Sequencing method, kit and application thereof

Abstract

The invention provides a nucleic acid sequencing method which comprises the following steps: (a) placing a mixture of a first nucleic acid template-primer compound, nucleotide or an analogue thereof and DNA polymerase under a condition suitable for basic group extension, so that the nucleotide or the analogue thereof is combined to the first nucleic acid template-primer compound to obtain an extension product, wherein the DNA polymerase is a BST DNA polymerase and / or a modified BST DNA polymerase, and the nucleotide or the analogue thereof has a structure as shown in a formula (I); (b) removal of free nucleotides or analogues; (c) detecting a detectable signal generated in the nucleotide or an analog thereof; (d) cutting off a cleavable group in the nucleotide or the analogue thereof or cutting off a cleavable bond in the nucleotide or the analogue thereof to obtain a second nucleic acid template-primer compound; and (e) repeating steps (a) to (d) at least once. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a sequencing method, a kit and applications thereof. Background Art

[0002] Massively parallel sequencing has been proven to be useful for whole genome sequencing and whole genome analysis. Among them, reversible terminal terminators with fluorescent modifications and DNA polymerases that can efficiently incorporate the corresponding modified bases have become the core elements of massively parallel sequencing. Virtual terminators and their corresponding DNA polymerases are the core elements of the sequencing reaction. Their principle of sequencing by synthesis is similar to that of reversible terminal terminators, and they have the potential to achieve massively parallel sequencing.

[0003] Sequencing-by-Synthesis (SBS) is a widely used second-generation sequencing technology. Taking ILLUMINA's SBS technology as an example, under the catalysis of polymerase, a single reversible stop base with a fluorescent dye (modified dNTP or ddNTP, also known as a reversible terminator) is incorporated into the extended nucleic acid molecule chain. By detecting the signal of the fluorescent dye carried by the incorporated reversible stop base, the base type at the corresponding position of the nucleic acid template is inferred, thereby determining the sequence of the nucleic acid template.

[0004] Reversible terminator bases and DNA polymerases are the core elements of sequencing by synthesis. Seeking suitable reversible terminator bases and DNA polymerases, especially reversible terminator bases and DNA polymerases that have a good reaction relationship with each other and can realize sequencing reactions, has always been the focus of sequencers. Summary of the invention

[0005] In a first aspect of the present invention, a sequencing method is provided.

[0006] According to an embodiment of the present invention, the method comprises the following steps: (a) placing a mixture of a first nucleic acid template-primer complex, a nucleotide or its analogue and a DNA polymerase under conditions suitable for base extension, allowing the nucleotide or its analogue to bind to the first nucleic acid template-primer complex to obtain an extension product, wherein the DNA polymerase is a BST DNA polymerase and / or a modified BST DNA polymerase; and the nucleotide or its analogue has a structure shown in formula (I);

[0007]

[0008] Wherein, L1, L2, and L3 are independently a covalent bond or a covalent linking group;

[0009] B is a base or a base derivative;

[0010] R1 is -OH, a phosphate group, or a nucleotide or its analog;

[0011] R2 is H or a cleavable group;

[0012] R3 is a detectable group or a targeting group;

[0013] R5 is an inhibitory group;

[0014] R4 is H or -OR6, wherein R6 is H or a cleavable group;

[0015] C is a cleavable group or a cleavable bond.

[0016] According to the above method of the present invention, the above nucleotides or their analogs and BST DNA polymerase and / or modified BST DNA polymerase can be used to sequence the first nucleic acid template-primer complex.

[0017] In the second aspect of the present invention, a kit is provided. According to an embodiment of the present invention, the kit comprises a nucleotide analogue and a DNA polymerase as shown in formula (I); wherein the DNA polymerase is a BST DNA polymerase fragment and / or a modified BST DNA polymerase fragment; the nucleotide or its analogue has a structure as shown in formula (I);

[0018]

[0019] Wherein, L1, L2, and L3 are independently a covalent bond or a covalent linking group;

[0020] B is a base or a base derivative;

[0021] R1 is -OH, a phosphate group, or a nucleotide or its analog;

[0022] R2 is H or a cleavable group;

[0023] R3 is a detectable group or a targeting group;

[0024] R5 is an inhibitory group;

[0025] R4 is H or -OR6, wherein R6 is H or a cleavable group;

[0026] C is a cleavable group or a cleavable bond.

[0027] According to the above method of the present invention, the first nucleic acid template-primer complex can be sequenced using the nucleotides or their analogs and BST DNA polymerase and / or modified BST DNA polymerase in the above kit.

[0028] In the third aspect of the present invention, a use of the kit described in the second aspect in nucleic acid sequencing is proposed.

[0029] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0031] Figure 1 : is the nucleic acid sequencing result obtained according to the method of Example 1, wherein the horizontal axis in the figure represents the length of single-stranded nucleotides in bp, and the vertical axis represents the fluorescence signal intensity.

[0032] Figure 2 This is a sequence alignment of E. coli DNA polymerase 1 and GEOSE DNA polymerase 1. DETAILED DESCRIPTION

[0033] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0034] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plurality" is two or more.

[0035] As used herein, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0036] In this article, the terms "optionally substituted", "optionally substituted", "optionally substituted by..." and "substituted or unsubstituted" can be used interchangeably. In general, the term "optionally", whether or not it is placed before the term "substituted", means that one or more hydrogen atoms in the given structure are replaced by a specific substituent. Unless otherwise indicated, an optional substituent group can be substituted at each substitutable position of the group. When more than one position in the given structural formula can be substituted by one or more substituents selected from a specific group, the substituents can be substituted at each position in the same or different manner. The substituents described can be, but are not limited to, F, Cl, Br, CN, OH, NH2, NO2, etc.

[0037] As used herein, the term "one or more" (e.g. in the definition of substituents of compounds of the general formula of the invention) means "one, two, three, four or five, especially one, two, three or four, more especially one, two or three, even more especially one or two".

[0038] In addition, it should be noted that, unless explicitly stated otherwise, the description methods used in the present invention, "each... is independently" and "... are each independently" and "... are independently" can be interchanged and should be understood in a broad sense, which can mean that in different groups, the specific options expressed by the same symbols do not affect each other, or that in the same group, the specific options expressed by the same symbols do not affect each other.

[0039] As used herein, the term "halogen" refers to a fluorine, chlorine, bromine or iodine atom.

[0040] In this document, the minimum and maximum carbon atom content in a hydrocarbon group is indicated by a prefix, for example, the prefix C a～b It means containing "a" to "b" carbon atoms. 1～n ” refers to a straight or branched saturated / unsaturated carbon chain containing 1, 2, 3, 4, 5, ... or n carbon atoms; further understand that “C 1～n " shall be interpreted as including any sub-ranges included therein, such as C 1～6 Including C 1～5 , C 1～4 , C 1～3 , C 1～2 , C 2～5 , C 2～4 , C 2～3 , C 3～5 , C 3～4 , C 4～5 .

[0041] In this context, the term "alkyl" refers to a linear or branched saturated monovalent hydrocarbon group having carbon atoms, such as "C1～6 "Alkyl" refers to a straight-chain or branched saturated monovalent hydrocarbon group having 1, 2, 3, 4, 5 or 6 carbon atoms, such as C 1～5 Alkyl, C 1～4 Alkyl, C 1～3 Alkyl, C 2～5 Alkyl, C 2～4 Alkyl, C 2～3 Alkyl. These include, but are not limited to, methyl, ethyl, n-propyl (n-Pr, -CH2CH2CH3), isopropyl (i-Pr, -CH(CH3)2), n-butyl (n-Bu, -CH2CH2CH2CH3), isobutyl (i-Bu, -CH2CH(CH3)2), sec-butyl (s-Bu, -CH(CH3)CH2CH3), tert-butyl (t-Bu, -C(CH3)3), n-pentyl (-CH2CH2CH2C H2CH3), 2-pentyl (-CH(CH3)CH2CH2CH3), 3-pentyl (-CH(CH2CH3)2), 2-methyl-2-butyl (-C(CH3)2CH2CH3), 3-methyl-2-butyl (-CH(CH3)CH(CH3)2), 3-methyl-1-butyl (-CH2CH2CH(CH3)2), 2-methyl-1-butyl (-CH2CH(CH3)CH2CH3), n-hexyl ( -CH2CH2CH2CH2CH2CH3), 2-hexyl (-CH(CH3)CH2CH2CH2CH3), 3-hexyl (-CH(CH2CH3)(CH2CH2CH3)), 2-methyl-2-pentyl (-C(CH3)2CH2CH2CH3), 3-methyl-2-pentyl (-CH(CH3)CH(CH3)CH2CH3), 4-methyl-2-pentyl (-CH(CH3)CH2CH(CH3)2), 3-methyl-3-pentyl (-C(CH3)(CH2CH3)2), 2-methyl-3-pentyl (-CH(CH2CH3)CH(CH3)2), 2,3-dimethyl-2-butyl (-C(CH3)2CH(CH3)2), 3,3-dimethyl-2-butyl (-CH(CH3)C(CH3)3), wherein the alkyl groups may independently be unsubstituted or substituted with one or more substituents described herein.

[0042] As used herein, the term "heteroalkyl" refers to an alkyl group containing at least one carbon atom and one heteroatom (e.g., O, N, P, Si, and S), preferably N and S. The heteroalkyl group is not a cyclic group. It includes, but is not limited to, -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -S(O)-CH3, -CH2-CH2-S(O)-CH3, -O-CH3, -O-CH2-CH3 and -CN. For structures containing two heteroatoms, examples include, -CH2-NH-OCH3, -CH3-O-Si(CH3)3.

