A molecular marker primer pair for identifying a gender determination system of a homologous tetraploid crucian carp, a kit and application thereof

By designing specific molecular marker primer pairs and PCR amplification technology, the problem of difficult identification of the sex determination system of homotetraploid crucian carp was solved, realizing rapid, simple and accurate sex determination system identification, applicable to crucian carp at different growth stages, saving time and cost.

CN119372331BActive Publication Date: 2026-04-10HUNAN NORMAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-08
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly, easily, and accurately identify the sex determination system of autotetraploid crucian carp, especially to determine its sex determination mechanism and the evolution of sex chromosomes, which affects breeding and farming strategies.

Method used

A specific molecular marker primer pair (Primer-F and Primer-R) was designed and provided, which, combined with PCR amplification and agarose gel electrophoresis, was used to identify the sex determination system of autotetraploid crucian carp, and the sex determination genotype was determined by detecting specific bands.

Benefits of technology

A rapid, simple, and accurate sex determination system for identifying autotetraploid crucian carp has been developed, saving time and costs. It provides a new technical means applicable to crucian carp at different growth stages and is inexpensive.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119372331B_ABST
    Figure CN119372331B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of fish sex determination system identification, and discloses a molecular marker primer pair for identifying the sex determination system of homologous tetraploid crucian carp, a kit and application. The molecular marker primer pair can not be limited by the growth stage of the homologous tetraploid crucian carp, saves time cost, overcomes the limitation of low evolution degree of sex chromosomes of the homologous tetraploid crucian carp, and also provides a new technical means for determining the sex determination system of fish. The molecular marker primer pair, the kit and the application method are low in cost, simple in operation, rapid, accurate, and can be applied to identifying the sex determination system of homologous tetraploid crucian carp, providing a more convenient method for determining the sex determination system of homologous tetraploid crucian carp. Meanwhile, the molecular marker primer pair can also be used for identifying the sex of the androgenetic offspring of the homologous tetraploid crucian carp.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of fish sex determination system identification technology, specifically relating to a molecular marker primer pair, reagent kit, and method for identifying the sex determination system of homotetraploid crucian carp. Background Technology

[0002] As a type of lower vertebrate, fish possess a sex determination system encompassing almost all types of sex chromosomes found in vertebrates. Currently, it is generally believed that there are six main types of sex determination in fish, including XY, ZW, XO, ZO, and duochromosome types. These sex chromosome types reflect the genetic basis of sex determination in fish, where sex chromosomes, sex-determining genes, and endocrine hormones work together to determine the sex of the fish. Sex determination is an important characteristic for aquatic organisms, especially fish. Currently, commonly used methods for determining sex determination systems include chromosome karyotype analysis and fluorescence in situ hybridization (FISH); however, as a lower vertebrate, fish have a low degree of sex chromosome differentiation, making it difficult to distinguish sex determination systems through karyotype analysis and FISH. Therefore, developing specific molecular markers to determine sex determination types is crucial for understanding the sex determination mechanism in fish and optimizing fish farming strategies, leading to a better understanding of fish biological characteristics and ecological adaptations, and providing a scientific basis for aquaculture, conservation, and management.

[0003] Autotetraploid crucian carp (Autotetraploid) Carassius auratus , 4n=200) originated from the mother red crucian carp ( Carassius auratus red var., 2n=100) and the parent species, the blunt-headed bream ( Megalobrama amblycephala The red tetraploid crucian carp, through distant hybridization between subfamilies (2n=48), possesses four sets of red crucian carp chromosomes. Due to the complexity of the entire genome of the red tetraploid crucian carp, it is difficult to determine its sex determination system. Current techniques have not been able to directly or indirectly prove the sex determination mechanism of the red tetraploid crucian carp, nor have they determined the existence of aberrant sex chromosomes, making it impossible to identify its sex determination system from a cytological perspective. These problems greatly hinder breeding, aquaculture, and related basic genetic research, especially research on sex chromosome evolution and the molecular mechanisms of sex determination. Therefore, developing specific molecular markers to identify the sex determination system of the red tetraploid crucian carp is an important means of identifying sex chromosomes, studying sex determination and sex chromosome evolution mechanisms, and revealing the sex determination mechanism of the red tetraploid crucian carp. This will help understand its genetic background and provide a reference for the study of sex determination in other fish species. Summary of the Invention

[0004] The technical problem solved by the present application is to overcome the deficiencies and defects mentioned in the above background art, and to provide a specific molecular marker primer pair, kit and method for quickly, simply and accurately identifying the gender determination system of homologous tetraploid crucian carp.

