Use of n-acetylglycine in the preparation of a drug for preventing and treating radiation-induced lung injury

By using N-acetylglycine in radiation-induced lung injury drugs, the problem of lack of effective treatment for radiation-induced lung injury has been solved. Through cellular and body administration, the symptoms of radiation-induced pneumonia and pulmonary fibrosis have been significantly improved, thereby enhancing the treatment effect.

CN119385998BActive Publication Date: 2025-10-14ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411575541.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-06
Publication Date
2025-10-14
Estimated Expiration
2044-11-06

AI Technical Summary

Technical Problem

Existing technologies lack effective drugs for preventing and treating radiation-induced lung injury, especially radiation pneumonitis and radiation-induced pulmonary fibrosis, resulting in severe clinical symptoms and no effective treatment options.

Method used

N-acetylglycine is used as the active ingredient, and a mixed solvent of DMSO, PEG3000, Tween-80 and ddH2O is used to prepare a drug for preventing and treating radiation-induced lung injury through cell administration and system administration. It significantly improves the inflammatory factors, ROS production and cell death of lung epithelial cells caused by ionizing radiation.

Benefits of technology

In in vitro cell experiments and animal models, N-acetylglycine significantly reduced the increase in inflammatory factors IL-1β and TGF-β in lung epithelial cells induced by ionizing radiation, reduced ROS production, reduced ferroptosis and copper death, improved the symptoms of radiation pneumonia and pulmonary fibrosis, and improved the quality of life of mice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119385998B_ABST
    Figure CN119385998B_ABST
Patent Text Reader

Abstract

The application provides application of N-acetylglycine in preparation of a medicine for preventing and treating radiation-induced lung injury, and belongs to the technical field of biological medicine. The application provides application of N-acetylglycine in preparation of a medicine for preventing and / or treating radiation-induced lung injury. The application proves that N-acetylglycine can improve the occurrence of cell ferroptosis and cupric death caused by ionizing radiation by using a cell experiment. The application proves that N-acetylglycine has a potential effect of improving radiation-induced lung injury by using a mouse experiment.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of N-acetylglycine in preparation of a medicine for preventing and treating radiation-induced lung injury. BACKGROUND

[0002] Radiation-induced lung injury (RILI) is a common complication of chest tumor radiotherapy, and is clinically divided into early radiation-induced pneumonia and late radiation-induced pulmonary fibrosis (RIPF). Clinical symptoms include vomiting, shortness of breath, chest pain, fever, and even respiratory failure and death. Since RILI lacks effective treatment drugs, finding a drug intervention target with diagnostic potential has very important clinical application value for the prevention and treatment of radiation-induced lung injury. Body fluid samples such as serum and feces can be used as important sample sources for disease diagnosis and treatment evaluation due to their easy availability and abundance. Screening of serum markers with diagnostic and therapeutic potential based on metabolomics has research significance for the prevention and treatment of radiation-induced lung injury. SUMMARY

[0003] The application provides application of N-acetylglycine in preparation of a medicine for preventing and treating radiation-induced lung injury, and confirms that the N-acetylglycine has a potential effect of improving radiation-induced lung injury.

[0004] The application aims to provide application of N-acetylglycine in preparation of a medicine for preventing and / or treating radiation-induced lung injury.

[0005] In one specific embodiment of the application, the working concentration of N-acetylglycine in the medicine for radiation-induced lung injury is not less than 10 μM.

[0006] In one specific embodiment of the application, the administration mode of the medicine for radiation-induced lung injury includes cell administration and body administration.

[0007] In one specific embodiment of the application, when the cell administration is performed, DMSO is used as a solvent, and the working solution concentration is 10-40 μM.

[0008] In one specific embodiment of the application, when the body administration is performed, 0.2 mg of the N-acetylglycine is administered each time for a mouse.

[0009] In one specific embodiment of the application, when the body administration is performed, a mixed solution of DMSO, PEG3000, Tween-80 and ddH2O is used as a solvent.

[0010] In one embodiment of the present application, the solvent comprises 5% DMSO, 40% PEG300, 5% Tween-80 and 50% ddH2O by volume percentage.