[0043] As used herein, the term "alkenyl" refers to a linear or branched monovalent hydrocarbon group having carbon atoms, wherein at least one position CC is an unsaturated sp2 double bond, wherein the alkenyl group may be independently unsubstituted or substituted with one or more substituents described herein, including groups with "cis", "trans" or "Z" or "E" orientations, wherein specific examples include but are not limited to ethyl (-CH=CH2), allyl (-CH2CH=CH2), and the like. For example, C 2～6 Alkenyl, C 2～5 Alkenyl, C 2～4 Alkenyl, C 2～3 Alkenyl, C 3～6 Alkenyl, C 3～5 Alkenyl, C 3～4 Alkenyl.

[0044] As used herein, the term "heteroalkenyl" refers to an alkenyl group containing at least one carbon atom and one heteroatom (e.g., O, N, P, Si and S), preferably N and S. It includes, but is not limited to, -CH ＝ CH-O-CH3, -CH=CH-NH-CH3, -CH=CH-N(CH3)-CH3, -CH2-S-CH=CH2, -S(O)-CH3, -CH=CH-S(O)-CH3. For structures containing 2 heteroatoms, examples include, -CH2-NH-OCH3, -CH3-O-Si(CH3)3; triple or double bond groups may also be included.

[0045] In this article, the term “C 1～6 "Alkoxy" refers to a C 1～6 Alkyl, wherein the term "alkyl" is as defined above. For example: methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, tert-butoxy, sec-butoxy, pentyloxy, isopentyloxy and n-hexyloxy, or isomers of the above groups. In particular, the "C 1～6 The "alkoxy" group may contain 1, 2, 3, 4 or 5 carbon atoms ("C1～5 Alkoxy”), preferably, may contain 1, 2, 3 or 4 carbon atoms (“C 1～4 "alkoxy").

[0046] As used herein, the term "cycloalkyl" refers to a saturated monovalent mono- or bicyclic hydrocarbon ring containing carbon atoms. 3～8 "Cycloalkyl" or "3 to 8 membered cycloalkyl" refers to a saturated monovalent mono- or bicyclic hydrocarbon ring containing 3, 4, 5, 6, 7 or 8 carbon atoms. Exemplarily, the C 3～6 Cycloalkyl is a monocyclic hydrocarbon ring, for example, cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

[0047] As used herein, the term "isocycloalkyl" refers to a cycloalkyl group containing one or more heteroatoms, or a group in which one or more carbon atoms in the cycloalkyl group are substituted by heteroatoms such as S, O, or N.

[0048] In this document, the terms "heterocycloalkyl" and "heterocycloalkane" both refer to a saturated ring or a non-aromatic unsaturated ring containing at least one heteroatom; wherein the heteroatom refers to a nitrogen atom, an oxygen atom, a sulfur atom, etc. It generally refers to a monovalent saturated or partially unsaturated monocyclic or bicyclic ring system of multiple ring atoms, which contains 1, 2 or 3 ring heteroatoms selected from N, O and S, and the remaining ring atoms are carbon.

[0049] The 3-6 membered "heterocycloalkyl" mentioned in the present invention refers to a 3-, 4-, 5- or 6-membered saturated heterocyclic ring.

[0050] In this article, the term "heterocycloalkenyl" refers to an unsaturated ring or a non-aromatic unsaturated ring containing at least one heteroatom; wherein the heteroatom refers to a nitrogen atom, an oxygen atom, a sulfur atom, etc. It usually refers to a monovalent saturated or partially unsaturated monocyclic or bicyclic ring system of multiple ring atoms, which contains 1, 2 or 3 ring heteroatoms selected from N, O and S, and the remaining ring atoms are carbon.

[0051] The 3-6 membered "heterocycloalkenyl" mentioned in the present invention refers to a 3-, 4-, 5- or 6-membered unsaturated heterocycle, wherein the unsaturated refers to a group or molecule containing a carbon-carbon double bond, a carbon-carbon triple bond, a carbon-oxygen double bond, a carbon-sulfur double bond, a carbon-nitrogen triple bond, etc.

[0052] In this document, the term "aromatic group" refers to an unsaturated aromatic group, and the term "heteroaryl group" refers to an aromatic heterocyclic ring containing a heteroatom (such as O, N, P, Si and S). Examples of aromatic groups include but are not limited to phenyl, naphthyl, imidazolyl, pyrimidinyl, etc.

[0053] In this article, the term "XX group" refers to a group formed by removing a hydrogen atom from an "XX group". In this article, the term "alkylene" refers to a group formed by removing a hydrogen atom from an "alkyl group", wherein "C1～6 "Alkylene" includes methylene, ethylene, propylene, isopropylene (such as ), butylene (such as ), pentylene (such as ), hexamethylene (such as ) etc. In this article, the term "alkenylene" refers to a group formed by removing a hydrogen atom from an alkenyl group. In this article, the term "cycloalkylene" refers to a group formed by removing a hydrogen atom from a cycloalkyl group. In this article, the term "alkyleneoxy" refers to a group formed by removing a hydrogen atom from an alkoxy group.

[0054] As used herein, the terms "-OR", "-C(O)OR" and the like refer to an R group being connected to an oxygen atom or a nitrogen atom by a single bond.

[0055] It should be noted that the term "C 1～6 ”, for example, in “C 1～6 Alkyl" or "C 1～6 In the context of the definition of "alkoxy", it refers to an alkyl group having a limited number of carbon atoms from 1 to 6, i.e., 1, 2, 3, 4, 5 or 6 carbon atoms. It is further understood that the term "C 1～6 " shall be interpreted as including any sub-ranges included therein, such as C 1～6 , C 2～5 , C 3～4 , C 1～2 , C 1～3 , C 1～4 , C 1～5 ; especially C 1～2 , C 1～3 , C 1～4 , C 1～5 , C 1～6 ; especially C 1～4 .

[0056] Similarly, as used herein, the term “C 2～6 ”, for example, in “C 2～6 "Alkenyl" and "C 2～6 In the context of the definition of "alkynyl", it is understood to refer to alkenyl or alkynyl groups having a limited number of carbon atoms of 2 to 6, i.e. 2, 3, 4, 5 or 6 carbon atoms. It is further understood that the term "C 2～6 " shall be interpreted as including any sub-ranges therein, e.g., C 2～6 , C 3～5 , C 3～4 , C 2～3 , C 2～4 , C 2～5 ; especially C 2～3 .

[0057] The group description of the present invention It is used to describe the position of group substitution.

[0058] The term "polymerase" refers to any natural or non-natural enzyme or catalyst that can cause DNA polymerization to occur. In some examples, the polymerase is 9°N polymerase or its variant, E.Coli DNA polymerase I, Bacteriophage T4 DNA polymerase, Sequenas enzyme, Taq DNA polymerase, Bacillus stearothermophilus DNA polymerase, Bst 2.0 DNA polymerase, phi29 DNA polymerase, T7 DNA polymerase.

[0059] In this article, the term "nucleotide" refers to a nucleoside-5'-polyphosphate compound, which is a compound composed of three substances: a base such as a purine base or a pyrimidine base, a ribose or a deoxyribose, and a phosphate. The base of the nucleotide includes A, T, G, C, U or its analogs, and the number of phosphates contained is 2, 3, 4, 5, 6, 7, 8 or more phosphates; "nucleotide analogs" refer to compounds that are similar to nucleotides in chemical structure. For sequencing methods, in some examples, the application method of nucleotide analogs is as follows: the nucleotide analogs contain an inhibitory group that can virtually block the 3' end of the base and are fluorescently labeled, which are used in the second or third generation (single molecule) sequencing by synthesis (SBS), and the four fluorescent bases A, T, G, and C are accompanied by a fluorescent group ATTO647N, which are added in four times.

[0060] In this article, unless otherwise specified, Base refers to a base, such as A, C, G, T, and U.

[0061] The present invention provides a nucleic acid sequencing method, a kit and applications thereof, which will be described in detail below.

[0062] Acid Sequencing Method

[0063] In the first aspect of the present invention, a method for nucleic acid sequencing is proposed. According to an embodiment of the present invention, the method comprises the following steps: (a) placing a mixture of a first nucleic acid template-primer complex, nucleotides or their analogs, and a DNA polymerase under conditions suitable for base extension, so that the nucleotides or their analogs bind to the first nucleic acid template-primer complex to obtain an extension product, wherein the DNA polymerase is a BST DNA polymerase and / or a modified BST DNA polymerase. According to the above method of the present invention, the above-mentioned nucleotides or their analogs and BST DNA polymerase and / or a modified BST DNA polymerase can be used to sequence the first nucleic acid template-primer complex.

[0064] In some optional embodiments of the present invention, the first nucleic acid template-primer complex is connected to a solid support.

[0065] In some optional embodiments of the present invention, the solid phase carrier is a chip or a microsphere.

[0066] In some optional embodiments of the present invention, the first nucleic acid template-primer complex is immobilized on a chip or a microsphere.

[0067] In some optional embodiments of the present invention, step (a) includes: contacting the first nucleic acid template-primer complex with a mixed solution containing nucleotides or their analogs and DNA polymerase, and allowing the nucleotides or their analogs to bind to the first nucleic acid template-primer complex under conditions suitable for base extension to obtain an extension product.