[0005] To solve the above technical problems, the technical solution provided by the present application is:

[0006] In a first aspect, the present application provides a molecular marker primer pair for identifying the gender determination system of homologous tetraploid crucian carp, which comprises an upstream forward primer Primer-F and a downstream reverse primer Primer-R, and the nucleotide sequences thereof are:

[0007] Primer-F: 5'-AACTGGGCTCCATTGACGAG-3' (SEQ ID NO. 2),

[0008] Primer-R: 5'-GCACGTACTCCCTAAGCTCT-3' (SEQ ID NO. 3).

[0009] In a second aspect, the present application provides a kit for identifying the gender determination system of homologous tetraploid crucian carp, comprising the molecular marker primer pair.

[0010] Preferably, the kit further comprises one or more of Tag DNA Polymerase, extension promoting factor, dNTP, buffer system and ddH2O.

[0011] In a third aspect, the present application provides a use of the molecular marker primer pair or the kit in identifying the gender determination system of homologous tetraploid crucian carp.

[0012] In a fourth aspect, the present application provides a method for identifying the gender determination system of homologous tetraploid crucian carp, comprising the following steps:

[0013] (1) Taking the DNA sample of the homologous tetraploid crucian carp to be tested, the homologous tetraploid crucian carp gynogenetic individual or / and the homologous tetraploid crucian carp androgenetic individual as a template, respectively, and using the molecular marker primer pair to perform PCR amplification, and reading the results of agarose gel electrophoresis;

[0014] (2) In the homologous tetraploid crucian carp to be tested, two bands with lengths of 244 bp and 218 bp appear in the electrophoresis results of male individuals, and a specific band with a length of 218 bp appears in the electrophoresis results of female individuals;

[0015] In the female offspring of the test homologous tetraploid crucian female-nucleus development, if a specific band with a length of 218 bp appears in the electrophoresis result of the female offspring, it indicates that the sex determination genotype of the test homologous tetraploid crucian female-nucleus development offspring is X type.

[0016] In the male offspring of the test homologous tetraploid crucian male-nucleus development, if a specific band with a length of 244 bp appears in the electrophoresis result, it indicates that the sex determination genotype of the test male homologous tetraploid crucian male-nucleus development offspring is Y type; in the female test homologous tetraploid crucian male-nucleus development offspring, if a specific band with a length of 218 bp appears in the electrophoresis result, it indicates that the sex determination genotype of the test female homologous tetraploid crucian male-nucleus development offspring is X type.

[0017] If the electrophoresis results of the female and male individuals of the test homologous tetraploid crucian and the homologous tetraploid crucian female-nucleus development offspring all meet, it is determined that the sex determination system of the test homologous tetraploid crucian is XY type.

[0018] The method, preferably, the PCR system for PCR amplification is 25 μL; specifically, 1.5 μL of DAN template, 12.5 μL of Rapid Taq Master Mix, 1.0 μL of forward and reverse primers, and finally 9.0 μL of ddH2O; the Rapid Taq Master Mix contains Tag DNA Polymerase, extension promoting factor, dNTP and buffer system.

[0019] More preferably, the PCR amplification conditions are as follows: 95 ℃ pre-denaturation for 3 min, 95 ℃ denaturation for 15 s, 53 ℃ annealing for 15 s, 72 ℃ extension for 15 s, 35 cycles, then 72 ℃ final extension for 5 min, and finally 4 ℃ preservation.

[0020] More preferably, the concentration of the agarose gel is 3.0%, the voltage is 220 V, the current is 120 mA, and the running time is 15-20 min.

[0021] The present application has at least the following beneficial effects:

[0022] 1. The molecular marker primer pair for identifying the sex determination system of the homologous tetraploid crucian provided by the present application can be used without being limited by the growth stage of the homologous tetraploid crucian, saving time and cost, overcoming the limitation of low evolution degree of sex chromosomes of the homologous tetraploid crucian, and also providing a new technical means for determining the sex determination system of fish.