[0011] Another object of the present application is to provide a medicament for preventing and / or treating radiation-induced lung injury, comprising N-acetylglycine and a pharmaceutically acceptable excipient.

[0012] Beneficial effects: The present application provides the use of N-acetylglycine in the preparation of a medicament for preventing and / or treating radiation-induced lung injury. In the examples, 10 μM N-acetylglycine was administered immediately before 10 Gy γ-ray irradiation of lung epithelial cells (A549), and the cells were cultured for 48 h after irradiation to observe changes in inflammatory factors IL-1β, TGF-β, ROS production, and the occurrence of ferroptosis and cuprizone death. The results showed that N-acetylglycine can improve the occurrence of ferroptosis and cuprizone death caused by ionizing radiation. In the present application, radiation pneumonia occurred in mice irradiated with 20 Gy γ-rays for 14 days, 30 days, and radiation-induced pulmonary fibrosis occurred in mice irradiated for 120 days. However, after administration of NAGly, the damage was improved. Metabolomics analysis results showed that the content of N-acetylglycine in the feces of 1-month and 4-month mice was significantly increased, confirming that N-acetylglycine has a potential effect on improving radiation-induced lung injury. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 Results graph for N-acetylglycine improving the increase of inflammatory factors in human lung epithelial cells A549 caused by ionizing radiation;

[0014] Figure 2 Results graph for N-acetylglycine improving the increase of ROS in human lung epithelial cells A549 caused by ionizing radiation;

[0015] Figure 3 Results graph for N-acetylglycine improving the occurrence of ferroptosis and cuprizone death in human lung epithelial cells A549 caused by ionizing radiation;

[0016] Figure 4 Graph of changes in body weight and lung coefficient of mice after irradiation;

[0017] Figure 5 Results graph of inflammatory infiltration of lung cells in mice after irradiation;

[0018] Figure 6 Results graph of respiratory function detection of mice fed for 14 days, 30 days, and 120 days after irradiation. DETAILED DESCRIPTION

[0019] The application aims to provide an application of N-acetylglycine in preparing a medicine for preventing and treating radiation-induced lung injury.

[0020] The N-acetylglycine has a CAS number of 543-24-8 and a molecular formula of C4H7NO3.

[0021] In one specific embodiment of the application, the administration mode of the medicine for radiation-induced lung injury includes cell administration and body administration. In the cell administration, DMSO is used as a solvent, and the working solution has a concentration of 10-40 μM. In the preparation of the cell administration solution, first, a 60 mM N-acetylglycine stock solution is prepared, for example, 7.026 mg of N-acetylglycine is dissolved in 1 mL of DMSO to obtain a 60 mM stock solution; then the stock solution is diluted with DMSO, for example, 10 μL of the 60 mM stock solution is dissolved in 50 μL of DMSO to obtain a 10 mM solution; in the administration, 10 mM of the solution and the culture medium are mixed at a volume ratio of 1:1000 to obtain a 10 μM N-acetylglycine working solution; the lung epithelial cells (A549) are administered with 10 μM N-acetylglycine immediately before being irradiated with 10 Gy of γ-rays; and the cells are cultured for 48 hours after the irradiation, and then sampled and observed for the changes of inflammatory factors IL-1β and TGF-β, ROS production and the occurrence of cell copper death and iron death. The results show that N-acetylglycine can improve the increase of inflammatory factors IL-1β and TGF-β, the increase of ROS and the occurrence of cell copper death and iron death caused by ionizing radiation.

[0022] In one specific embodiment of the application, in the body administration, 0.2 mg of N-acetylglycine is administered to a mouse per day. The body administration mode can be gavage as in the examples, and in the gavage of the mouse, a mixture of DMSO, PEG3000, Tween-80 and ddH2O is used as a solvent. In the examples of the application, the solvent includes 5% DMSO, 40% PEG300, 5% Tween-80 and 50% ddH2O in terms of volume percentage. In the preparation of the gavage agent, first, a 0.02 mg / μL N-acetylglycine stock solution is prepared, for example, 0.02 mg of N-acetylglycine is dissolved in 1 μL of DMSO to obtain a 0.02 mg / μL stock solution; then a N-acetylglycine reagent (NAGly) is prepared, which includes 5% N-acetylglycine stock solution, 40% PEG300, 5% Tween-80 and 50% ddH2O in terms of volume percentage; and 200 μL of the reagent is administered to each mouse per gavage. The examples of the application show that the content of N-acetylglycine in the feces of a mouse irradiated with 20 Gy of γ-rays for one month and a mouse irradiated with 20 Gy of γ-rays for four months is significantly increased, which proves that N-acetylglycine has a potential effect of improving radiation-induced lung injury.