[0068] In some optional embodiments of the present invention, the first nucleic acid template-primer complex is connected to a solid support.

[0069] In some optional embodiments of the present invention, the solid phase carrier is a chip or a microsphere.

[0070] In some optional embodiments of the present invention, the working concentration of the DNA polymerase is 0.005-0.02 U / μL.

[0071] In some optional embodiments of the present invention, the mixed solution includes a buffer solution, and the buffer solution contains ammonium ions, magnesium ions, potassium ions and acetate ions.

[0072] In some optional embodiments of the present invention, the pH of the buffer solution is 7 to 8.5.

[0073] In some optional embodiments of the present invention, the buffer further comprises manganese ions.

[0074] In some optional embodiments of the present invention, the method further comprises:

[0075] (b) removing free nucleotides or analogs;

[0076] (c) detecting a detectable signal generated in the nucleotide or its analog;

[0077] (d) removing a cleavable group in the nucleotide or its analog or severing a cleavable bond in the nucleotide or its analog to obtain a second nucleic acid template-primer complex;

[0078] (e) Repeat steps (a) to (d) at least once.

[0079] In some optional embodiments of the present invention, step (d) comprises: using a cleavage agent to break the cleavable group or cleavable bond in the nucleotide or its analog.

[0080] Reagent test kit

[0081] In a second aspect of the present invention, a kit is proposed. According to an embodiment of the present invention, the kit includes a nucleotide analogue and a DNA polymerase as shown in formula (I); wherein the DNA polymerase is a BST DNA polymerase fragment and / or a modified BST DNA polymerase fragment. According to the above kit of the present invention, the nucleotides or their analogues and the BST DNA polymerase and / or the modified BST DNA polymerase in the above kit can be used to sequence the first nucleic acid template-primer complex.

[0082] In some optional embodiments of the present invention, the kit includes HN reagent.

[0083] In some optional embodiments of the present invention, the kit includes a CN reagent.

[0084] It should be noted that the HN reagent is a virtual terminator base dNTP reagent, which includes a class of fluorescently modified virtual terminator base dNTPs (see Example 1 for details) and their corresponding DNA polymerases, as well as a suitable buffer system; the CN reagent is a terminator capped dNTP reagent that does not contain a fluorescent group, which includes a class of efficiently incorporated virtual terminator base capped dNTPs and their corresponding DNA polymerases, as well as a suitable buffer system.

[0085] Exemplarily, the HN reagent comprises A, T, C and G (at concentrations of 0.5 to 2 μM, respectively), a DNA polymerase or mutant, and a buffer system (20 mM Tris-CH 3 COOH, 50 mM CH 3 COOK, 10 mM Mg(CH 3 COO) 2, 0.1% tween 20, pH 7.9) at a concentration of 0.005 to 0.02 U / μL.

[0086] Exemplarily, the CN reagent comprises A, T, C and G (at concentrations of 1 to 5 μM, respectively), a DNA polymerase or mutant, and a buffer system (20 mM Tris-CH 3 COOH, 50 mM CH 3 COOK, 10 mM Mg(CH 3 COO) 2, 0.1% tween 20, pH 7.9) at a concentration of 0.005 to 0.02 U / μL.

[0087] Furthermore, the nucleic acid sequencing method of the first aspect and the kit of the second aspect may further include at least one of the following technical features:

[0088] In some optional embodiments of the present invention, the BST DNA polymerase has an amino acid sequence as shown in SEQ ID NO: 1 or 2.

[0089] According to an embodiment of the present invention, the amino acid sequence of the BST DNA polymerase is shown in SEQ ID NO: 1 (derived from Escherichia coli DNA polymerase).

[0090] (SEQ ID NO:1).

[0091] According to an embodiment of the present invention, the amino acid sequence of the BST DNA polymerase is shown in SEQ ID NO:2 (derived from DNA polymerase from Geobacillus stearothermophilus).

[0092] MKNKLVLIDGNSVAYRAFFALPLLHNDKGIHTNAVYGFTMMLNKILAEEQPTHILVAFDAGKTTFRHETFQDYKGGRQQTPPELSEQFPLLRELLKAYRIPAYELDHYEADDIIGTMAARAEREGFAVKVISGDRDLTQLASPQVTVEITKKGITDIESYTPETVVEKYGLTPEQIVDLKGLMGDKSDNIPGVPGIGEKTAVKLLKQFGTVENVLASIDEIKGEKLKENLRQYRDLALLSKQLAAICRDAPVELTLDDIVYKGEDREKVVALFQELGFQSFLDKMAVQTDEGEKPLAGMDFAIADSVTDEMLADKAALVVEVVGDNYHHAPIVGIALANERGRFFLRPETALADPKFLAWLGDETKKKTMFDSKRAAVALKWKGIELRGVVFDLLLAAYLLDPAQAAGDVAAVAKMHQYEAVRSDEAVYGKGAKRTVPDEPTLAEHLVRKAAAIWALEEPLMDELRRNEQDRLLTELEQPLAGILANMEFTGVKVDTKRLEQMGAELTEQLQAVERRIYELAGQEFNINSPKQLGTVLFDKLQLPVLKKTKTGYSTSADVLEKLAPHHEIVEHILHYRQLGKLQSTYIEGLLKVVHPVTGKVHTMFNQALTQTGRLSSVEPNLQNIPIRLEEGRKIRQAFVPSEPDWLIFAADYSQIELRVLAHIAEDDNLIEAFRRGLDIHTKTAMDIFHVSEEDVTANMRRQAKAVNFGIVYGISDYGLAQNLNITRKEAAEFIERYFASFPGVKQYMDNIVQEAKQKGYVTTLLHRRRYLPDITSRNFNVRSFAERTAMNTPIQGSAADIIKKAMIDLSVRLREERLQARLLLQVHDELILEAPKEEIERLCRLVPEVMEQAVTLRVPLKVDYHYGPTWYDAK(SEQ ID NO:2).

[0093] In some optional embodiments of the present invention, compared with the amino acid sequence of the BST DNA polymerase, the amino acid sequence of the modified BST DNA polymerase has at least one amino acid mutation in the following positions or positions functionally equivalent thereto: I657, F710 and T794.

[0094] It should be noted that the sites of "I657, F710 and T794" in this article are located based on the amino acid sequence of BST DNA polymerase shown in SEQ ID NO:2.

[0095] In this article, the amino acid numbering of the BST DNA polymerase is numbered according to the EU numbering system, for example, position 710 refers to position 762 according to the EU numbering system; the "F710" means that the phenylalanine at position 710 according to the EU numbering system is replaced; "790" means that the alanine at position 790 according to the EU numbering system is replaced; "T794" means that the threonine at position 794 according to the EU numbering system is replaced.

[0096] The term "functional equivalent" means the same function. In this article, "functional equivalent position" refers to an amino acid at another position that has the same function as a specific amino acid in BST DNA polymerase. For example, in this article, "F710 functional equivalent position mutation" refers to a position mutation of an amino acid that has the same function as the phenylalanine at position 710 in BST DNA polymerase, and this mutation is also within the scope of protection of this application.

[0097] In this article, the above-mentioned "functionally equivalent positions" can be obtained by homology comparison. Wherein, when homology is used to describe an amino acid sequence or a nucleic acid sequence relative to a reference sequence, the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences is determined by conventional methods, for example, see Ausubel et al., ed. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research There are many algorithms for aligning sequences and determining sequence identity, including the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48:443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:2444; the Smith-Waterman algorithm (Meth. Mol. Biol. 48:443); the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:24 ... .70:173-187 (1997); and BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J. Mol. Biol. 215:403-410). Computer programs that utilize these algorithms are also available, and include, but are not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth. Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altschul et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.

[0098] For example, Figure 2As shown, for the DNA polymerase derived from Escherichia coli (such as the amino acid sequence shown in SEQ ID NO: 2), it can be subjected to homology analysis with the amino acid sequence derived from Geobacillus stearothermophilus (the amino acid sequence shown in SEQ ID NO: 1), and positions functionally equivalent to I657, F710 and T794 in the amino acid sequence shown in SEQ ID NO: 2 are found, which correspond to I709, F762 and A846 in the amino acid sequence shown in SEQ ID NO: 1, respectively. Therefore, mutations in I709, F762 and A846 of the amino acid sequence derived from Geobacillus stearothermophilus as shown in SEQ ID NO: 1 are also within the protection scope of the present invention.

[0099] In some optional embodiments of the present invention, compared with the amino acid sequence of the BST DNA polymerase, the amino acid sequence of the modified BST DNA polymerase includes at least one of the following mutations: I657K or a mutation functionally equivalent thereto, F710Y or a mutation functionally equivalent thereto, T794K or a mutation functionally equivalent thereto.

[0100] In some preferred embodiments of the present invention, compared with the BST DNA polymerase having amino acids as shown in SEQ ID NO: 2, the amino acid sequence of the modified BST DNA polymerase includes at least one of the following mutations: I657K or a mutation functionally equivalent thereto, F710Y or a mutation functionally equivalent thereto, T794K or a mutation functionally equivalent thereto.

[0101] In some optional embodiments of the present invention, the modified BST DNA polymerase has an amino acid sequence as shown in any one of SEQ ID NOs: 3-5.

[0102] (SEQ ID NO:3, I657K).

[0103] (SEQ ID NO:4, F710Y).

[0104] (SEQ ID NO:5, T794K).

[0105] In the embodiment of the present invention, the described structure has the structure shown in (I).