[0023] 2、The molecular marker primer pair, kit and method provided by the application are low in cost, simple in operation, rapid and accurate, can be applied to identifying the gender determination system of homologous tetraploid crucian carp, provide a more convenient method for determining the gender determination system of homologous tetraploid crucian carp, and the molecular marker primer pair can also be used for identifying the gender of the androgenetic offspring of homologous tetraploid crucian carp. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0025] Figure 1 In order to verify the gender determination system of homologous tetraploid crucian carp in the sequence design of the primer pair of the homologous tetraploid crucian carp sex difference gene sequence diagram.

[0026] Figure 2 In order to use the gender determination specific molecular marker of homologous tetraploid crucian carp for detecting the specific amplification fragment of homologous tetraploid crucian carp and gynogenesis offspring in the PCR agarose gel electrophoresis diagram.

[0027] Figure 3 In order to use the gender determination specific molecular marker of homologous tetraploid crucian carp for detecting the specific amplification fragment of homologous tetraploid crucian carp and gynogenesis offspring in the PCR agarose gel electrophoresis diagram.

[0028] Figure 4 In order to verify the gender determination system of homologous tetraploid crucian carp in the sequence design of the primer pair of the homologous tetraploid crucian carp sex difference gene sequence diagram. DETAILED DESCRIPTION

[0029] In order to facilitate the understanding of the present application, the following will combine the drawings in the specification and the preferred embodiments to make a more comprehensive and detailed description of the present application, but the protection scope of the present application is not limited to the following specific embodiments.

[0030] Unless otherwise defined, all the professional terms used in the following have the same meaning as generally understood by those skilled in the art. The professional terms used in this paper are only for the purpose of describing the specific embodiments, and are not intended to limit the protection scope of the present application.

[0031] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.

[0032] The method for identifying the gender determination system of homologous tetraploid crucian carp in the following embodiments comprises the following steps:

[0033] (1) Design and synthesis of specific molecular markers of the sex determination system of homologous tetraploid crucian carp;

[0034] (2) Design and synthesis of the primer pair (synthesized by Genesky Biotechnology Co., Ltd.);

[0035] (3) Preparation of DNA of homologous tetraploid crucian carp individuals, homologous tetraploid gynogenesis offspring and androgenesis offspring;

[0036] (4) Using the DNA extracted in step (3) as a template, PCR amplification is performed using the primer pair provided in the present application, and then the PCR product is detected using 3.0% agarose gel electrophoresis;

[0037] (6) In the homologous tetraploid crucian carp, if the result of the agarose gel electrophoresis shows two bands of different lengths in the male individuals and one shorter specific band in the female individuals; in the gynogenesis offspring of the homologous tetraploid crucian carp, the result of the agarose gel electrophoresis shows one shorter specific band; in the androgenesis offspring of the homologous tetraploid crucian carp, if the result of the agarose gel electrophoresis shows a single shorter specific band, it indicates that the sex determination genotype of the female homologous tetraploid crucian carp androgenesis offspring to be detected is X type; in the male homologous tetraploid crucian carp and the male androgenesis offspring, if the result of the agarose gel electrophoresis shows a single longer specific band, it indicates that the sex determination genotype of the male homologous tetraploid crucian carp androgenesis offspring to be detected is Y type; thus, the sex determination system of the homologous tetraploid crucian carp is determined to be XY type according to the above results.

[0038] Example 1:

[0039] A molecular marker primer pair for identifying the sex determination system of homologous tetraploid crucian carp, which is obtained by the following development process:

[0040] 1. Design a molecular marker primer pair for the sex determination system of homologous tetraploid crucian carp

[0041] Based on the male homologous tetraploid individual, there is a 26 bp (GGTTCAATAATGACTGATCACAGGTT, see SEQ ID NO. 1) insertion between the 22647031 and 22647032 bases on the Chr46B chromosome. The primer pair is designed upstream and downstream of the position. First, the nucleotide sequence of the region is extracted using samtools software (version number: 1.20), and then the primer is designed using the NCBI online tool (Primer-BLAST: https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The reference gene sequence of the designed primer is as shown in Figure 1 ;

[0042] 2. Primer synthesis

[0043] The designed forward and reverse primers, the upstream forward primer is numbered Primer-F: 5'-AACTGGGCTCCATTGACGAG-3', and the nucleotide sequence is as shown in SEQ ID NO. 2; the downstream reverse primer is numbered Primer-R: 5'-GCACGTACTCCCTAAGCTCT-3', and the nucleotide sequence is as shown in SEQ ID NO. 3. The primer is synthesized by Genescript Biotech Co., Ltd.