[0023] Another object of the present application is to provide a medicine for preventing and / or treating radiation-induced lung injury, comprising N-acetylglycine and a pharmaceutically acceptable excipient.

[0024] The present application does not have special limitations on the type and amount of the excipient, and the medicine can be prepared by adding and preparing the excipient using conventional excipients in the art.

[0025] In order to further illustrate the present application, the application of N-acetylglycine provided by the present application in the preparation of a medicine for preventing and / or treating radiation-induced lung injury is described in detail below in conjunction with examples, but they should not be understood as limiting the scope of protection of the present application.

[0026] Example 1 Cell Experiment

[0027] Acetylglycine stock solution (60 mM): 7.026 mg of N-acetylglycine solid was dissolved in 1 mL of DMSO;

[0028] N-acetylglycine working solution (10 mM): 10 μL of 60 mM stock solution was dissolved in 50 μL of DMSO to obtain a 10 mM working solution;

[0029] Complete medium: DMEM: fetal bovine serum: double antibody = 0.94:0.05:0.01.

[0030] During the experiment, 10 μM of N-acetylglycine solution was prepared according to the ratio of working solution: complete medium = 1:1000, and 10 μM of N-acetylglycine was immediately administered to lung epithelial cells (A549) before 10 Gy γ-ray irradiation. After irradiation, the cells were cultured for 48 h, and the changes in cell inflammatory factors IL-1β, TGF-β, ROS production, and cell ferroptosis and cuprizone were observed.

[0031] Cell inflammatory factor expression determination primer sequences:

[0032] h actinF (SEQ ID No. 1): gacctgtacgccaacacag;

[0033] h actinR (SEQ ID No. 2): ctcaggaggagcaatgatc;

[0034] h IL1-βF1 (SEQ ID No. 3): GCCAGTGAAATGATGGCTTATT;

[0035] h IL1-βR1 (SEQ ID No. 4): AGGAGCACTTCATCTGTTTAGG;

[0036] hTGF-β1 F1 (SEQ ID No. 5): CTGTACATTGACTTCCGCAAG;

[0037] hTGF-β1 R1 (SEQ ID No. 6): TGTCCAGGCTCCAAATGTAG.

[0038] The changes of cell inflammatory factors IL-1β and TGF-β are as shown in Figure 1 N-acetylglycine improves the increase of lung epithelial cell inflammatory factors caused by ionizing radiation.

[0039] ROS production was detected by the Bicun ROS detection kit, and the results are as shown in Figure 2 N-acetylglycine improves the increase of lung epithelial cell reactive oxygen species caused by ionizing radiation.

[0040] The occurrence of cell ferroptosis and cuproptosis is as shown in Figure 3 N-acetylglycine improves the occurrence of lung epithelial cell ferroptosis and cuproptosis caused by ionizing radiation.

[0041] Example 2 Mouse Experiment

[0042] The experiment was divided into three groups:

[0043] NC+solvent (NC+Vehicle) group: normal purchase seven-week-old male C57BL / 6J mice were adaptively fed in SPF environment for one week, and then 0.2 mg per mouse was fed once a day with solvent;

[0044] IR+solvent (IR+Vehicle) group: normal purchase seven-week-old male C57BL / 6J mice were adaptively fed in SPF environment for one week, and then 20Gy γ-ray whole chest local irradiation was performed once, and 0.2 mg per mouse was fed once a day with solvent;

[0045] IR+N-acetylglycine reagent (IR+NAGly) group: normal purchase seven-week-old male C57BL / 6J mice were adaptively fed in SPF environment for one week, and then 20Gy γ-ray whole chest local irradiation was performed once, and 0.2 mg per mouse was fed once a day with solvent;

[0046] Among them, the solvent (Vehicle): 5% DMSO+40% PEG300+5% Tween-80+50% ddH2O;

[0047] N-acetylglycine reagent (NAGly, IR): 5% N-acetylglycine stock solution+40% PEG300+5% Tween-80+50% ddH2O (200 μL per mouse);

[0048] N-acetylglycine stock solution: 0.02 mg N-acetylglycine was dissolved in 1 μL DMSO to obtain a stock solution of 0.02 mg / μL.