[0106]

[0107] Wherein, L1, L2, and L3 are independently a covalent bond or a covalent linking group;

[0108] B is a base or a base derivative;

[0109] R1 is -OH, a phosphate group, or a nucleotide or its analog;

[0110] R2 is H or a cleavable group;

[0111] R3 is a detectable group or a targeting group;

[0112] R5 is an inhibitory group;

[0113] R4 is H or -OR6, wherein R6 is H or a cleavable group;

[0114] C is a cleavable group or a cleavable bond.

[0115] In some optional embodiments of the present invention, R2 is H, and R4 is H or -OH.

[0116] In this article, the term "detectable group" refers to a group or molecule (such as a fluorescent dye, a detectable dye) that can specifically release a signal or specifically identify. For example, it can be a chromophoric group or a chromophoric molecule (such as a fluorescent group), for example, it can be a chemical group that obtains a quantitative light signal, an electrical signal or a radioactive signal corresponding to the detectable group through a detection instrument or device; it can also be a chromophoric group or a chromophoric molecule, that is, an unsaturated group and its related chemical bonds that can absorb light radiation and have transitions, which can absorb light of a certain wavelength (color) but not absorb light of another wavelength (color), so that the substance shows color. Exemplarily, the detectable group can be selected from any of the following: a) four dyes, ROX, Alexa532, Cy5, IF700, respectively mark A, T, G, C; b) a dye Cy5 marks A, T, C, G, and then distinguishes A, T, G, C according to different feeding times.

[0117] As used herein, chromophores include, but are not limited to, non-proteinaceous organic fluorophores such as xanthene derivatives (fluorescein, rhodamine, Oregon Green, Eosin, and Texas Red); cyanine derivatives (cyanine, indocarbocyanine, oxacyanine, thiocyanine, and merocyanine); squaric acid derivatives and ring-substituted squaric acids, including Seta, SeTau, and Square dyes; naphthalene derivatives (dansyl and sodium fluorosilicate derivatives); coumarin derivatives; oxadiazole derivatives; Biological (pyridyl oxazoles, nitrobenzoxazoles and benzoxadiazoles); anthracene derivatives (anthraquinones, including DRAQ5, DRAQ7 and CyTRAK Orange); pyrene derivatives (Cascade Blue, etc.); oxazine derivatives (Nile Red, Nile Blue, Cresyl Violet, Oxazine 170, etc.); acridine derivatives (xanthin, acridine orange, acridine yellow, etc.); arylmethylamine derivatives (auramine, crystal violet, malachite green) and tetrapyrrole derivatives (porphine, phthalocyanine, bilirubin).

[0118] As used herein, chromophores include, but are not limited to, CF dyes (Biotium), DRAQ and CyTRAK probes (BioS-tatus), BODIPY (Invitrogen), Alexa Fluor (Invitrogen), DyLight Fluor (ThermoScientific, Pierce), Atto and Tracy (SigmaAldrich), FluoProbes (Interchim), Abberior dyes (Abberior), DY and MegaStokes dyes (Dyomics), SulfoCy dyes (Cyandye), HiLyte Fluor (AnaSpec), Seta, SeTau and Square dyes (Biosearch Technologies), SureLight dyes (RPEPerCP, Phycobilisomes) (Columbia Biosciences), APC, APCXL, RPE, BPE (Phyco-Biotech).

[0119] In some optional embodiments of the present invention, the detectable group includes but is not limited to: a fluorescent labeling group or a fluorescent dye, an enzyme labeling group, a colloidal chromogenic labeling group, a radioactive labeling group, a click chemistry reaction group, an azide group, and a biotin group.

[0120] In some optional embodiments of the present invention, the detectable group includes but is not limited to a fluorescent labeling group or a fluorescent dye, an enzyme labeling group, a colloidal chromogenic labeling group or a radioactive labeling group.

[0121] In some optional embodiments of the present invention, the “detectable group” includes but is not limited to a Cy2 group, a Cy3 group, a Cy3.5 group, a Cy3B group, a Cy5 group, a Cy5.5 group, a Cy7 group, a Hoechst33258 group, a Hoechst33342 group, a Hoechst34580 group, a PO-PRO-1 group, a PO-PRO-1-DNA group, a POPO-1 group, a DAPI-DNA group, a DAPI group, a SYTO 45-DNA group, an Alexa Fluor@350 group, an Alexa Fluor@450 group, an Alexa Fluor@430 group, an Alexa Fluor@488 group, an Alexa Fluor@532 group, an Alexa Fluor@546 group, an Alexa Fluor@555 group, an Alexa Fluor@568 group, an Alexa Fluor@594 group, an Alexa Fluor@610 group, an Alexa Fluor@633 group, an Alexa Fluor@635 group, an Alexa Fluor@636 group, an Alexa Fluor@640 group, an Alexa Fluor@641 group, an Alexa Fluor@642 group, an Alexa Fluor@6435 group, an Alexa Fluor@644 group, an Alexa Fluor@645 Fluorophores of the Fluor@647 group, Alexa Fluor@660 group, Alexa Fluor@680 group, Alexa Fluor@700 group, Alexa Fluor@750 group, Alexa Fluor@790 group, allophycocyanin (APC), APC-Seta-750, AsRed2, ATTO390, ATTO425, ATTO430LS, ATTO465, ATTO488, ATTO490LS, ATTO495, ATTO514, ATTO520, ATTO532, ATTO550, ATTO565, ATTO590, ATTO594, ATTO645, and ATTO680.

[0122] In some embodiments of the present invention, R3 is a fluorescent dye. In some embodiments of the present invention, R3 is a click chemistry reaction group; In some embodiments of the present invention, R3 is an azido group; In some embodiments of the present invention, R3 is a biotin group.

[0123] In some embodiments of the present invention, R3 is a fluorescent dye.

[0124] In some embodiments of the present invention, R3 is Alexa Fluor@350 group, Alexa Fluor@450 group, Alexa Fluor@430 group, Alexa Fluor@488 group, Alexa Fluor@532 group, Alexa Fluor@546 group, Alexa Fluor@555 group, Alexa Fluor@568 group, Alexa Fluor@594 group, Alexa Fluor@610 group, Alexa Fluor@633 group, Alexa Fluor@635 group, Alexa Fluor@635 group, Alexa Fluor@647 group, Alexa Fluor@660 group, Alexa Fluor@680 group, Alexa Fluor@691 group, Alexa Fluor@700 group, Alexa Fluor@712 group, Alexa Fluor@724 group, Alexa Fluor@735 group, Alexa Fluor@736 group, Alexa Fluor@737 group, Alexa Fluor@738 group, Alexa Fluor@740 group, Alexa Fluor@741 group, Alexa Fluor@742 group, Alexa Fluor@743 group, Alexa Fluor@744 group, Alexa Fluor@745 group, Alexa Fluor@746 group, Alexa Fluor@747 group, Alexa Fluor@748 group, Alexa Fluor@750 group, Alexa Fluor@751 group, Alexa Fluor@752 group, Alexa Fluor@753 group, Alexa Fluor@754 group, Alexa Fluor@755 group, Alexa Fluor@756 group, Alexa Fluor@757 group, Alexa Fluor@758 group, Alexa Fluor@759 group, Alexa Fluor@760 group, Alexa Fluor@761 group, Alexa Fluor@762 group, Alexa Fluor@763 group, 700 groups, Alexa 750 groups, Alexa Fluor@790 groups.

[0125] In some embodiments of the present invention, R3 is ATTO390 group, ATTO425 group, ATTO430LS group, ATTO465 group, ATTO 488 group, ATTO490LS group, ATTO495 group, ATTO514 group, ATTO520 group, ATTO532 group, ATTO550 group, ATTO565 group, ATTO590 group, ATTO594 group, ATTO610 group, ATTO620 group, ATTO633 group, ATTO635 group, ATTO647 group, ATTO647 group, ATTO647N group, ATTO655 group, ATTO665 group, ATTO700 group, ATTO725 group, ATTO740 group, ATTO680 group, ATTO Rho12 group, ATTO3B group, ATTO Rho6G group, ATTO Rho11 group, ATTO Rho12 group, ATTO Rho13 group, ATTO Rho14 group, ATTO Rho101 group, ATTO Thio12 group.

[0126] In some embodiments of the present invention, R3 is a BO-PRO-1 group, a BO-PRO-3 group, a BOBO-1 group, a BOBO-3 group, a BODIPY630 650-X group, a BODIPY650 / 665-X group, a BODIPY FL group, a BODIPYR6G group, a BODIPY TMR-X group, a BODIPY TR-X group, a BODIPY TR-X pH7.0 group, BODIPYTR-X-phallacidin group, BODIPY-DiMe group, BODIPY-Phenyl group, BODIPY-TMSCC group, C3-Indocyanine group, C3-Oxacyanine group, C3-Thiacyanine-Dye(EtOH) group, C3-Thiacyanine-Dye(PrOH) group, C5-Indocyanine group, C5-Oxacyanine group, C5-Thiacyanine group, C7-Indocyanine group, C7-Oxacyanine group, C454T,C-Phycyanin group, Calcein group, Calcein-red-orang group, Calcium-Crimson group, Calcium Green-1 group, Calcium Orange group.