[0044] 3. Phenotypic sex determination

[0045] In the breeding season, the sex of the mature homologous tetraploid crucian carp individuals and the gynogenesis offspring is identified. The male homologous tetraploid crucian carp individuals can squeeze out sperm, and the female homologous tetraploid crucian carp individuals and the gynogenesis individuals can squeeze out eggs. After the sex is determined, the tail fins are cut and fixed and preserved with anhydrous ethanol. Ten homologous tetraploid crucian carp individuals and gynogenesis offspring are taken for verification.

[0046] 4. Genomic DNA extraction

[0047] Using the above cut tail fins, the female and male individuals are numbered respectively; the male individuals are numbered M1-M10, the female individuals are numbered F1-F10, and the gynogenesis offspring individuals are numbered CF1-CF10; then the genomic DNA extraction kit produced by Genescript Biotech Co., Ltd. is used for DNA extraction, and the steps are operated according to the manufacturer's instructions to prepare DNA samples; after extraction, the DNA concentration and quality are detected, and the Qubit fluorescence spectrometer is used for DNA concentration detection and 1% agarose gel electrophoresis detection.

[0048] 5. Verification of specific molecular markers of the homologous tetraploid sex determination system, the specific steps are as follows:

[0049] (1) Using the extracted DNA to verify the molecular marker;

[0050] (2) PCR reaction system, the total reaction system is 25 μL, specifically: DAN template 1.5 μL, Rapid Taq Master Mix (containing Tag DNA Polymerase, extension promoting factor, dNTP and optimized buffer system) 12.5 μL, 1.0 μL of forward and reverse primers respectively, and finally adding ddH2O 9.0 μL, after adding, centrifugation and mixing;

[0051] (3) PCR reaction program: 95 ℃ pre-denaturation 3 min, 95 ℃ denaturation 15 s, 53 ℃ annealing 15 s, 72 ℃ extension 15 s, 35 cycles, then 72 ℃ final extension 5 min, finally 4 ℃ preservation;

[0052] (4) Agarose gel electrophoresis detection and result analysis: the PCR product is subjected to 3.0% agarose gel electrophoresis, the voltage is 220 V, the current is 120 mA, and the running time is 18 min; the results are shown in Figure 2 and Figure 3 As shown, two bright bands (one with a length of 244 bp and the other with a length of 218 bp) can be amplified in all male homologous tetraploid crucian carp individuals, only a single bright shorter band (length 218 bp) can be amplified in female homologous tetraploid crucian carp individuals, and only a single bright shorter band (length 218 bp) can be amplified in homologous tetraploid crucian carp gynogenesis individuals.

[0053] 6. Verification of the molecular marker or primer pair of the sex determination system of homologous tetraploid crucian carp in homologous tetraploid crucian carp androgenetic offspring, the specific steps are as follows:

[0054] (1) Sex identification of homologous tetraploid androgenetic offspring

[0055] Similarly, in the breeding season, sex mature homologous tetraploid androgenetic offspring individuals are selected for female and male sex identification, according to the male individuals can squeeze sperm, and the female individuals can squeeze eggs. After the sex is determined, the tail fins are cut and fixed and preserved with anhydrous ethanol, and 10 tails of each sex are used for verification.

[0056] (2) Extraction of genomic DNA of homologous tetraploid androgenetic offspring individuals

[0057] First, number the 10 tails of each sex, the male individuals are numbered as XM1-XM10, and the female individuals are numbered as XF1-XF10; then extract the genomic DNA of each individual according to the method of point 5.

[0058] (3) The identification of the sex determination system of the homologous tetraploid crucian carp is carried out, and the specific steps are as follows: the extracted DNA is used to verify the molecular marker; the PCR reaction system, the PCR reaction procedure and the 5th point are the same; the agarose gel electrophoresis detection and result analysis: the PCR product is subjected to 3.0% agarose gel electrophoresis, the voltage is 220 V, the current is 120 mA, and the running time is 18 min.