[0049] Experimental procedure:

[0050] I. 15-day sample collection

[0051] NC+Vehicle group: After one week of adaptive feeding, the solvent was administered once a day for 14 times;

[0052] IR+Vehicle group: After one week of adaptive feeding, 20 Gy of γ-ray whole chest local irradiation was performed once, and immediately after irradiation, the solvent was administered once a day for a total of 14 times;

[0053] IR+NAGly group: After one week of adaptive feeding, 20 Gy of γ-ray whole chest local irradiation was performed once, and immediately after irradiation, NAGly was administered once a day for a total of 14 times;

[0054] The experimental period was 14 days for sample collection, and the mouse fur color, body weight, lung coefficient, lung tissue HE, and Masson staining results were observed.

[0055] II. 30-day sample collection

[0056] NC+Vehicle group: After one week of adaptive feeding, the solvent was administered once a day for 30 times;

[0057] IR+Vehicle group: After one week of adaptive feeding, 20 Gy of γ-ray whole chest local irradiation was performed once, and immediately after irradiation, the solvent was administered once a day for a total of 30 times;

[0058] IR+NAGly group: After one week of adaptive feeding, 20 Gy of γ-ray whole chest local irradiation was performed once, and immediately after irradiation, NAGly was administered once a day for a total of 30 times;

[0059] The experimental period was 30 days for sample collection, and the mouse fur color, body weight, lung coefficient, lung tissue HE, and Masson staining results were observed.

[0060] III. 120-day sample collection

[0061] NC+Vehicle group: After one week of adaptive feeding, the solvent was administered once a day for 30 times for a total of 30 days, and then normally fed for 90 days;

[0062] IR+Vehicle group: After one week of adaptive feeding, 20 Gy of γ-ray whole chest local irradiation was performed once, and immediately after irradiation, the solvent was administered once a day for a total of 30 times for a total of 30 days, and then normally fed for 90 days;

[0063] IR+NAGly group: after adaptive feeding for one week, the mice were locally irradiated with 20Gy γ-rays, and then immediately administered with NAGly once a day for 30 days, and then normally fed for 90 days.

[0064] The results of the changes in the body weight of the mice are shown in Table 1. Figure 4 As shown in Table 1, the body weight of the mice decreased sharply seven days after irradiation, and the degree of the decrease was alleviated after administration of NAGly. Figure 4 As shown in Table 2, the lung coefficient of the mice increased after irradiation, and the damage was alleviated after administration of NAGly.

[0065] The results of the inflammatory infiltration of the lung cells of the mice after irradiation are shown in Table 3. Figure 5 As shown in Table 3, NAGly can improve the inflammatory infiltration and fibrosis of the lung tissue of the mice caused by ionizing radiation.

[0066] The results of the respiratory function detection indexes are shown in Table 4. Figure 6 As shown in Table 4, MV refers to minute ventilation, and TV refers to tidal volume. The same indexes have different values due to the differences in the detection instruments for the mice of 14 days and 1 month and the mice of 4 months.

[0067] The above results show that the mice developed radiation pneumonitis 14 days and 30 days after irradiation, and developed radiation fibrosis 120 days after irradiation, and the damage was improved after administration of NAGly.

[0068] Although the above embodiment has described the present application in detail, it is only a part of the embodiments of the present application, but not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. Use of N-acetylglycine in the preparation of drugs for preventing and / or treating radiation-induced lung injury.

Citation Information

Patent Citations

  • Environmental protection synthetic method of N-acetoglycocol

    CN101284798A

  • Production method of N-acetoglycocoll

    CN101735097A