[0127] In some examples of the present invention, R3 is a CF450M group, a CF405S group, a CF488A group, a CF543 group, a CF555 group, a CFP group, a CFSE group, a CF350 group, a CF485 group, a Chlorophyll-A group, a Chlorophyll-B group, a Chromeo488 group, a Chromeo494 group, a Chromeo505 group, a Chromeo546 group, a Chromeo642 group, a Cryptolight CF1 group, a Cryptolight CF2 group, a Cryptolight CF3 group, a CryptolightCF4 group, a Cryptolight CF5 group, a Cryptolight CF6 group, a Crystal Violet group, a Cumarin153 group, a Cy2 group, a Cy3 group, a Cy3.5 group, a Cy3B group, a Cy5ET group, a Cy5 group, a Cy5.5 group, a Cy7 group, or a DAPI group.

[0128] In some embodiments of the present invention, R3 is a DsRed-Express group, a DsRed-Express2 group, a DsRed-Express T1 group, a DY350XL group, a DY-480 group, a DY-480XL Megastokes group, a DY485 group, a DY485XL Megastokes group, a DY490 group, a DY490XL Megastokes group, a DY-500 group, a DY-500XL Megastokes group, a DY-520 group, a DY520 Megastokes group, DY-547 group, DY549P1 group, DY-554 group, DY-555 group, DY-557 group, DY-590 group, DY-615 group, DY-630 group, DY-631 group, DY-633 group, DY-635 group, DY-636 group, DY-647 group, DY-649P1 group, DY-650 group, DY651 group, DY-656 group group, DY-673 group, DY-675 group, DY-676 group, DY-680 group, DY-681 group, DY-700 group, DY-701 group, DY-730 group, DY-731 group, DY-750 group, DY-751 group, DY-776 group, DY-782 group, Dye-28 group, Dye-33 group, Dye-45 group, Dye-304 group, Dye-1041 group.

[0129] In some embodiments of the present invention, R3 is a Dylight488 group, a Dylight594 group, a Dylight633 group, a Dylight649 group, a Dylight680 group, a Hilyte Fluor488 group, a Hilyte Fluor555 group, a Hilyte Fluor647 group, a Hilyte Fluor680 group, a Hilyte Fluor750 group, a HiLyte Plus555 group, a HiLyte Plus647 group, a HiLyte Plus750 group, a Hoechst33258 group, or a Hoechst33342 group.

[0130] In some embodiments of the present invention, R3 is a PromoFluor-350 group, a PromoFluor-405 group, a PromoFluor-415 group, a PromoFluor-488 group, a PromoFluor-488 Premium group, PromoFluor-488LS group, PromoFluor-500LSS group, PromoFluor-505 group, PromoFluor-555 group, PromoFluor-590 group, PromoFluor-510LSS group, PromoFluor-514LSS group, PromoFluor-520LSS group, PromoFluor-532 group, PromoFluor-546 group, PromoFluor-610 group, PromoFluor-633 group, PromoFluor-647 group, PromoFluor-670 group, PromoFluor-680 group, PromoFluor-700 group, PromoFluor-750 group, PromoFluor-770 group, PromoFluor-780 group, PromoFluor-840 group.

[0131] In some embodiments of the present invention, R3 is a QD525 group, a QD565 group, a QD585 group, a QD605 group, a QD655 group, a QD705 group, a QD800 group, a QD903 group, a QDpbS950 group, a QDot525 group, a QDot545 group, a QDot565 group, a QDot585 group, a QDot605 group, a QDot625 group, a QDot655 group, a QDot705 group, a QDot800 group, a QpyMe2 group, a QSY7 group, a QSY9 group, a QSY21 group, a QSY35 group, a Rhodamine700perchlorate group, a Rhodamine group, a Rhodamine6G group, a Rhodamine101 group, a Rhodamine123 group, a RhodamineB group, a RhodamineGreen group, a Rhodamine pH-Probe585-7.0 group, RhodaminepH-Probe585-7.5 group, Rhodamine phalloidin group, Rhodamine Red-X group, RhodamineTag pH-Probe 585-7.0 group.

[0132] In some embodiments of the present invention, R3 is a SYBR Green group, a SYPRO Ruby group, a SYTO9 group, a SYTO11 group, a SYTO13 group, a SYTO16 group, a SYTO17 group, a SYTO45 group, a SYTO59 group, a SYTO60 group, a SYTO61 group, a SYTO62 group, a SYTO82 group, a SYTORNASelect group, a SYTOX Blue group, a SYTOX Green group, a SYTOX Orange group, a SYTOX Red group, a Texas red group, a Texas redDHPE group, or a Texasred-X group.

[0133] In some embodiments of the present invention, R3 is a FAMTM group, a TETTM group, a JOETM group, a VICTM group, a HEXTM group, a NEDTM group, a PET group, a ROXTM group, a TAMRATM group, a TETTM group, a Texas Red group, a Rhodamine 6G (R6G) group, or a Cy5 group.

[0134] In some embodiments of the present invention, R3 is (B in this formula is boron),

[0135] In some optional embodiments of the present invention, R3 is selected from the following detectable groups or compounds that can or are easily combined (coupled or specifically combined) with the targeting group, and the compound after R3 is combined with the targeting group:

[0136] ROX-labeled Dibenzocyclooctyne(DBCO)(ROX-DBCO or DBCO-ROX) The structure of ROX-DBCO after binding to the dATP analogue with an azide targeting group

[0137]

[0138] ATTO Rho6G labeled SHA (ATTO Rho6G-SHA or SHA-ATTO Rho6G) Structure of ATTO Rho6G-SHA bound to dTTP analog

[0139]

[0140] ATTO647N-tetrazine (ATTO647N-tetrazine or tetrazine-ATTO647N) The structure of ATTO647N-tetrazine bound to dGTP analogue:

[0141]

[0142] In some optional embodiments of the present invention, R5 contains at least one charged group.

[0143] In some optional embodiments of the present invention, the charged group is selected from at least one of -COOH, -PO4, -SO4, -SO3, and -SO2.

[0144] In some optional embodiments of the present invention, R5 is or -NH-(R 1a )3;

[0145] Among them, each R 10 With R 11 are independently H or C 1-6 Alkyl, each a and b are independently any integer between 0 and 5;

[0146] Each R 1a are independently H, -C(O)-NH-(R 1b 2. -C 0-6 Alkylene-C(O)OR 1c or -C 2-6 Alkenylene-Z-H2PO3;

[0147] Each R 1b Each independently is -C 0-3 Alkylene-C(O)OR 1c ;

[0148] Each R 1c Each independently is H or C 1-6 alkyl;

[0149] Z is a nucleoside or an analog thereof.

[0150] As used herein, the term "nucleoside" refers to a compound composed of two substances, a purine base or a pyrimidine base (e.g., a purine base (adenine, guanine) and a pyrimidine base (cytosine, uracil, thymine)), and ribose or deoxyribose; and a "nucleoside analog" refers to a compound that is similar to a nucleoside in chemical structure.

[0151] In some optional embodiments of the present invention, each a and b is independently 1 or 2.

[0152] In some optional embodiments of the present invention, each R 1a Each independently represents H, -C(O)-NH-(-C0-1 Alkylene -C(O)OH)2, -C 1-2 Alkylene -C(O)OH or -C 2-6 Alkenylene-Z-H2PO3.

[0153] In some optional embodiments of the present invention, R5 is

[0154] In some optional embodiments of the present invention, L1, L2 and L3 independently include the following structures:

[0155] Independent bonds, optionally replaced by one or more R 1d Alkylene, optionally substituted with one or more R 1d Substituted alkenylene, optionally with one or more R 1d Substituted heteroalkylene, optionally with one or more R 1d substituted heteroalkenylene, optionally substituted with one or more R 1d Substituted cycloalkylene, optionally with one or more R 1d Substituted cycloalkenylene, optionally substituted with one or more R 1d Substituted isocycloalkylene, optionally substituted with one or more R 1d Substituted isocycloalkenyl, optionally substituted with one or more R 1d The substituted arylene group and optionally one or more R 1d At least one of substituted heteroarylene groups, and L1, L2 and L3 are not simultaneously selected from independent bonds;

[0156] Among them, each R 1d Each independently is -OH, C 1-6 Alkyl, halogen, nitro or C 1-6 Halogenated alkyl.

[0157] In some optional embodiments of the present invention, L1, L2 and L3 independently include the following structures:

[0158] An independent bond, optionally replaced by one or more R 1d Substituted C 1-8 Alkylene, optionally with one or more R 1d Substituted C 2-8 Alkenylene, optionally substituted with one or more R 1d Substituted C 2-8 Heteroalkylene, optionally substituted by one or more R 1d Substituted C 2-8 heteroalkenylene, optionally substituted with one or more R 1d Substituted C 3-8 Cycloalkylene, optionally substituted by one or more R 1d Substituted C3-8 Isocycloalkylene, optionally substituted by one or more R 1d Substituted C 3-8 Isocycloalkenyl, optionally substituted with one or more R 1d Substituted C 6-10 Arylene or optionally one or more R 1d Substituted C 6-10 wherein L1, L2 and L3 are not simultaneously selected from independent bonds.

[0159] In some optional embodiments of the present invention, L1, L2 and L3 independently include the following structures:

[0160] An independent bond, optionally replaced by one or more R 1d Substituted C 2-6 Alkylene, optionally with one or more R 1d Substituted C 2-6 Alkenylene, optionally substituted with one or more R 1d Substituted C 2-6 Heteroalkylene, optionally substituted by one or more R 1d substituted heteroalkenyl consisting of 2 to 6 backbone atoms, optionally substituted by one or more R 1d Substituted C 3-6 Cycloalkylene, optionally substituted by one or more R 1d Substituted C 3-6 Cycloalkenylene, optionally substituted with one or more R 1d substituted heterocycloalkylene composed of 3 to 6 backbone atoms, optionally substituted by one or more R 1d substituted heterocyclohetero ... 1d Substituted C 6-10 Arylene.

