target gene.

12. The methylation detection reagent according to claim 10, characterized in that Methylation detection reagents are disease diagnostic reagents.

13. The methylation detection reagent according to claim 12, characterized in that The disease is a gene methylation-related disease.

14. The methylation detection reagent according to claim 13, characterized in that The diseases related to gene methylation are diseases caused by tumors, genetic abnormalities, metabolic abnormalities, and infections caused by drug-resistant pathogens.

Images