[0059] The results are shown in the following table: Figure 4 If the result of agarose gel electrophoresis shows a single long specific band (length 244 bp), it indicates that the sex determination genotype of the male individual in the tested male-nucleus development offspring is Y type; if the result of agarose gel electrophoresis shows a single short specific band (length 218 bp), it indicates that the sex determination genotype of the female individual in the tested male-nucleus development offspring is X type; combined with the RCR amplification results of the molecular marker primer pair in the homologous tetraploid crucian carp male and female individuals and the female-nucleus development offspring of the homologous tetraploid crucian carp, it is determined that the sex determination system of the homologous tetraploid crucian carp is XY type.

[0060] In summary, based on the inserted sequence in the male individual of the homologous tetraploid crucian carp, the primers are designed on the upstream and downstream sequences of the inserted sequence; the PCR experiment is verified in the homologous tetraploid crucian carp male and female individuals, the female-nucleus development and male-nucleus development offspring; then the agarose gel electrophoresis experiment is carried out, and finally the sex determination system of the homologous tetraploid crucian carp is determined to be XY type. The specific molecular marker primer pair provided by the application for identifying the sex determination system of the homologous tetraploid crucian carp can determine the sex determination system of the homologous tetraploid crucian carp, and provides a stable, accurate and efficient method for solving this problem. In addition, the molecular marker primer pair developed by the application can also identify the genetic sex of the male-nucleus development offspring; the sexual maturity of the male-nucleus development offspring of the homologous tetraploid crucian carp is two ages, and the molecular marker primer pair also saves time for the selection of the male-nucleus development offspring.

Claims

1. The application of a molecular marker primer pair in a sex determination system for identifying autotetraploid crucian carp, characterized in that, The molecular marker primers include the following molecular marker primer pairs: Primer-F: 5'-AACTGGGCTCCATTGACGAG-3', Primer-R: 5'-GCACGTACTCCCTAAGCTCT-3'; The method of application includes the following steps: (1) Using DNA samples from the target homotetraploid crucian carp, the female-developed homotetraploid crucian carp and / or the male-developed homotetraploid crucian carp as templates, PCR amplification was performed using the aforementioned molecular marker primer pair, and the agarose gel electrophoresis results were read. The PCR amplification system was 25 μL; specifically: 1.5 μL of DNA template, 12.5 μL of Rapid Taq Master Mix, 1.0 μL each of forward and reverse primers, and finally 9.0 μL of ddH2O was added. (2) In the autotetraploid crucian carp to be tested, the electrophoresis results of male individuals showed two bands with lengths of 244 bp and 218 bp, respectively, while the electrophoresis results of female individuals showed a specific band with a length of 218 bp. If a specific band of 218 bp appears in the electrophoresis results of the female offspring of the homotetraploid crucian carp undergoing gynogenesis, it indicates that the sex-determining genotype of the female offspring of the homotetraploid crucian carp undergoing gynogenesis is X. If a specific band of 244 bp appears in the electrophoresis results of the male homotetraploid crucian carp androgen-developed offspring, it indicates that the sex-determining genotype of the male homotetraploid crucian carp androgen-developed offspring is Y-type; if a specific band of 218 bp appears in the electrophoresis results of the female homotetraploid crucian carp androgen-developed offspring, it indicates that the sex-determining genotype of the female homotetraploid crucian carp androgen-developed offspring is X-type. If the electrophoretic results of the male and female individuals of the autotetraploid crucian carp to be tested, as well as the female offspring of the autotetraploid crucian carp, are all consistent, then the sex determination system of the autotetraploid crucian carp to be tested is determined to be XY type.

2. The method according to claim 1, characterized in that, The Rapid Taq Master Mix contains TagDNA Polymerase, elongation-promoting factor, dNTPs, and a buffer system.

3. The method according to claim 1, characterized in that, The PCR amplification conditions were as follows: 95 °C pre-denaturation for 3 min, 95 °C denaturation for 15 s, 53 °C annealing for 15 s, 72 °C extension for 15 s, 35 cycles, followed by a final extension at 72 °C for 5 min, and finally storage at 4 °C.

4. The method according to claim 1, characterized in that, The concentration of the agarose gel is 3.0-3.5% by mass.

Citation Information

Patent Citations

  • Molecular marker, primer pair, kit and method for identifying sex of autotetraploid crucian carp

    CN117431307A