[0161] In some optional embodiments of the present invention, each R 1d Each independently is C 1-6 Alkyl, halogen, nitro or C 1-6 Halogenated alkyl.

[0162] In some optional embodiments of the present invention, L1 is selected from at least one of the following:

[0163] Independent keys,

[0164] wherein each R7 is independently NH or O,

[0165] Each p1 is independently any integer between 0 and 10,

[0166] Each p2 is independently any integer between 0 and 5,

[0167] Each R8 and R9 is independently selected from H, -CX3, -N3, -CHX2, -CH2X, -CN, -Ph, -C 1-6 Alkyl and C 3～6 At least one of cycloalkyl groups, wherein X is Cl, Br or I;

[0168] Each p3 is independently any integer between 0 and 4.

[0169] In some optional embodiments of the present invention, each p1 is independently 1 or 4.

[0170] In some optional embodiments of the present invention, each p2 is independently 1 or 4.

[0171] In some optional embodiments of the present invention, each p3 is independently 1 or 2.

[0172] In some optional embodiments of the present invention, L1 is selected from at least one of the following:

[0173] Independent keys,

[0174] In some optional embodiments of the present invention, L2 is selected from at least one of the following:

[0175]

[0176] Among them, each R x , R y , R A , R B are independently H, -C 1～6 Alkyl, -C 3-10 Cycloalkyl or -C 5-10 In the aryl group, each of x, y and z is independently any integer between 0 and 6.

[0177] In some optional embodiments of the present invention, each R x , R y Independently H, -C 3-5 Cycloalkyl, -C 5-6 Cycloalkyl or phenyl.

[0178] In some optional embodiments of the present invention, L2 is one selected from the following structures:

[0179]

[0180] wherein each Ra and Rb are independently H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heteroalkenyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, or substituted or unsubstituted aryl, wherein the substituent is -OH, -CN, halogen, nitro, -C1-6 Alkyl or C 1-6 Halogenated alkyl.

[0181] In some optional embodiments of the present invention, each Ra and Rb is independently H, optionally replaced by one or more R 1e Substituted C 1-6 Alkyl, optionally with one or more R 1e Substituted C 1-6 Heteroalkyl, optionally substituted by one or more R 1e Substituted C 2-6 heteroalkenyl, optionally substituted with one or more R 1e Substituted C 3-6 Cycloalkyl, optionally substituted by one or more R 1e Substituted C 3-6 isocycloalkyl or optionally substituted by one or more R 1e substituted aromatic group consisting of 3 to 6 skeleton atoms, wherein each R 1e are independently -OH, -CN, halogen, nitro, -C 1-6 Alkyl or C 1-6 Halogenated alkyl.

[0182] In some optional embodiments of the present invention, L3 is selected from one of the following structures:

[0183]

[0184] Among them, n1, n2, n3, n4, n5, and n6 are each independently any integer between 0 and 7.

[0185] In some optional embodiments of the present invention, L3 is selected from one of the following structures:

[0186]

[0187] In some optional embodiments of the present invention, C contains at least one of the following groups: optionally with one or more R 1f Substituted ethynyl, optionally with one or more R 1f substituted disulfide bonds, optionally replaced by one or more R 1f Substituted amidoalkyl, optionally with one or more R 1f Alkoxy substituted, optionally with one or more R 1f Substituted straight-chain or branched alkyl, each R 1f are independently -OH, -CN, halogen, nitro, -C 1-6 Alkyl or C 1-6 Halogenated alkyl.

[0188] In some optional embodiments of the present invention, C contains at least one of the following groups:

[0189] Optionally one or more R 1f Substituted ethynyl, optionally with one or more R 1f substituted disulfide bonds, optionally replaced by one or more R 1f Substituted amidoalkyl, optionally with one or more R 1f substituted aryl, optionally substituted with one or more R 1f Alkoxy substituted, optionally with one or more R 1f substituted azido, optionally substituted with one or more R 1f Substituted straight-chain or branched alkyl, each R 1f are independently -OH, -CN, halogen, nitro, -C 1-6 Alkyl or C 1-6 Halogenated alkyl.

[0190] In some optional embodiments of the present invention, C contains at least one of the following groups:

[0191] An acetylene group optionally substituted by a hydroxy group, a disulfide bond optionally substituted by a hydroxy group, an amide group optionally substituted by a hydroxy group, an alkyleneoxy group optionally substituted by a hydroxy group, an aryl group optionally substituted by a hydroxy group, an azide group optionally substituted by a hydroxy group, or a straight or branched alkylene group optionally substituted by a hydroxy group.

[0192] In some optional embodiments of the present invention, C is selected from at least one of the following groups:

[0193]

[0194] Among them, each R 12 are independently -NH-CO-, -O-, -O-CH(N3)-;

[0195] Each R 12 are independently -SS-, -O-, -CH=CH-C 1～3 Alkylene-,

[0196] Each p1 is independently any integer between 0 and 5.

[0197] In some optional embodiments of the present invention, each p1 is independently 1, 2 or 3.

[0198] In some optional embodiments of the present invention, C is selected from at least one of the following:

[0199]

[0200] According to an embodiment of the present invention, -L1-C-L2(R5)-L3- is selected from any of the following structures:

[0201]

[0202]

[0203] Wherein, each n7 is independently selected from any integer from 1 to 7;

[0204] According to an embodiment of the present invention, each Ra and Rb is independently H, C 1-3 Alkyl, phenyl.

[0205] According to an embodiment of the present invention, the nucleotide or its analogue has at least one of the following structural formulas:

[0206]

[0207]

[0208]

[0209] Among them, the preparation method of the above-mentioned nucleotides or their analogs can be specifically referred to the Chinese patent document with application number 201880077576.4.

[0210] According to an embodiment of the present invention, each Ra and Rb is independently H, C 1-3 Alkyl, phenyl.

[0211] According to an embodiment of the present invention, the nucleotide or its analogue includes at least one of the specific structures listed in the Chinese patent document with application number 201880077576.4, specifically including at least one of structural formulas (3) to (10), (14) to (34) and (40) to (92) (see the claims for the specific structural formula), and may also include at least one of the nucleotide or its analogue structures listed in patent documents WO2009124254A1, WO2007062160A2, WO2008144544A1, US20090061437A1, WO2008144315A1, and WO2008137661A1.

[0212] application

[0213] In the third aspect of the present invention, a use of the kit described in the second aspect in nucleic acid sequencing is provided, whereby nucleic acid sequencing can be performed with high detection accuracy.

[0214] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0215] It should be noted that, for some nucleotides or their analogs (such as nucleotides with pentose as 3'-OH), after the fluorescent group is removed, the remaining group has reactive activity, which will affect the next extension; therefore, a cap reagent is used to block the removed group to reduce or eliminate its reactive activity. Therefore, in the embodiments, "capped dNTP" refers to a dNTP that does not contain a fluorescent group and has a blocking group. For example, the capped dCTP in Table 1 of Example 1 of the present invention.

[0216] Example 1

[0217] Primer extension reaction of virtual terminator

[0218] This example describes the process of using capillary electrophoresis to detect virtual stop bases in solution and incorporate hybridization primers according to the principle of base complementary pairing (L. Greenough et al., 2016).

[0219] Taking the virtual terminator dCTP as an example, the primers and templates of the following sequences are designed:

[0220] Primer sequence: 5'FAM-TACTTTGCCTCCTTCTGCATGGTATTCTTTCTTCCGCACCCAG-3' (SEQ ID NO: 6);

[0221] Template sequence:

[0222] 5'-TATTGATTCTCAAACTTACTCAAAATTAATTTTTAAATAACATTCTAACAAAATACCTCACT

[0223] GGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCA-3' (SEQ ID NO: 7).

[0224] The primers and templates were annealed at a molar ratio of 1:2.5. The annealing process was as follows: on the PCR instrument, the hot cover was set to 98°C; the temperature program was: 95°C for five minutes, then cooled to 4°C within 20 minutes, and placed on ice away from light.

[0225] Prepare the following reaction mixture in a PCR tube (see Table 1).

[0226] Table 1

[0227]

[0228] The reaction was incubated at 37°C for 5 minutes, and EDTA was added to a final concentration of 50 mM to terminate the reaction.

[0229] Among them, the structure of the virtual termination base dNTP is:

[0230]

[0231] The structure of capped dNTP is: Here, Base represents a base.

[0232] The products of the primer extension reaction can be detected using a variety of methods. Examples of test results are Figure 1 As shown, Figure 1 The base types and product types added from top to bottom in the experiment are shown in Table 2. In this example, primer extension products of different lengths are detected by using the 5'FAM-labeled primer fluorescence signal. Since the capped dNTP and virtual stop base used in the experiment are modified bases with a molecular weight greater than that of natural bases, the number of nucleotides calculated in the capillary electrophoresis results will be significantly greater than the actual number.

[0233] Table 2

[0234] Serial number Base type product 1 capped dATP+capped dTTP+capped dGTP Incompletely extended primer 2 capped dATP+capped dTTP+capped dGTP+capped dCTP Fully extended primer 3 capped dATP+capped dTTP+capped dGTP+virtual terminator dCTP Primer extension terminated 4 none Negative control

[0235] From the results, we can see that the combination Figure 1 And from Table 2, we can see that:

[0236] (1) Sequence numbers 1 and 2 in Table 2 indicate that the DNA polymerase used can incorporate capped dNTP into the strand to be tested;

[0237] (2) Sequence number 3 in Table 2 indicates that the DNA polymerase used can incorporate a virtual stop base into the primer, and the primer extension can be terminated by the virtual stop base;

[0238] (3) Sequence number 2 in Table 2 indicates that the process can continue after excision, thus realizing sequencing by synthesis. The capped dNTP here can be a modified base and its analogues that are similar in structure to the virtual termination base but do not carry a fluorescent group and a virtual termination group.

[0239] Furthermore, the reaction system can be further optimized to improve the reaction efficiency, and the optimization aspects include: changing the concentration of components in the reaction buffer, using different one or two divalent metal ions; using additives that can promote base incorporation; in particular, using different types of DNA polymerases and their mutants. In addition, by replacing the template chain, the detection of all four virtual termination base incorporation reactions including the virtual termination base dCTP can be achieved. Furthermore, by changing the DNA polymerase involved in the catalysis, the characterization of the catalytic activity of the DNA polymerase and the screening method of the directed evolution of the DNA polymerase can be achieved.

[0240] Specifically, a usable reaction buffer system is 20 mM Tris-CH3COOH, 50 mM CH3COOK, 10 mM Mg(CH3COO)2, 0.1% tween20, pH 7.9.

[0241] Example 2

[0242] This embodiment describes the process of sequencing by synthesis of a single molecule template sequence or amplification cluster on a solid surface by hybridization of sequencing primers. The method for generating amplification clusters on a solid surface includes but is not limited to thermal cycle amplification, such as bridge PCR amplification, and isothermal amplification, such as template walking amplification CN103370425B, rolling circle amplification US7910354, and recombinase polymerase amplification US20090029421A1. Specifically, the reaction reagent is introduced into the flow channel fixed with the amplification cluster according to the following process, and the flow channel is scanned at a specific step to collect sequencing signals.

[0243] Sequencing primer hybridization: At 55°C, slowly introduce the following reagents into the prepared amplification cluster flow channel in the order of Table 3.

[0244] Table 3

[0245] Serial number Reagent name Volume (μl) Flow rate (μl / min) Reaction time (minutes) 1 Sequencing primers 100 750 15 2 3XSSC 0.1% Tween 300 750 0.1

[0246] After primer hybridization is completed, the sequencing reaction is synthesized: at 55°C, the following reagents are introduced into the flow channel in the order of Table 4.

[0247] Table 4

[0248] Serial number Reagent name Volume (μl) Flow rate (μl / min) Reaction time (minutes) 1 Reaction buffer 100 750 0.1 2 HN reagent 155 750 1 3 CN reagent 155 750 1 4 3XSSC0.1%Tween 300 750 0.1 5 Imaging reagents 155 750 1

[0249] Subsequently, the sequencer is used to scan the channel and continue to perform excision, and the excision process is shown in Table 5.

[0250] Table 5

[0251] Serial number Reagent name Volume (μl) Flow rate (μl / min) Reaction time (minutes) 1 Excision reagent 155 750 1 2 3XSSC 0.1% Tween 300 750 0.1

[0252] Next, the synthesis sequencing-scanning-excision steps are repeated in cycles to obtain continuous sequencing signals.

[0253] Among them, the HN reagent is a virtual terminator base dNTP reagent, which includes a class of fluorescently modified virtual terminator base dNTP (see Example 1 for details) and its corresponding DNA polymerase, and a suitable buffer system; the CN reagent is a terminator capped dNTP reagent without a fluorescent group, which includes a class of efficiently incorporated virtual terminator base capped dNTP and its corresponding DNA polymerase, and a suitable buffer system.

[0254] The HN reagent contains A, T, C and G (concentrations are 0.5-2 μM, respectively), DNA polymerase or mutant, and a buffer system (20 mM Tris-CH3COOH, 50 mM CH3COOK, 10 mM Mg(CH3COO)2, 0.1% tween 20, pH 7.9) with a concentration of 0.005-0.02 U / μL.

[0255] The CN reagent contains A, T, C and G (concentrations are 1 to 5 μM, respectively), DNA polymerase or mutant, and a buffer system (20 mM Tris-CH3COOH, 50 mM CH3COOK, 10 mM Mg(CH3COO)2, 0.1% tween 20, pH 7.9) with a concentration of 0.005 to 0.02 U / μL.

[0256] One or more DNA polymerases or their mutants are used during sequencing. Specifically, the DNA polymerase is a BST DNA polymerase fragment DPO1_GEOSE UniProt ID P52026 (specifically referring to the amino acid sequence shown in SEQ ID NO:2) or a BST DNA polymerase fragment DPO1_ECOLI UniProt ID P00682 (specifically referring to the amino acid sequence shown in SEQ ID NO:1); the DNA polymerase mutant has at least one mutation site among I657, F710 and T794. In particular, compared with the DPO1_GEOSE sequence, the DNA polymerase mutant has at least one mutation site among I657K, F710Y and T794K. Specifically, the DNA polymerase mutant has an amino acid sequence as shown in any one of SEQ ID NOs:3 to 5. The incorporation activity of the DNA polymerase mutant for the virtual termination base can be determined using the method in Example 1. Further, the sequencing reaction in this example can be used for determination.

[0257] The excision reagent used in sequencing is a reducing reagent that can open the disulfide bond of the virtual stop base. Specifically, the reducing reagent can be one or more of TCEP, THPP, DTT or β-mercaptoethanol. The specific ingredients are 0.1-1M Tris, 1-10mM THPP, 0.01-0.1% Tween-20, pH 8-10.

[0258] The imaging reagent used in sequencing is a buffer that can protect the fluorescent group and remove dissolved oxygen. Specifically, the imaging reagent may include a buffer; an oxygen removal system such as glucose oxidase-glucose; an oxidoreductant, etc., and the specific ingredients are 0.1-1M Tris, 0.1-1M NaCl, 20-200mM glucose, 10-50U / ml glucose oxidase, 10-50mM ascorbic acid, 0.01-0.1% Tween20, pH7.0-8.0.

[0259] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0260] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A sequencing method, characterized in that: The method comprises the following steps: (a) placing a mixture of a first nucleic acid template-primer complex, nucleotides or their analogs, and a DNA polymerase under conditions suitable for base extension, allowing the nucleotides or their analogs to bind to the first nucleic acid template-primer complex to obtain an extension product, Wherein, the DNA polymerase is BST DNA polymerase and / or modified BST DNA polymerase; The nucleotide or its analogue has a structure shown in formula (I); Wherein, L1, L2, and L3 are independently a covalent bond or a covalent linking group; B is a base or a base derivative; R1 is -OH, a phosphate group, or a nucleotide or its analog; R2 is H or a cleavable group; R3 is a detectable group or a targeting group; R5 is an inhibitory group; R4 is H or -OR6, wherein R6 is H or a cleavable group; C is a cleavable group or a cleavable bond.

2. A kit, characterized in that: Comprising a nucleotide analogue represented by formula (I) and a DNA polymerase; Wherein, the DNA polymerase is a BST DNA polymerase fragment and / or a modified BST DNA polymerase fragment; The nucleotide or its analogue has a structure shown in formula (I); Wherein, L1, L2, and L3 are independently a covalent bond or a covalent linking group; B is a base or a base derivative; R1 is -OH, a phosphate group, or a nucleotide or its analog; R2 is H or a cleavable group; R3 is a detectable group or a targeting group; R5 is an inhibitory group; R4 is H or -OR6, wherein R6 is H or a cleavable group; C is a cleavable group or a cleavable bond.

3. The method according to claim 1 or the kit according to claim 2, characterized in that The BST DNA polymerase has an amino acid sequence as shown in any one of SEQ ID NOs: 1 to 2; Optionally, compared with the amino acid sequence of the BST DNA polymerase, the amino acid sequence of the modified BST DNA polymerase has at least one amino acid mutation in the following positions or positions functionally equivalent thereto: I657, F710 and T794; Optionally, the amino acid sequence of the modified BST DNA polymerase comprises at least one of the following mutations compared to the amino acid sequence of the BST DNA polymerase: I657K or a mutation functionally equivalent thereto, F710Y or a mutation functionally equivalent thereto, T794K or a mutation functionally equivalent thereto; Optionally, the modified BST DNA polymerase has an amino acid sequence as shown in any one of SEQ ID NOs: 3-5.

4. The method according to claim 1 or 3 or the kit according to claim 2, characterized in that R2 is H, and R4 is H or -OH; Optionally, R5 contains at least one charged group; Optionally, the charged group is selected from at least one of -COOH, -PO4, -SO4, -SO3, -SO2; Optionally, R5 is or -NH-(R 1a )3; Among them, each R 10 With R 11 are independently H or C 1-6 Alkyl, each a and b are independently any integer between 0 and 5; Each R 1a are independently H, -C(O)-NH-(R 1b 2. -C 0-6 Alkylene-C(O)OR 1c or -C 2-6 Alkenylene-Z-H2PO3; Each R 1b Each independently is -C 0-3 Alkylene-C(O)OR 1c ; Each R 1c Each independently is H or C 1-6 alkyl; Z is a nucleoside or an analog thereof; Optionally, each a and b is independently 1 or 2; Optionally, each R 1a Each independently represents H, -C(O)-NH-(-C 0-1 Alkylene -C(O)OH)2, -C 1-2 Alkylene -C(O)OH or -C 2-6 Alkenylene-Z-H2PO3; Optionally, R5 is 5. The method according to claim 1 or 3 or the kit according to claim 2, characterized in that L1, L2 and L3 independently include the following structures: Independent bonds, optionally replaced by one or more R 1d Alkylene, optionally substituted with one or more R 1d Substituted alkenylene, optionally with one or more R 1d Substituted heteroalkylene, optionally with one or more R 1d substituted heteroalkenylene, optionally substituted with one or more R 1d Substituted cycloalkylene, optionally with one or more R 1d Substituted cycloalkenylene, optionally substituted with one or more R 1d Substituted isocycloalkylene, optionally substituted with one or more R 1d Substituted isocycloalkenyl, optionally substituted with one or more R 1d The substituted arylene group and optionally one or more R 1d At least one of substituted heteroarylene groups, and L1, L2 and L3 are not simultaneously selected from independent bonds; Among them, each R 1d Each independently is -OH, C 1-6 Alkyl, halogen, nitro or C 1-6 Haloalkyl; Optionally, L1, L2 and L3 each independently comprise the following structures: Independent bonds, optionally replaced by one or more R 1d Substituted C 1-8 Alkylene, optionally with one or more R 1d Substituted C 2-8 Alkenylene, optionally substituted by one or more R 1d Substituted C 2-8 Heteroalkylene, optionally substituted by one or more R 1d Substituted C 2-8 heteroalkenylene, optionally substituted by one or more R 1d Substituted C 3-8 Cycloalkylene, optionally substituted by one or more R 1d Substituted C 3-8 Isocycloalkylene, optionally substituted by one or more R 1d Substituted C 3-8 Isocycloalkenyl, optionally substituted with one or more R 1d Substituted C 6-10 Arylene or optionally one or more R 1d Substituted C 6-10 Heteroarylene, and L1, L2 and L3 are not simultaneously selected from independent bonds; Optionally, L1, L2 and L3 each independently comprise the following structures: Independent bonds, optionally replaced by one or more R 1d Substituted C 2-6 Alkylene, optionally with one or more R 1d Substituted C 2-6 Alkenylene, optionally substituted by one or more R 1d Substituted C 2-6 Heteroalkylene, optionally substituted by one or more R 1d substituted heteroalkenyl consisting of 2 to 6 backbone atoms, optionally substituted by one or more R 1d Substituted C 3-6 Cycloalkylene, optionally substituted by one or more R 1d Substituted C 3-6 Cycloalkenylene, optionally substituted with one or more R 1d substituted heterocycloalkylene composed of 3 to 6 backbone atoms, optionally substituted by one or more R 1d substituted heterocyclohetero ... 1d Substituted C 6-10 arylene; Optionally, each R 1d Each independently is C 1-6 Alkyl, halogen, nitro or C 1-6 Haloalkyl; Optionally, L1 is selected from at least one of the following: Independent keys, wherein each R7 is independently NH or O, Each p1 is independently any integer between 0 and 10, Each p2 is independently any integer between 0 and 5, Each R8 and R9 is independently selected from H, -CX3, -N3, -CHX2, -CH2X, -CN, -Ph, -C 1-6 Alkyl and C 3～6 At least one of cycloalkyl groups, wherein X is Cl, Br or I; Each p3 is independently any integer between 0 and 4; Preferably, each p1 is independently 1 or 4; Preferably, each p2 is independently 1 or 4; Preferably, each p3 is independently 1 or 2; Optionally, L1 is selected from at least one of the following: Independent keys, Optionally, L2 is selected from at least one of the following: Among them, each R x , R y , R A , R B are independently H, -C 1～6 Alkyl, -C 3-10 Cycloalkyl or -C 5-10 Aryl, each x, y, z is independently any integer between 0 and 6, Preferably, each R x , R y Independently H, -C 3-5 Cycloalkyl, -C 5-6 Cycloalkyl or phenyl; Optionally, L2 is one selected from the following structures: wherein each Ra and Rb are independently H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heteroalkenyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, or substituted or unsubstituted aryl, wherein the substituent is -OH, -CN, halogen, nitro, -C 1-6 Alkyl or C 1-6 Haloalkyl; Optionally, each Ra and Rb are independently H, optionally substituted by one or more R 1e Substituted C 1-6 Alkyl, optionally with one or more R 1e Substituted C 1-6 Heteroalkyl, optionally substituted by one or more R 1e Substituted C 2-6 heteroalkenyl, optionally substituted with one or more R 1e Substituted C 3-6 Cycloalkyl, optionally substituted by one or more R 1e Substituted C 3-6 isocycloalkyl or optionally substituted by one or more R 1e substituted aromatic group consisting of 3 to 6 skeleton atoms, wherein each R 1e are independently -OH, -CN, halogen, nitro, -C 1-6 Alkyl or C 1-6 Haloalkyl; Optionally, L3 is selected from one of the following structures: Wherein, n1, n2, n3, n4, n5, n6 are independently any integer between 0 and 7; Optionally, L3 is selected from one of the following structures: Optionally, -L1-C-L2(R5)-L3- is selected from any of the following structures: Wherein, each n7 is independently selected from any integer from 1 to 7; Preferably, each Ra and Rb is independently H, C 1-3 Alkyl, phenyl.

6. The method according to claim 1 or 3 or the kit according to claim 2, characterized in that C contains at least one of the following groups: optionally with one or more R 1f Substituted ethynyl, optionally with one or more R 1f substituted disulfide bonds, optionally replaced by one or more R 1f Substituted amidoalkyl, optionally with one or more R 1f Alkoxy substituted, optionally with one or more R 1f Substituted straight-chain or branched alkyl, each R 1f are independently -OH, -CN, halogen, nitro, -C 1-6 Alkyl or C 1-6 Haloalkyl; Optionally, C contains at least one of the following groups: Optionally one or more R 1f Substituted ethynyl, optionally with one or more R 1f substituted disulfide bonds, optionally replaced by one or more R 1f Substituted amidoalkyl, optionally with one or more R 1f substituted aryl, optionally substituted with one or more R 1f Alkoxy substituted, optionally with one or more R 1f substituted azido, optionally substituted with one or more R 1f Substituted straight-chain or branched alkyl, each R 1f are independently -OH, -CN, halogen, nitro, -C 1-6 Alkyl or C 1-6 Haloalkyl; Optionally, C contains at least one of the following groups: an acetylene group optionally substituted by a hydroxyl group, a disulfide bond optionally substituted by a hydroxyl group, an amide group optionally substituted by a hydroxyl group, an alkyleneoxy group optionally substituted by a hydroxyl group, an aryl group optionally substituted by a hydroxyl group, an azide group optionally substituted by a hydroxyl group, or a straight or branched alkylene group optionally substituted by a hydroxyl group; Optionally, C is selected from at least one of the following groups: Among them, each R 12 are independently -NH-CO-, -O-, -O-CH(N3)-; Each R 12 are independently -SS-, -O-, -CH=CH-C 1～3 Alkylene-, Each p1 is independently any integer between 0 and 5; Preferably, each p1 is independently 1, 2 or 3; Optionally, C is selected from at least one of the following:

7. The method according to claim 1 or 3 or the kit according to claim 2, characterized in that The nucleotide or its analog has at least one of the following structures: Preferably, each Ra and Rb is independently H, C 1-3 Alkyl, phenyl; Optionally, the nucleotide or its analogue has at least one of the following structural formulas (3) to (10), (14) to (34) and (40) to (92): Where B is a boron atom 8. The method according to claim 1 or 3, characterized in that: The first nucleic acid template-primer complex is connected to a solid support; Optionally, the solid phase carrier is a chip or a microsphere; Optionally, the first nucleic acid template-primer complex is immobilized on a chip or a microsphere; Optionally, step (a) comprises: contacting the first nucleic acid template-primer complex with a mixed solution containing nucleotides or their analogs and DNA polymerase, and allowing the nucleotides or their analogs to bind to the first nucleic acid template-primer complex under conditions suitable for base extension to obtain an extension product; Optionally, the working concentration of the DNA polymerase is 0.005 to 0.02 U / μL; Optionally, the mixed solution includes a buffer, and the buffer contains ammonium ions, magnesium ions, potassium ions and acetate ions; Optionally, the pH of the buffer is 7 to 8.5; Optionally, the buffer further comprises manganese ions; Optionally, the method further comprises: (b) removing free nucleotides or analogs; (c) detecting a detectable signal generated in the nucleotide or its analog; (d) removing a cleavable group in the nucleotide or its analog or severing a cleavable bond in the nucleotide or its analog to obtain a second nucleic acid template-primer complex; (e) repeating steps (a) to (d) at least once; Optionally, step (d) comprises: using a cleavage agent to break a cleavable group or cleavable bond in the nucleotide or its analog; Optionally, C contains an optionally substituted disulfide bond, and the cleavage agent is selected from at least one of TCEP, THPP, DTT and β-mercaptoethanol.

9. The kit according to any one of claims 2 to 7, characterized in that The kit includes HN reagent; Optionally, the kit includes a CN reagent; Optionally, the kit comprises a cleavage reagent, and the cleavage reagent is TCEP / THPP.

10. Use of the kit according to any one of claims 2 to 7 and 9 in nucleic acid sequencing.

Images